CRISPR and RNAi Platforms for Genome- Wide Loss-of-Function Screens AACR April 21, 2015

Size: px
Start display at page:

Download "CRISPR and RNAi Platforms for Genome- Wide Loss-of-Function Screens AACR April 21, 2015"

Transcription

1 CRISPR and RNAi Platforms for Genome- Wide Loss-of-Function Screens AACR April 21, 2015 Paul Diehl, Ph.D. Director of Business Development Cellecta, Inc. Mountain View, CA

2 Cellecta Overview Founded: April 2006 Started Operations in July 2007 Headquarters: Mountain View, CA 12 SBIR Grants Network of collaborators (primarily cancer-related) Focuses on the development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization of novel therapeutic targets for drug discovery.

3 Public Collaborations Khorashad JS, et al. (2015) "shrna library screening identifies nucleocytoplasmic transport as a mediator of BCR-ABL1 kinase-independent resistance." Blood Jan 8 (125) DOI: /blood Natarajan V, et al., (2014) "Peptides genetically selected for NF-kB activation cooperate with oncogene Ras and model carcinogenic role of inflammation." PNAS 2014: v Leonova KI, et al., (2013) "p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs." Proc Natl Acad Sci U S A. Jan 2;110(1):E Neznanov N, et al., (2011) "Proteotoxic stress targeted therapy (PSTT): induction of protein misfolding enhances the antitumor effect of the proteasome inhibitor bortezomib." Oncotarget. Mar 2(3): In vivo Synthetic Lethality Screens to Identify Genetic Dependencies in Patient-Derived Tumor Models, Timothy Heffernan, Ph.D., Senior Associate Director, Target Discovery, Inst. for Applied Cancer Science, University of Texas, MD Anderson Cancer Center, Discovery on Target Conference Presentation, 2014 (Cambridge Healthtech). Nolan-Stevaux O, et al (2013) "Measurement of Cancer Cell Growth Heterogeneity through Lentiviral Barcoding Identifies Clonal Dominance as a Characteristic of In Vivo Tumor Engraftment." PLoS One. Jun 26;8(6):e Print PMID: DECIPHER Open-Source Genome-wide RNAi Screening Libraries. The DECIPHER Project ( Moving beyond in vitro models and addressing the challenges of pooled RNAi screens in mouse xenografts, Donato Tedesco, Kyle Bonneau, Mikhail Makhanov, Debbie Deng, Paul Diehl, Peiqing Sun, and Alex Chenchik, AACR Annual Meeting 2014; April 5-9, 2014; San Diego, CA

4 Cellecta s Products/Services RNAi & CRISPR Loss-of-Function Screens RNAi shrna and CRISPR sgrna Pooled Libraries (Custom & Premade) Targeted Gene Knockdowns and Knockouts Assay Services Custom Lentiviral RNAi Knockdown and CRISPR Knockout Constructs Custom Lentiviral Expression and Reporter Constructs Knockdown, Knockout, Reporter, and cdna Cell Line Engineering NGS of RNAi and CRISPR Screens with Cellecta Libraries Complex Barcode Cell Tracking Libraries

5 shrna/sgrna Libraries

6 Loss of Function Genetic Analysis Finding and prioritizing drug targets Understanding disease progression and gene-disease associations Finding functional drivers in expression profiling data Analyzing signal transduction pathways Characterizing the mechanisms for compounds Uncovering synergistic gene interactions Identifying mechanisms and markers of drug resistance/sensitivity Research areas Oncology and Cancer Biology Infectious Diseases Inflammation Other diseases with cell-culture model systems

7 RNAi and CRISPR RNAi CRISPR

8 Screening Approaches Functional Assay Functional Assay / Selection Pooled Format Screening Advantages: Flexibility Any set of target genes, number of shrna, markers, promoters. Reproducibility Single assay, all variables consistent. Efficiency Faster and more economic, easy to screen 10s of shrna per gene.

9 sgrna/shrna Library Construction Oligo Pool Synthesis Agilent Array Synthesis Defined complex pools High yield long oligos Low mutation rate (< 0.5%) Cloning Optimized Cloning High complexity >99% representation Packaging Optimized Large Scale Maintains representation High Titer

10 shrna Vectors Standard Library Vector

11 Library QC by NGS 27K Plasmid shrna Library ~90% inserts within 10-fold abundance range (i.e. narrow distribution) ~95% of shrna constructs without mutations/deletions ~98% shrna insert rate Poor Quality

12 Pooled shrna/sgrna Libraries Custom Libraries (2-3 months: $25-$50K depending on size) Just give us a gene list and we Design shrna/sgrna sequences Synthesize oligos Clone our optimized vectors, customized vectors, or customer s own vector QC by NGS sequencing and full analysis of select clones Library packaging available Premade Libraries Genome-Wide (hgw) shrna Library--Targets 19,276 Human Genes 3 Modules, each targeting approximately 6,500 genes Each gene is targeted by 8 hairpins 55,000 hairpins per module CRISPR Genome-Wide sgrna Library--Targets 19,276 human Genes (in development) Each gene targeted by 8 sgrna 55,000 hairpins per module (first module complete)

13 Loss of Function Genetic Screens

14 Cellecta Loss of Function Screening Platform sgrna/

15 Types of Screens Rescue/Survival Screens (Positive Selection): Find genes required to produce a response to added factors or compound; for example, genes necessary for trigging apoptosis or cell death in response to FAS, PUMA or other effectors. Viability/Dropout Screens (Negative Selection): Identify essential genes in a specific population of cells (e.g., prostate, blood, mammary cancer cells). Selected Populations (e.g., FACS): Look for modulators of NF-κB, p53, c-myc, HSF-1, HIF-1α using fluorescent reporter cell line, or cells expressing specific Abdetectable marker, such as specific receptors.

16 Viability Screen for Blood Neoplasia K562 Cells Cellecta Human 27K Library Targeting Signaling Pathway Genes

17 Viability Hits Associated with K562 Cells * * * Overlap with previous study: Luo B, et al. Highly parallel identification of essential genes in cancer cells. Proc Natl Acad Sci U S A Dec 23;105(51):

18 Abstract BCR-ABL1 kinase domain mutations are detected in 30-60% of patients who develop resistance to tyrosine kinase inhibitors (TKIs) such as imatinib. However, the underlying mechanism(s) of resistance in the remaining patients are not known. To identify BCR-ABL1-independent mechanisms of resistance to TKIs, we used K562 cells that were adapted for long-term growth in 1 µm imatinib (K562-R). These cells lack BCR- ABL1 kinase domain mutations and survive despite continued suppression of BCR-ABL1 kinase activity. To screen for novel genes associated with BCR-ABL1-independent resistance, parental K562 and K562-R cells were lentivirally infected with a pooled shrna library containing 27,000 shrnas targeting 5,000 genes with known roles in cell signaling (Cellecta, Human Module 1).

19 Found BRG1/SMARCA4 mutant cancer cells are highly sensitive to BRM/ SMARCA2 depletion.

20

21 Citations of Cellecta s RNAi Libraries Wagenaar, T, R, et al. (2014), Identification of the endosomal sorting complex required for transport-i (ESCRT-I) as an important modulator of anti-mir uptake by cancer cells. Nucleic Acids Res Jan 30;43(2): doi: /nar/gku1367. Epub 2014 Dec 30. An Integrated Genomic and Chemical Screening Platform for Oncology Target Discovery, Serena Silver, Ph.D., Principal Research Investigator, Sanofi Oncology Target Discovery, Discovery on Target Conference Presentation, 2012 (Cambridge Healthtech) Mele DA, et al. (2013). "BET bromodomain inhibition suppresses TH17-mediated pathology." J Exp Med. Oct 21;210(11): Hoffman GR, et al (2014) "Functional epigenetics approach identifies BRM/SMARCA2 as a critical synthetic lethal target in BRG1-deficient cancers." PNAS. PMID: Genomic Platforms to Generate Unbiased Responder and Treatment Hypotheses for Oncology Translational Research, Jing Li, Ph.D., Director of Genomics Screening, Discovery and Pre-clinical Science, Merck Research Laboratories, Discovery on Target Conference Presentation, 2012 (Cambridge Healthtech) Wolf J, et al. (2013) "An in vivo RNAi screen identifies SALL1 as a tumor suppressor in human breast cancer with a role in CDH1 regulation." Oncogene. December 2013; doi: /onc Wolf J, et al. (2013) "A mammosphere formation RNAi screen reveals that ATG4A promotes a breast cancer stem-like phenotype." Breast Cancer Research. 15:R109. Fredebohm J, et al. (2013) "Depletion of RAD17 sensitizes pancreatic cancer cells to gemcitabine." J Cell Sci. Aug 1;126(Pt 15): Amy M S, et al, (2014) Casp8p41 generated by HIV protease kills CD4 T cells through direct Bak activation. JCB Sept 22 (206): Christiana S K, et al. (2015), Oncogenic signaling in amphiregulin and EGFR-expressing PTEN-null human breast cancer. Feb (9): Satish S K, et al. (2014), Vulnerability of Glioblastoma Cells to Catastrophic Vacuolization and Death Induced by a Small Molecule. Cell Apr 10 (175):

22 Development of CRISPR Libraries

23 Published CRISPR Screens

24 Site-Specific Gene Deletion with CRISPR Clustered Regularly Interspaced Short Palindromic Repeats genomic elements found in bacteria defense against invading viruses Offers Convenient Genome Editing Tool Elements of the CRISPR System Single-guide RNA (sgrna) - 20 base RNA sequence - Targets gene Cas9 Protein Figure from Case Transgenic and Targeting Core Facility, Case Western Reserve (

25 Single Vector CRISPR Construct Cas9 and sgrna in Same Vector No Co-Transduction prsgc1-u6-sg-cmv-cas9-2a-puro 11.5 kb

26 GFP-Expressing HEK293 Cells 7 days post-transduction with single CRISPR plasmid expressing sgrna to GFP no sgrna GFP sgrna #D1 GFP sgrna #C3

27 % Cells with Knocked Out GFP Day 9 Day 14

28 Effect of Cas9 Expression Level on KO CMV UbiC 9 days

29 CRISPR Vectors AmpR promoter prsgc1-u6-sg-cmv-cas9-2a-puro 11.5 kb prsg16-u6-sg-ubic-tagrfp-2a-puro 8.0 kb pr-cmv-cas9-2a-hygro 11.6 kb

30 Titers with Cas9 Lentivirus 2-vector system 1-vector system

31 CRISPR 2-Vector Systems pr-cas9-hygro + prsg16-sgrna-puro

32 1 vs. 2 Vector CRISPR Knockout

33 CRISPR KO v. Cas9 Level

34 Different CRISPR Designs

35 Pooled Loss of Function Screens: CRISPR vs. RNAi Screen

36 CRISPR/shRNA Screen Patient-Derived (PDx) CML Cells (K-CML) * courtesy of collaborators at Roswell Park Cancer Institute Transduced w/ Cas9-hyg, MOI = 2 Cas9-expressing Derivative Cells Grow Cells to 40M, Transduce with 20M TU Library (ca. 400 cells / construct) Libraries: 3 days Puro Selection Grow and Harvest 2 weeks 3 weeks 4 weeks 55K shrna hgw Library Module 1 Targets ca. 6,500 human genes 8 shrna/target 55K CRISPR Genome Library Module 1 Targets ca. 6,500 human genes 8 sgrna/target

37 Screen Results

38 Analysis of the Controls Depletion averages for negative (non-targeting) and positive (lethal) controls in the library. shrna seem to deplete more strongly but the SD is much broader.

39 Difference Between Pos v. Neg Controls Strictly Standardized Mean Difference (quantifies difference between pos/neg controls) shrna response more rapid but noise increases at later times sgrna longer to reach performance peak but signal is more consistent Genetic drift doesn t seem to be as much an issue with sgrna

40 Frequency of shrna and grna Hits

41 Number of grna v. shrna Hits per Gene About 35% of target genes identified by a single shrna hit (~ 2,300 shrnas) compared to about only 5% of genes (~320 grnas). Roughly same numbers of target genes were identified by multiple hits in CRISPR and RNAi screens.

42 Overlap of RNAi and CRISPR

43 Exclusive Hits of RNAi or CRISPR CRISPR CML-R CML-P ATP6V0B ATP6V0B CCNH CHORDC1 DHDDS DHFR DHFR ERCC2 ERCC2 FARSA FARSA FARSB NARFL NARFL PGAM1 PGAM1 RNMT SCYL1 SCYL1 TRMT112 TRMT112 YARS2 Strong score with CRISPR, none with shrna RNAi CML-R CML-P MTAP OTOGL TAF1L UBC UBC Strong score with shrna, none with CRISPR

44 ~47% Overlap between CRISPR & RNAi a= 0.01 & z-score=2.58

45 DNMT1 (only CRISPR) BCR ABL1 CCND3 MTOR PRPF31 HMGA2 BCL2 AKT1 (CRISPR and RNAi) (only RNAi)

46 Cellecta CRISPR Products/Services CRISPR/shRNA Screens Full Screening in mammalian cell system of choice Transduction, selection, NGS, Deconvolution è Data Pooled CRISPR Libraries Customer just needs to provide the target gene list CRISPR Genome-Wide Library CRISPR Knockout Constructs Clone customer-provided sgrna or design and provide several CRISPR constructs to gene target Custom Knockout Cell Lines Knockout endogenous genes in any common cell line Customer just provides information on target gene and cell line Cellecta returns two clonal lines with knockout verified by genomic sequencing

47 Multiplex-PCR/NGS Assays that Profile Genetic Markers in Cancer Cells

48 Cancer Profiling Assays Multiplex PCR/NGS-based assays for molecular profiling of key gene transcript levels, mutations and rearrangements in human tumor and PDx samples. Targeting key genes associated with prognoses & sensitivities Core panel of couple hundred markers Additional modules focusing on blood, immune markers, etc. Target set of ca genes with optimized primers in final panel Include expression & mutation analysis Provide internal calibration standards for background correction Multiplex PCR designed specifically for human (not mouse) genes

49 NGS Expression Profiling

50 Thank You! Paul Diehl Director of Business Development Tel: Cellecta, Inc. 320 Logue Ave. Mountain View, CA, USA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

More information

CRISPRaTest Functional dcas9-activator Assay Kit v1 Last update: 2018/07/04 Cellecta, Inc.

CRISPRaTest Functional dcas9-activator Assay Kit v1 Last update: 2018/07/04 Cellecta, Inc. CRISPRaTest Functional dcas9-activator Assay Kit v1 Last update: 2018/07/04 Cellecta, Inc. Copyright (c) 2018 Cellecta, Inc. All Rights Reserved. Table of Contents 1. CRISPRaTest Functional dcas9-activator

More information

Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc.

Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc. Molecular Profiling of Tumor Microenvironment Alex Chenchik, Ph.D. Cellecta, Inc. Cellecta, Inc. Founded: April 2006 Headquarters: Mountain View, CA 12 SBIR Grants Custom Service Provider for Functional

More information

Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery

Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery Choosing Between Lentivirus and Adeno-associated Virus For DNA Delivery Presenter: April 12, 2017 Ed Davis, Ph.D. Senior Application Scientist GeneCopoeia, Inc. Outline Introduction to GeneCopoeia Lentiviral

More information

p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs

p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs p53 cooperates with DNA methylation and a suicidal interferon response to maintain epigenetic silencing of repeats and noncoding RNAs 2013, Katerina I. Leonova et al. Kolmogorov Mikhail Noncoding DNA Mammalian

More information

Tips for genome-wide shrna pooled screen

Tips for genome-wide shrna pooled screen Tips for genome-wide shrna pooled screen 鄭金松 1 Approaches to large-scale RNAi screen/selection (I) Arrayed RNAi screen To address the hits by arrayed information (a) sirna / plasmid shrna (b) Arrayed viral

More information

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway

Pre-made Reporter Lentivirus for JAK-STAT Signaling Pathway Pre-made Reporter for JAK-STAT Signaling Pathway Cat# Product Name Amounts LVP937-P or: LVP937-P-PBS ISRE-GFP (Puro) LVP938-P or: LVP938-P-PBS ISRE-RFP (Puro) LVP939-P or: LVP939-P-PBS ISRE-Luc (Puro)

More information

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway

Pre-made Reporter Lentivirus for MAPK/ERK Signal Pathway Pre-made Reporter for MAPK/ERK Signal Pathway Cat# Product Name Amounts LVP957-P or: LVP957-P-PBS SRE-GFP (Puro) LVP958-P or: LVP958-P-PBS SRE-RFP (Puro) LVP959-P or: LVP959-P-PBS SRE-Luc (Puro) LVP960-P

More information

Experimental Therapeutics I

Experimental Therapeutics I Experimental Therapeutics I Mary Hitt 5142 Katz Group Centre mhitt@ualberta.ca; or Mary.Hitt@albertahealthservices.ca 1 Specific Topics for Today Preclinical and clinical testing Gene therapy Nonviral

More information

Award Number: W81XWH TITLE: Synthetic Lethal Gene for PTEN as a Therapeutic Target. PRINCIPAL INVESTIGATOR: Kounosuke Watabe, Ph.D.

Award Number: W81XWH TITLE: Synthetic Lethal Gene for PTEN as a Therapeutic Target. PRINCIPAL INVESTIGATOR: Kounosuke Watabe, Ph.D. AD Award Number: W81XWH-12-1-0151 TITLE: Synthetic Lethal Gene for PTEN as a Therapeutic Target PRINCIPAL INVESTIGATOR: Kounosuke Watabe, Ph.D. CONTRACTING ORGANIZATION: University of Mississippi Medical

More information

CRISPR/CAS9 based high-throughput screening. Journal club Caihong Zhu

CRISPR/CAS9 based high-throughput screening. Journal club Caihong Zhu CRISPR/CAS9 based high-throughput screening Journal club Caihong Zhu 29.04.2014 High Throughput Screening (HTS) HTS is a method for scientific experimentation especially used in drug discovery and relevant

More information

Pre-made Reporter Lentivirus for NF-κB Signal Pathway

Pre-made Reporter Lentivirus for NF-κB Signal Pathway Pre-made Reporter for NF-κB Signal Pathway Cat# Product Name Amounts LVP965-P or: LVP965-P-PBS NFKB-GFP (Puro) LVP966-P or: LVP966-P-PBS NFKB-RFP (Puro) LVP967-P or: LVP967-P-PBS NFKB-Luc (Puro) LVP968-P

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer

VIRAL TITER COUNTS. The best methods of measuring infectious lentiviral titer VIRAL TITER COUNTS The best methods of measuring infectious lentiviral titer FLUORESCENCE CYCLES qpcr of Viral RNA SUMMARY Viral vectors are now routinely used for gene transduction in a wide variety of

More information

~Lentivirus production~

~Lentivirus production~ ~Lentivirus production~ May 30, 2008 RNAi core R&D group member Lentivirus Production Session Lentivirus!!! Is it health threatening to lab technician? What s so good about this RNAi library? How to produce

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Pre-made Lentiviral Particles for Fluorescent Proteins

Pre-made Lentiviral Particles for Fluorescent Proteins Pre-made Lentiviral Particles for Fluorescent Proteins Catalog# Product Name Amounts Fluorescent proteins expressed under sucmv promoter: LVP001 LVP001-PBS LVP002 LVP002-PBS LVP011 LVP011-PBS LVP012 LVP012-PBS

More information

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

More information

Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX

Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX Contents Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX 1 General Aspects of Signal Transduction and Cancer Therapy 1 1.1 General Principles of Signal Transduction

More information

AWARD NUMBER: W81XWH TITLE: An in Vivo shrna-drug Screen to Identify Novel Targeted Therapy Combinations for KRAS Mutant Cancers

AWARD NUMBER: W81XWH TITLE: An in Vivo shrna-drug Screen to Identify Novel Targeted Therapy Combinations for KRAS Mutant Cancers AWARD NUMBER: W81XWH-12-1-0420 TITLE: An in Vivo shrna-drug Screen to Identify Novel Targeted Therapy Combinations for KRAS Mutant Cancers PRINCIPAL INVESTIGATOR: Ryan B. Corcoran, M.D., Ph.D. CONTRACTING

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1

More information

TITLE: Genomic Approaches for Detection and Treatment of Breast Cancer. Boston, MA 02115

TITLE: Genomic Approaches for Detection and Treatment of Breast Cancer. Boston, MA 02115 AD AWARD NUMBER: W81XWH-04-1-0197 TITLE: Genomic Approaches for Detection and Treatment of Breast Cancer PRINCIPAL INVESTIGATOR: Stephen J. Elledge, Ph.D. CONTRACTING ORGANIZATION: Brigham & Women s Hospital

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Seed-effect modeling improves the consistency of genome-wide loss-offunction screens and identifies synthetic lethal vulnerabilities in cancer cells

Seed-effect modeling improves the consistency of genome-wide loss-offunction screens and identifies synthetic lethal vulnerabilities in cancer cells Jaiswal et al. Genome Medicine (2017) 9:51 DOI 10.1186/s13073-017-0440-2 RESEARCH Seed-effect modeling improves the consistency of genome-wide loss-offunction screens and identifies synthetic lethal vulnerabilities

More information

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed

More information

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors VIROLOGY Engineering Viral Genomes: Retrovirus Vectors Viral vectors Retrovirus replicative cycle Most mammalian retroviruses use trna PRO, trna Lys3, trna Lys1,2 The partially unfolded trna is annealed

More information

CONTRACTING ORGANIZATION: Cold Spring Harbor Laboratory Cold Spring Harbor, NY 11724

CONTRACTING ORGANIZATION: Cold Spring Harbor Laboratory Cold Spring Harbor, NY 11724 AD Award Number: W81XWH-06-1-0249 TITLE: Detection of genes modifying sensitivity to proteasome inhibitors using a shrna Library in Breast Cancer PRINCIPAL INVESTIGATOR: Gregory J. Hannon, Ph.D. CONTRACTING

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis

Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis 5/17/13 Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis Johannes Kratz, MD Post-doctoral Fellow, Thoracic Oncology Laboratory

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Jumpstart your research with ViraPower Lentiviral Expression Systems

Jumpstart your research with ViraPower Lentiviral Expression Systems ViraPower Lentiviral Expression Systems Jumpstart your research with ViraPower Lentiviral Expression Systems With ViraPower Lentiviral Systems you can: Efficiently transduce both dividing and non-dividing

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis. Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)

More information

Functional validation of cancer susceptibility genes using gene editing

Functional validation of cancer susceptibility genes using gene editing Functional validation of cancer susceptibility genes using gene editing 2-22-2017 Sabine Topka Research Fellow Niehaus Center for Inherited Cancer Genomics www.mskcc.org Inherited Predisposition to Cancer

More information

Ready-to-use Lentiviral Particles for intracelular labeling

Ready-to-use Lentiviral Particles for intracelular labeling Ready-to-use Lentiviral Particles for intracelular labeling (LocLight TM Living cell imaging lentivirus for sub-cellular localization) LocLight TM cell organelle labeling lentivirus are provided as 200ul/per

More information

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science

More information

TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer

TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer AWARD NUMBER: W81XWH-14-1-0588 TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Timothy Ratliff CONTRACTING ORGANIZATION:

More information

DNA context and promoter activity affect gene expression in lentiviral vectors

DNA context and promoter activity affect gene expression in lentiviral vectors ACTA BIOMED 2008; 79: 192-196 Mattioli 1885 O R I G I N A L A R T I C L E DNA context and promoter activity affect gene expression in lentiviral vectors Gensheng Mao 1, Francesco Marotta 2, Jia Yu 3, Liang

More information

609G: Concepts of Cancer Genetics and Treatments (3 credits)

609G: Concepts of Cancer Genetics and Treatments (3 credits) Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,

More information

Comprehensive Genomic Profiling, in record time. Accurate. Clinically Proven. Fast.

Comprehensive Genomic Profiling, in record time. Accurate. Clinically Proven. Fast. Comprehensive Genomic Profiling, in record time Accurate. ly Proven. Fast. PCDx advantages Comprehensive genomic profiling, in record time PCDx Comprehensive Genomic Profiling (CGP) provides precise information

More information

NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 November 16.

NIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 November 16. NIH Public Access Author Manuscript Published in final edited form as: Science. 2008 February 1; 319(5863): 617 620. doi:10.1126/science.1149185. Profiling Essential Genes in Human Mammary Cells by Multiplex

More information

number Done by Corrected by Doctor Maha Shomaf

number Done by Corrected by Doctor Maha Shomaf number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads

More information

Bihong Zhao, M.D, Ph.D Department of Pathology

Bihong Zhao, M.D, Ph.D Department of Pathology Bihong Zhao, M.D, Ph.D Department of Pathology 04-28-2009 Is tumor self or non-self? How are tumor antigens generated? What are they? How does immune system respond? Introduction Tumor Antigens/Categories

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation ofopen Access publicationsand worldwide international science conferences and events. Established in the year 2007 with the sole aim of making

More information

Introduction to Cancer Biology

Introduction to Cancer Biology Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Chapter 22: The Lymphatic System and Immunity

Chapter 22: The Lymphatic System and Immunity Bio40C schedule Lecture Immune system Lab Quiz 2 this week; bring a scantron! Study guide on my website (see lab assignments) Extra credit Critical thinking questions at end of chapters 5 pts/chapter Due

More information

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The

More information

A CRISPR dropout screen identifies genetic vulnerabilities in acute myeloid leukaemia. Kosuke Yusa Wellcome Trust Sanger Institute

A CRISPR dropout screen identifies genetic vulnerabilities in acute myeloid leukaemia. Kosuke Yusa Wellcome Trust Sanger Institute A CRISPR dropout screen identifies genetic vulnerabilities in acute myeloid leukaemia Kosuke Yusa Wellcome Trust Sanger Institute CRISPR screens Dec 2013 PLX4720 resistance in BRAF V600E melanoma. Resistance

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

Evaluation of STAT3 Signaling in Macrophages Using a Lentiviral Reporter System

Evaluation of STAT3 Signaling in Macrophages Using a Lentiviral Reporter System Evaluation of STAT3 Signaling in Macrophages Using a Lentiviral Reporter System Schwertfeger Laboratory Emily Hartsough Breast Cancer Prevalence Adapted from Siegel et. al Cancer Statistics. 2016 Tumor

More information

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy

More information

Innate Immunity & Inflammation

Innate Immunity & Inflammation Innate Immunity & Inflammation The innate immune system is an evolutionally conserved mechanism that provides an early and effective response against invading microbial pathogens. It relies on a limited

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:

1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles: Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

Targeting MAT2A in MTAP-deleted Cancers

Targeting MAT2A in MTAP-deleted Cancers Targeting MAT2A in MTAP-deleted Cancers Presented at the American Association for Cancer Research (AACR) Annual Meeting, April 14-18, 2018, Chicago, IL, USA 1 Acknowledgements Agios 2017 Founders Day Retreat

More information

John Bell Centre for Innovative Cancer Therapeutics

John Bell Centre for Innovative Cancer Therapeutics Enhancing Oncolytic Virus Activity by Engineering of Artificial micrornas John Bell Centre for Innovative Cancer Therapeutics Affiliated with Affilié à 1 Oncolytic Viruses: A Therapy for Metastatic Cancers?

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression

Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression Myelodysplastic Syndromes: Hematopathology. Analysis of SHIP1 as a potential biomarker of Disease Progression Carlos E. Bueso-Ramos, M.D., Ph.D Department of Hematopathology The University of Texas M.

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-11-1-0487 TITLE: Development of Advanced Technologies for Complete Genomic and Proteomic Characterization of Quantized Human Tumor Cells PRINCIPAL INVESTIGATOR: Dr. Robert Moritz

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

MicroRNAs: the primary cause or a determinant of progression in leukemia?

MicroRNAs: the primary cause or a determinant of progression in leukemia? MicroRNAs: the primary cause or a determinant of progression in leukemia? The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation

More information

Module 3: Pathway and Drug Development

Module 3: Pathway and Drug Development Module 3: Pathway and Drug Development Table of Contents 1.1 Getting Started... 6 1.2 Identifying a Dasatinib sensitive cancer signature... 7 1.2.1 Identifying and validating a Dasatinib Signature... 7

More information

Cancer and Gene Alterations - 1

Cancer and Gene Alterations - 1 Cancer and Gene Alterations - 1 Cancer and Gene Alteration As we know, cancer is a disease of unregulated cell growth. Although we looked at some of the features of cancer when we discussed mitosis checkpoints,

More information

Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients

Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients Smith Family Awards Program for Excellence in Biomedical Research 2017 Award Recipients Aaron Hata, M.D., Ph.D. Assistant Professor of Medicine at Harvard Medical School MGH Cancer Center Determining the

More information

TITLE: Enhancing the Anti-Tumor Activity of ErbB Blockers with Histone Deaccetylase (HDAC) Inhibition in Prostate Cancer Cell Lines

TITLE: Enhancing the Anti-Tumor Activity of ErbB Blockers with Histone Deaccetylase (HDAC) Inhibition in Prostate Cancer Cell Lines AD Award Number: W81XWH-05-1-0040 TITLE: Enhancing the Anti-Tumor Activity of ErbB Blockers with Histone Deaccetylase (HDAC) Inhibition in Prostate Cancer Cell Lines PRINCIPAL INVESTIGATOR: Prakash Chinnaiyan,

More information

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies

Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus

More information

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Catalog No. Amount Lot Number 631987 10 μg Specified on product label. Product Information plvx-ef1α-ires-mcherry is a bicistronic lentiviral expression vector that can be used

More information

HORIZON DISCOVERY THE CASE FOR A SYNTHETIC-LETHALITY FOCUSSED NEWCO

HORIZON DISCOVERY THE CASE FOR A SYNTHETIC-LETHALITY FOCUSSED NEWCO HORIZON DISCOVERY THE CASE FOR A SYNTHETIC-LETHALITY FOCUSSED NEWCO Jon Moore, CSO Dutch Life Sciences Conference, November 24 th 2016 Disclaimer The information contained in this document ( Presentation

More information

Chapt 15: Molecular Genetics of Cell Cycle and Cancer

Chapt 15: Molecular Genetics of Cell Cycle and Cancer Chapt 15: Molecular Genetics of Cell Cycle and Cancer Student Learning Outcomes: Describe the cell cycle: steps taken by a cell to duplicate itself = cell division; Interphase (G1, S and G2), Mitosis.

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus. Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett

More information

Section D: The Molecular Biology of Cancer

Section D: The Molecular Biology of Cancer CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty

More information

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical

More information

Synthetic Genomics and Its Application to Viral Infectious Diseases. Timothy Stockwell (JCVI) David Wentworth (JCVI)

Synthetic Genomics and Its Application to Viral Infectious Diseases. Timothy Stockwell (JCVI) David Wentworth (JCVI) Synthetic Genomics and Its Application to Viral Infectious Diseases Timothy Stockwell (JCVI) David Wentworth (JCVI) Outline Using informatics to predict drift (strain selection) Synthetic Genomics: Preparedness

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

TITLE: Effect of MUC1 Expression on EGFR Endocytosis and Degradation in Human Breast Cancer Cell Lines

TITLE: Effect of MUC1 Expression on EGFR Endocytosis and Degradation in Human Breast Cancer Cell Lines AD AWARD NUMBER: W81XWH-06-1-0464 TITLE: Effect of MUC1 Expression on EGFR Endocytosis and Degradation in Human Breast Cancer Cell Lines PRINCIPAL INVESTIGATOR: Rachid M El Bejjani CONTRACTING ORGANIZATION:

More information

IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER"

IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER" Edmond Marzbani, MD December 2, 2008 Early diagnosis of cancer Many solid tumors are potentially curable if diagnosed at an early stage

More information

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway

TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway AWARD NUMBER: W81XWH-12-1-0560 TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway PRINCIPAL INVESTIGATOR: Andrew S. Kraft, MD CONTRACTING ORGANIZATION:

More information

Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous

Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Sleeping Beauty: Current applications and future strategies. CAR-TCR Summit 2017 Partow Kebriaei, MD

Sleeping Beauty: Current applications and future strategies. CAR-TCR Summit 2017 Partow Kebriaei, MD Sleeping Beauty: Current applications and future strategies CAR-TCR Summit 2017 Partow Kebriaei, MD Outline Chimeric antigen receptor (CAR) technology Viral versus nonviral vectors Results of current clinical

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Welcome. Nanostring Immuno-Oncology Summit. September 21st, FOR RESEARCH USE ONLY. Not for use in diagnostic procedures.

Welcome. Nanostring Immuno-Oncology Summit. September 21st, FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. Welcome Nanostring Immuno-Oncology Summit September 21st, 2017 1 FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. Agenda 4:00-4:30

More information

p53 and Apoptosis: Master Guardian and Executioner Part 2

p53 and Apoptosis: Master Guardian and Executioner Part 2 p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy

More information

micrornas (mirna) and Biomarkers

micrornas (mirna) and Biomarkers micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Award Number: W81XWH TITLE: Dependency on SRC-Family Kinases for Recurrence of Androgen- Independent Prostate Cancer

Award Number: W81XWH TITLE: Dependency on SRC-Family Kinases for Recurrence of Androgen- Independent Prostate Cancer AD Award Number: W81XWH-08-1-0026 TITLE: Dependency on SRC-Family Kinases for Recurrence of Androgen- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Irwin H. Gelman, Ph.D. CONTRACTING ORGANIZATION:

More information

Cancer Genomics (Current technologies & clinical implication)

Cancer Genomics (Current technologies & clinical implication) Cancer Genomics (Current technologies & clinical implication) Jeonghee Cho, Ph.D. Samsung Medical Center Samsung Cancer Research Institute Robert Weinberg (M.I.T) Douglas Hanahan (ISREC) The Hallmarks

More information