Regulation of BRCA1 and BRCA2 expression in human breast cancer cells by DNA-damaging agents

Transcription

1 Oncogene (1998) 16, 2229 ± tockton Press All rights reserved 0950 ± 9232/98 $ expression in humn rest cncer cells y DNA-dmging gents Jnet L Andres, ijun Fn, Gry J Turkel, Ji-An Wng, Ne-Fng Twu, Ren-Qi Yun, Ktrin Lmszus, Itzhk D Golderg nd Eliot M Rosen Deprtment of Rdition Oncology, Long Islnd Jewish Medicl Center, The Long Islnd Cmpus for the Alert Einstein College of Medicine, th Avenue, New Hyde Prk, New York 11040, UA Germline muttions in the rest cncer susceptiility genes BRCA1 nd BRCA2 hve een linked to the development of rest cncer, ovrin cncer, nd other mlignncies. Recent studies suggest tht the BRCA1 nd BRCA2 gene products my function in the sensing nd/or repir of DNA dmge. To investigte this possiility, we determined the e ects of vrious DNAdmging gents nd other cytotoxic gents on the mrna levels of BRCA1 nd BRCA2 in the MCF-7 nd other humn rest cncer cell lines. We found tht severl gents, including drimycin ( DNA intercltor nd inhiitor of topoisomerse II), cmptothecin ( topoisomerse I inhiitor), nd ultrviolet rdition induced signi cnt decreses in BRCA1 nd BRCA2 mrna levels. Decresed levels of BRCA1 nd BRCA2 mrnas were oserved within 6 ± 12 h fter tretment with drimycin nd persisted for t lest 72 h. Adrimycin lso induced decreses in BRCA1 protein levels; ut these decreses required severl dys. U.V. rdition induced dose-dependent down-regultion of BRCA1 nd BRCA2 mrnas, with signi cnt decreses in oth mrnas t doses s low s 2.5 J/m 2, dose tht yielded very little cytotoxicity. Adrimycin-induced down-regultion of BRCA1 nd BRCA2 mrnas ws rst oserved t doses tht yielded reltively little cytotoxicity nd little or no poptotic DNA frgmenttion. Adrimycin nd U.V. rdition induced distinct dose- nd time-dependent ltertions in the cell cycle distriution; ut these ltertions did not correlte well with corresponding chnges in BRCA1 nd BRCA2 mrna levels. However, the drimycin-induced reduction in BRCA1 nd BRCA2 mrna levels ws correlted with p53 functionl sttus. MCF-7 cells trnsfected with dominnt negtive mutnt p53 (143 vl?l) required t lest tenfold higher doses of drimycin to downregulte BRCA1 nd BRCA2 mrnas thn did prentl MCF-7 cells or control-trnsfected MCF-7 clones. These results suggest tht BRCA1 nd BRCA2 my ply roles in the cellulr response to DNA-dmging gents nd tht there my e p53-sensitive component to the regultion of BRCA1 nd BRCA2 mrna expression. Keywords: Brest cncer; BRCA1; BRCA2; MCF-7; DNA dmge; drimycin Correspondence: EM Rosen Received 10 July 1997; revised 25 Novemer 1997; ccepted 27 Novemer 1997 Introduction Germline muttions in the BRCA1 nd BRCA2 genes hve een linked to n incresed risk of development of rest cncer, ovrin cncer, nd other mlignncies (Miki et l., 1994; Tvtigin et l., 1996). Muttions in one or the other of these genes re found in pproximtely 80% of cses of fmilil rest cncer (Eston et l., 1993). BRCA1 is n 1863 mino cid phosphoprotein whose levels nd phosphoryltion stte vry during the cell cycle (Guds et l., 1996; Rjn et l., 1996; Vughn et l., 1996). Most evidence suggests tht BRCA1 is loclized in the nucleus (Chen et l., 1996; Thoms et l., 1996; cully et l., 1996), lthough cytoplsmic nd extrcellulr distriution hs een reported (Jensen et l., 1996). BRCA1 is thought to e tumor suppressor gene, since mrna levels re gretly reduced in invsive rest cncer nd since overexpression of BRCA1 inhiits rest cncer cell prolifertion in vitro nd in n experimentl tumor model (Holt et l., 1996). elective reduction of BRCA1 mrna levels using ntisense RNA induces more rpid cell growth, decresed susceptiility to poptosis, nd cell trnsformtion in NIH3T3 firolsts (Thompson et l., 1995; Ro et l., 1996). On the other hnd, overexpression of full-length cdna construct cuses susceptiility to poptosis in trnsfected cell lines (ho et l., 1996). A fusion protein contining the C-terminl region of BRCA1 cn ctivte trnscription when linked to suitle DNA inding domin, suggesting tht BRCA1 my function s trnscription fctor (Chpmn nd Verm, 1996; Monteiro et l., 1996). BRCA1 lso contins domins homologous to recently cloned p53 inding protein (53BP1) nd to Rd9, yest protein tht my regulte the G2 DNA-dmge checkpoint (Koonin et l., 1996). In ddition, BRCA1 hs een found to ssocite with Rd51, the humn homolog of the cteril recominse RecA (cully et l., 1997). The humn BRCA2 gene encodes 3418 mino cid protein tht lcks signi cnt sequence homology to known proteins (Tvtigin et l., 1996). BRCA2 lso ssocites with the Rd51 protein, nd BRCA27/7 cells pper to e hypersensitive to ionizing rdition (hrn et l., 1997). BRCA1 nd BRCA2 mrna levels re regulted co-ordintely during cell cycle progression nd growth rrest (pillmn nd Bowcock, 1996; Rjn et l., 1996), with pek mrna levels oserved t the G1/ interfce nd low levels in lte - phse (Vughn et l., 1996; Guds et l., 1996; Rjn et l., 1996). Levels of oth mrnas re reduced when mmmry epithelil cells ecome growth-rrested due

2 2230 to serum deprivtion (Guds et l., 1996; Vughn et l., 1996; Rjn et l., 1996). These oservtions suggest tht BRCA1 nd BRCA2 my function in monitoring genomic integrity nd in DNA repir. However, their precise functions remin to e determined. Bsed on these considertions, we hve investigted the possiility tht BRCA1 nd BRCA2 might function in the response of cells to DNA-dmging gents nd other cytotoxic gents. In this report, we descrie the e ects of these gents on BRCA1 nd BRCA2 mrna levels in humn rest cncer cells, nd the e ect of the p53 functionl sttus on the response of these cells to the DNA topoisomerse II inhiitor drimycin (doxoruicin hydrochloride). Results E ect of drimycin (ADR) on BRCA1 nd BRCA2 expression in MCF-7 cells with wild-type (WT) or mutnt p53 ince BRCA1 hs een implicted in the process of poptosis nd since oth BRCA1 nd BRCA2 my e involved in DNA repir, we exmined the expression of BRCA1 nd BRCA2 mrna following tretment of MCF-7 humn rest cncer cells with ADR. Cells were treted with 5 mm ADR for 1 h, nd mrna levels were exmined 24 h lter using semi-quntittive RT ± PCR nlysis (see Mterils nd methods). Although the cells showed no ovious evidence of cytotoxicity under these conditions (see elow), oth BRCA1 nd BRCA2 mrna levels were found to e decresed reltive to untreted control cells (Figure 1). MCF-7 cells normlly express WT p53 (Wosikowski et l., 1995). To determine if the ility to downregulte BRCA1 nd BRCA2 ws p53 dependent, we compred MCF-7 cell clones trnsfected with dominnt negtive mutnt p53 (p53 ± 143 vl? l) (Kern et l., 1992) with prentl cells nd with control clones trnsfected with vector contining only the neomycin resistnce gene. At dose of 5 mm ADR, prentl cells nd three neo-trnsfected clones showed down-regultion of BRCA1 nd BRCA2 mrna levels 24 h fter tretment (Figure 1). However, four clones trnsfected with mutnt p53 showed little or no downregultion of BRCA1 or BRCA2 mrna under the sme conditions. Expression of WT vs mutnt p53 ws con rmed y Western lotting, s shown in Figure 1c. With the exception of mutnt clone 2, mutnt trnsfectnts exhiited much higher sl levels of p53 thn did prentl or control-trnsfected cells. Tretment of cells contining WT p53 with 5 mm ADR induced n ovious increse in the p53 protein levels, wheres only smll increses in p53 protein levels were oserved fter tretment of cells contining mutnt p53. These smll chnges in p53 levels in the mutnt clones my hve een due to endogenous WT p53 or to posttrnsltionl modi ctions of the p53 protein. Mutnt clone 2 ws originlly isolted s trnsfectnt tht overexpressed mutnt p53 protein. However, Western lotting reveled little or no sl or ADR-induced p53 protein expression, suggesting tht this clone my hve lost the expression of oth wild-type nd mutnt p53 genes. Mutnt clone 2 ws therefore functionlly negtive for p53 protein. Dose response nd time course of ADR-induced decreses in BRCA1 nd BRCA2 mrna levels Dose response To determine if the di erence etween WT nd mutnt MCF-7 cells in the sensitivity of BRCA1 nd BRCA2 mrna levels to ADR ws quntittive rther thn qulittive, we compred the dose-response reltionship for down-regultion of BRCA1 nd BRCA2 in prentl MCF-7 cells nd one of the mutnt clones (mutnt clone 3). Ech cell line showed dose-dependent down-regultion of BRCA1 nd BRCA2 expression (Figure 2). Downregultion of BRCA1 nd BRCA2 in the prentl cells ws detected t doses of ADR s low s 1 mm, wheres in MCF-7/p cells, down-regultion required doses of 510 mm ADR. For the prentl cell line, the ADR-induced decreses in BRCA1 nd BRCA2 mrna levels ppered to correlte with the ADRinduced increses in WT p53 protein levels (Figure 2). We lso oserved ADR-induced down-regultion of BRCA1 nd BRCA2 in four other humn rest cncer cell lines (MDA-MB-231, MDA-MB-453, MDA-MD-468, nd T47-D) (dt not shown). Time course Prentl MCF-7 cells, shm-treted or treted with ADR (5 mm61 h), were hrvested t di erent times fter ADR tretment for ssessment of BRCA1 nd BRCA2 mrna levels. For ech time point, levels of mrnas were compred in control vs ADR-treted cells. Decresed levels of mrna for BRCA1 were rst detected s erly s 6 h fter ADR tretment, ut these ltertions were much more prominent fter 12 h (Figure 3). Di erences in BRCA1 levels etween control nd ADR-treted cells persisted for t lest 72 h. BRCA2 mrna levels showed similr time dependence, with prominent decrese in BRCA2 oserved y 6 h fter ADR tretment. Thus, for MCF-7 cells contining WT p53, signi cnt down-regultion of BRCA1 nd BRCA2 ws oserved y 6 ± 12 h fter ADR tretment nd persisted for t lest 3 dys. Protein expression We utilized Western lotting to determine if the down-regultion of BRCA1 mrna ws lso ssocited with decresed expression of the BRCA1 protein. In multiple experiments, y 24 h fter tretment of MCF-7 prentl cells with 5 mm ADR, there ws little or no chnge in the level of BRCA1 protein. However, t lter times (48, 72 nd 96 h), BRCA1 protein levels were decresed, s compred with shm-treted control cell hrvested t the sme times (Figure 3). On the other hnd, for MCF-7/p (mutnt clone 3) cells, t dose of 5 mm ADR, there were little or no chnges in BRCAl protein levels for the rst 72 h; while protein levels t 96 h were lower in ADR-treted cells thn in control cells (Figure 3). These ndings re consistent with the decresed sensitivity of MCF-7/p cells to ADR-induced down-regultion of BRCAl mrna. They lso suggest tht the BRCAl protein hs longer hlf-life thn the mrna.

3 + + + ADR 2231 BRCA1 BRCA2 Actin wt-p53 p ADR BRCA1 BRCA2 ACTIN c wt-p p ADR p53 Figure 1 Down-regultion of BRCA1 nd BRCA2 mrna levels y drimycin (ADR) in MCF-7 cells expressing wild-type or mutnt p53. ucon uent proliferting cultures of MCF-7 cells were treted with 5 mm ADR for 1 h. After 24 h, the totl cell RNA ws extrcted nd the BRCA1 nd BRCA2 mrna levels were determined y semi-quntittive RT ± PCR nlysis. -Actin levels were mesured s control. () shows the responses of MCF-7 prentl cells. () shows the responses for prentl MCF-7 cells nd three control (neo)-trnsfected cell clones, compred with the responses for four cell clones expressing mutnt p3. (c) shows Western lot nlysis of p53 protein for the ove cell lines fter tretment under the sme conditions E ect of ADR on survivl, poptosis, nd prolifertion of MCF-7 cells We performed severl di erent types of studies to determine if the down-regultion of BRCA1 nd BRCA2 induced y drimycin might e directly relted to its cytotoxicity. In one set of studies, the dose-dependence of ADR-induced cytotoxicity ws ssessed 24 h fter tretment using the trypn lue dye exclusion ssy. In these experiments, we found tht the degree of cytoxicity ws only slightly greter in MCF-7 prentl cells thn in MCF-7/p (mutnt clone 3) cells (see Figure 4). Thus, the IC 50 s for loss of cell viility were out 17 mm for the prentl cells nd 22 mm for the p53 mutnt cells. For prentl cells, the cell `survivl' t the dose t which ADR-induced down-regultion of BRCA1/2 ws rst oserved (1 mm) ws 96%; nd t 5 mm ADR, the survivl of these cells ws still out 91%. For p53 mutnt cells, cell survivl t 10 ± 15 mm ADR (the dose t which BRCA1/2 down-regultion ws rst oserved) ws lso quite high (80 ± 90%). Cell survivl ws lso ssyed using the MTT dye conversion ssy. Dye conversion ctivity ws ssessed 3 dys fter exposure to ADR, so tht these ssys re longer term mesure of cytotoxicity. By this ssy, the IC 50 vlues for loss of cell survivl were out 13 mm nd 17 mm, respectively, for prentl nd p53 mutnt cells.

4 2232 Thus, mrked down-regultion of BRCA1 nd BRCA2 could e oserved t ADR doses tht yielded reltively little cytotoxicity. PARENTAL p ADR (µm) BRCA1 BRCA2 ACTIN ADR (µm) p53 ACTIN Figure 2 Dose-dependent down-regultion of BRCA1 nd BRCA2 mrna levels in prentl MCF-7 s compred with MCF-7/p cells induced y ADR. () shows BRCA1, BRCA2, nd -ctin mrna levels in MCF-7 prentl cells nd in MCF-7/p clone 3 cells (see Figure 1) 24 h fter 1 h exposure to the indicted doses of ADR. () shows Western lot nlysis of p53 in prentl MCF-7 cells 24 h fter tretment with the indicted doses of ADR. -Actin protein levels were mesured s control We compred the growth of MCF-7 prentl cells treted without or with ADR (5 mm61 h). These studies reveled no net cell loss in ADR-treted popultions of cells, lthough there ws dely in cell growth etween 24 nd 48 h (Figure 5). The ADR-treted cells continued to grow etween 48 nd 72 h, even though BRCA1 nd BRCA2 mrna levels remined low t these times (see Figure 3). For p53 mutnt MCF-7 cells, t dose of 5 mm ADR, there ws no ovious morphologicl evidence of cytotoxicity; nd growth curves reveled n even smller or no e ect on cell growth kinetics. These ndings re consistent with the trypn lue ssys, demonstrting little or no cytotoxicity t dose of 5 mm ADR for either cell line. We lso ssessed DNA frgmenttion in ADRtreted cells s mesure of the entry of cells into poptosis. There ppered to e little or no induction of poptosis in MCF-7 cells 24 h fter tretment with ADR doses s high s 25 mm, s indicted y the sence of interoligonucleosoml-sized DNA frgments (Figure 5). In contrst, n ADR-sensitive rest cncer cell line (MDA-MB-453) showed mrked DNA frgmenttion 24 h fter tretment with dose of 5 mm ADR. Tken together, these oservtions suggest tht the down-regultion of BRCA1 nd BRCA2 ws not direct consequence of cytotoxicity or cell deth. E ect of ADR on cell cycle progression of MCF-7 cells BRCA1 nd BRCA2 mrna levels hve een found to vry in cell-cycle dependent fshion (see Introduction). We utilized ow cytometric nlysis of propidium iodide-stined nuclei to ssess the e ects of ADR on the cell cycle distriutions of initilly synchronous proliferting popultions of MCF-7 cells ADR BRCA1 BRCA2 ACTIN ADR MCF-7/Prentl MCF-7/p Figure 3 Time course of BRCA1 nd BRCA2 down-regultion induced y ADR. In () prentl MCF-7 cells were treted without or with ADR (5 mm61 h) nd hrvested t the indicted times for determintion of BRCA1, BRCA2, nd -ctin mrna levels y semi-quntittive RT ± PCR nlysis t the indicted times. In nother experiment, similrly treted MCF-7 prentl nd MCF-7/ p (mutnt clone 3) cells were hrvested t di erent times for determintion of BRCA1 protein levels y Western lotting (). For ech time point, levels of mrnas or protein were compred in ADR-treted cells vs shm-treted control cells

5 2233 Figure 4 Dose-dependent cytotoxicity of drimycin for MCF-7 cells. () Trypn lue dye exclusion ssys. MCF-7 prentl or p (mutnt clone 3) cells were treted with di erent doses of ADR for 1 h nd then incuted for 24 h prior to hrvesting for trypn lue dye exclusion ssy. Cell survivl vlues (i.e., percentges of trypn lue dye excluding cells) re mens+rnges of duplicte determintions in which over 500 cells were counted. () MTT dye conversion ssys. Cells in 96-well dishes were exposed to di erent doses of ADR for 1 h nd then incuted in the sence of ADR for 3 dys. MTT dye reduction ctivity ws then mesured s descried in the Mterils nd methods section. Vlues were normlized reltive to shm-treted control cells, nd represent the mens+s.e.m.s of 10 replicte wells MCF-7/PARENTAL MDAMB ADR (µm) Figure 5 E ect of ADR on prolifertion nd poptosis in prentl MCF-7 cells. () shows growth curves for untreted prentl MCF-7 cells nd cells treted with ADR (5 mm61 h). Vlues plotted represent mens+s.d of triplicte determintions. () shows DNA frgmenttion ssys of prentl MCF-7 cells treted with ADR nd hrvested fter 24 h. Equl cell numers were lysed nd nlysed y grose gel electrophoresis. The ADR-sensitive cell line MDA-MB-453 treted with 5 mm ADR61 h ws included s positive control with WT vs mutnt p53. Both prentl MCF-7 nd MCF-7/p (clone 3) cells exhiited dose-dependent ltertions of cell cycle distriutions 24 h fter tretment with ADR (Figure 6, Tle 1). These ltertions were qulittively similr in prent vs mutnt cell lines, ut di ered t the low vs high ADR doses. Thus, t 1 nd 5 mm ADR, the proportion of cells in -phse decresed, while tht in tended to increse. On the other hnd, tretment with 10 nd 25 mm ADR showed cells ccumulting in lte or throughout -phse. In time course studies, cells were treted without (7) or with (+) dose of 5 mm ADR. These ssys reveled time-dependent loss of cells from -phse nd ccumultion of cells in for oth prentl nd p53 mutnt cell lines (Figure 6, Tle 1). These studies suggest tht t lower doses (1 ± 5 mm?), the predominnt e ect of ADR my e to induce prtil G1 nd rrest; while cells in -phse cn progress into the comprtment. Thus, the net e ect is time-dependent loss of cells from nd ccumultion in. At the higher doses (10 nd 25 mm), cells lso pper to prtilly or fully rrest in, consistent with ADR-medited inhiition of topoisomerse II nd DNA synthesis (tevensner et l., 1993). These findings do not pper to e consistent with the ide tht ADRinduced chnges in BRCA1 nd BRCA2 mrna levels re solely due to cell cycle ltertions. For exmple, fter tretment with 5 mm ADR, prentl cells showed mrked time-dependent loss of BRCA1 nd BRCA2 mrna expression; while similr chnges were not oserved chnges in p cells. In contrst, the

6 2234 Figure 6 E ect of ADR on the cell cycle distriutions of prentl nd MCF-7/p cells. Cells were treted s descried in the Mterils nd methods section, nd the DNA content of propidium iodide-stined cell nuclei ws nlysed y ow cytometry. In () cell cycle distriutions for prentl nd p (mutnt clone 3) cells were otined 24 h fter tretment of cells with di erent doses of ADR (1 h exposure). In () prentl nd p cells were treted without or with ADR (5 mm61 h). Cell cycle distriutions of shm-treted (7) nd ADR-treted (+) cells were otined t di erent times fter the end of ADR tretment ltertions in cell cycle distriutions were qulittively similr in oth cell lines. Furthermore, t the 24 h time point, doses of 1, 5, 10 nd 25 mm ADR ech induced down-regultion of BRCA1 nd BRCA2 mrnas in prentl MCF-7 cells; wheres these doses cused distinct chnges in cell cycle distriution, chrcterized y loss of cells from t lower doses nd inhiition of -phse progression t higher doses. In oth cell lines, there were few or no cells with su-g1 DNA content, consistent with the lck of DNA frgmenttion on DNA grose gel electrophoresis. These comprisons suggest tht the e ects of ADR on BRCA1 nd BRCA2 levels do not exctly correspond with ADR-induced chnges in the cell cycle distriutions of MCF-7 prentl or MCF-7/p cells. E ects of other cytotoxic gents on BRCA1 nd BRCA2 mrna levels nd on cell survivl We studied the e ects of pnel of di erent cytotoxic gents on BRCA1 nd BRCA2 mrna levels in prentl MCF-7 cells s well s cell clone expressing mutnt p53 (MCF-7/p mutnt clone 3). For this study, we used reltively high dose of ech drug [15 mm61 h, except for pclitxel (TAXOL) nd vincristine (VCR), which were pplied for full 24 h]. Of the gents tested, ADR, cmptothecin (CPT), nd ultrviolet rdition (U.V.@254 nm, 10 J/m 2 ) induced decreses in BRCA1 nd BRCA2 mrna levels in oth prentl nd MCF-7/p cells (Figure 7). In ddition, the microtuuledisrupting gents TAX nd VCR nd the lkylting gent nitrogen mustrd (HN2) lso induced detectle decreses in BRCA1 nd BRCA2 mrna levels in MCF-7 prentl cells, ut not in MCF-7/p cells. To determine if the down-regultion of BRCA1 nd BRCA2 y cytotoxic gents ws relted to the ility of these gents to induce incresed levels of p53 protein, we performed Western lot nlysis under the sme conditions. In prentl cells, ADR, CPT, nd U.V. ech induced lrge increses in the levels of p53 protein, while HN2 induced smller increse, nd TAX nd VCR induced smll ut detectle increses. In contrst, MCF-7/p cells expressed reltively high sl levels of p53, which were slightly incresed y some of the tretments, prticulrly CPT. Downregultion of BRCAl nd BRCA2 therefore ppered to correlte with the ility of the gents tested to induce lrge increses in the levels of WT p53 protein in prentl MCF-7 cells. We lso determined the e ects of the cytotoxic gents on the levels of p21 wf/cip1 protein, p53- regulted inhiitor of G1 cyclin-dependent kinses. Levels of p21 increse in response to induction of p53 y DNA-dmging gents such s ionizing rdition; nd p21 medites the p53-dependent G1 cell-cycle rrest (reviewed y Levine, 1997). However, for oth prentl nd MCF-7/p cells, U.V. nd ADR ech induced decreses in p21 protein levels fter 24 h fter tretment, while CPT induced n increse in p21 levels (Figure 8). Thus, p21 wf/cip1 protein levels nd BRCA1 nd BRCA2 mrna levels do not pper to e co-ordintely regulted in MCF-7 cells. Figure 7 shows the e ects of the sme cytotoxic tretments on cell survivl, using the trypn lue dye exclusion ssy. For oth prentl nd p53 mutnt cell lines, ech of the gents tested cused some degree of cytotoxicity. However, the ility of n gent to downregulte BRCA1 nd BRCA2 mrnas did not pper to e directly linked to cytotoxicity. For exmple, t cell survivl level of out 80%, HN2 (Figure 7) nd ADR (Figure 4) induced mrked down-regultion. On the other hnd, the microtuule disrupting gents TAX nd VCR induced mrked toxicity in oth prentl nd p53 mutnt cells (c. 50% survivl); ut these gents induced down-regultion of BRCA1 nd BRCA2 only in the prentl cells. The gents CDDP, VP-16, nd dfdc were toxic to prentl nd mutnt cells (cell survivl levels from out 55 ± 90%), ut did not cuse down-regultion of BRCA1 or BRCA2 in either cell line.

7 Tle 1 E ects of exposure to drimycin (ADR) on the cell cycle distriutions of MCF-7 prentl nd MCF-7/p (mutnt clone 3) cells (A) Cell cycle distriutions 24 h fter 1 h exposure to vrious doses of ADR 2235 Cell Percentge of cells (mm ADR) Cell line cycle phse MCF-7 Prentl G0/G MCF-7/p G0/G (B) Cell cycle distriutions t vrious times fter tretment without (±) or with (+) ADR (5 mm61 h) Percentge of cells Cell MCF-7 Prentl MCF-7/p Time (h) cycle phse ± + ± + 6 G0/G1 G2M 12 G0/G1 24 G0/G1 48 G0/G1 72 G0/G Cells were treted nd nlysed s descried in the Mterils nd methods section. These dt correspond to the ow cytometry histogrms shown in Figure 6 nd Figure 6, respectively Dose-dependent ltertions in BRCA1/BRCA2 expression, cell survivl, nd cell cycle distriution of wild-type MCF-7 cells treted with U.V. rdition While U.V. dose of 10 J/m 2 potently down-regulted BRCA1 nd BRCA2 expression, this dose ws mrkedly cytotoxic for prentl MCF-7 cells (30% survivl fter 24 h). We, therefore, performed dditionl studies to determine if down-regultion occurred t lower U.V. doses. U.V. tretment induced dosedependent down-regultion of BRCA1 nd BRCA2 mrnas (Figure 9). Decresed levels of oth mrnas were oserved t the lowest dose tested (2.5 J/m 2 ); nd dose of 5 J/m 2 ws su cient to induce mximl down-regultion. At these U.V. doses, cell survivl levels mesured y trypn lue dye exclusion were out 90% nd 75%, respectively (Figure 9). urvivl levels declined progressively with incresing dose, with less thn 10% surviving cells t dose of 20 J/m 2. These ndings re qulittively similr to the results otined with ADR; nd they suggest tht higher doses of U.V. rdition re required to reduce cell viility thn re required to inhiit BRCA1 nd BRCA2 mrna expression. The e ect of U.V. tretment on the cell cycle distriution of prentl MCF-7 cells is shown in Figure 9c nd in Tle 2. At 24 h fter irrdition, U.V. induced n increse in the G0/Gl popultion (up to +12%), ssocited with smll-moderte decreses in the proportion of cells in the nd phses [up to 7(5 ± 8)%]. These ndings re consistent with U.V.-induced G1 cell cycle rrest. In contrst, in the sme cell line, ADR induced predominntly G2 cell cycle rrest (Figure 6). Furthermore, U.V. dose of 2.5 J/m 2, which ws su cient to cuse mrked down-regultion of BRCA1 nd BRCA2 mrnas, hd reltively little e ect on cell cycle distriution t 24 h, t which time there ws no net loss of cells from -phse. Thus, while ADR nd U.V. rdition ech induced dosedependent down-regultion of BRCA1 nd BRCA2 mrna expression, the e ects of these two DNAdmging gents on the cell cycle distriution of MCF-7 cells were distinct. Discussion We show here tht in MCF-7 humn rest cncer cells, levels of mrnas for the rest cncer susceptiility genes BRCA1 nd BRCA2 were reduced following tretment with cytotoxic gents tht re potent inducers of the wild-type p53 tumor suppressor protein. These gents include drimycin, cmptothecin, nd ultrviolet rdition. For ADR, decresed levels of BRCAl nd BRCA2 were rst oserved etween 6 nd 12 h fter drug tretment nd were dose-dependent. The ADR-induced down-regultion of BRCA1 nd BRCA2 did not pper to e directly relted to the induction of poptotic DNA frgment-

8 tion or cell deth. Thus, in wild-type MCF-7 cells, prominent down-regultion of BRCA1 nd BRCA2 mrnas ws oserved t ADR or U.V. doses for which cell survivl ws 590%. It is unlikely tht the down-regultion of BRCA1 nd BRCA2 in wild-type MCF-7 cells ws solely due to ltertions of the cell PARENTAL p CON TAXOL VCR VP16 ADR dfdc CDDP CPT UV HN2 CON TAXOL VP16 ADR dfdc CDDP CPT UV HN2 BRCA1 BRCA2 ACTIN RNA Figure 7 E ect of di erent cytotoxic gents on BRCA1/BRCA2 mrna levels nd cell viility in MCF-7 prentl nd MCF-7/ p cells. Cells were treted with di erent gents; nd 24 h fter tretment, totl cell RNA ws extrcted for semi-quntittive RT ± PCR nlysis of BRCA1, BRCA2, nd -ctin (). In prllel experiment, cultures were hrvested 24 h fter tretment for ssessment of cell viility using the trypn lue dye exclusion ssy (). Results re expressed s the percentge of `surviving' (i.e., trypn lue dye excluding) cells. Cell survivl vlues re mens+rnges of duplicte determintions in which over 500 cells were counted. Arevitions: TAXOL, pclitxel; VCR, vincristine; VP-16, etoposide; ADR, drimycin; dfdc, gemcitine; CDDP, cispltinum; U.V., ultrviolet rdition; CPT, cmptothecin; HN2, nitrogen mustrd. The doses of gents were s follows: 15 mm61 h (VP-16, ADR, dfdc, CDDP, CPT, nd HN2); 15 mm624 h (TAXOL nd VCR); U.V. (10 J/m 2 ) CON ADR CDDP CPT dfdc HN2 Txol VCR UV VP16 CON CON ADR CDDP CPT dfdc HN2 Txol VCR UV VP PARENTAL p p53 p21 ACTIN Figure 8 E ect of di erent cytotoxic gents on the p53 nd p21 protein levels in MCF-7 prentl nd MCF-7/p cells. Cells were treted with cytotoxic gents s descried in Figure 7 legend nd in the text. After 24 h, p53 nd p21 levels were determined y Western lotting

9 2237 BRCA1 β-actin BRCA2 M M M c Figure 9 Dose-dependent ltertions in BRCA1/BRCA2 mrna levels, cell viility, nd cell cycle distriution following the tretment of prentl MCF-7 treted with ultrviolet (U.V.) rdition. () shows BRCA1, BRCA2, nd -ctin mrna levels in prentl MCF-7 cells 24 h fter exposure to the indicted doses of U.V. rdition (254 nm, 10 J/m 2 /min). () shows cell survivl s function of U.V. dose, mesured y trypn lye dye exclusion ssy 24 h fter irrdition. (c) shows ow cytometric nlysis of the DNA content of propidium iodide-stined nuclei from cells treted s descried ove Tle 2 E ect of ultrviolet (U.V.) rdition on the cell cycle distriution of MCF-7 prentl cells 24 h fter irrdition Cell cycle Percentge of cells (J/m 2 U.V.) phse G0/G Cells were treted with U.V.-C. rdition t room temperture, incuted t 378C for 24 h, nd then nlysed s descried in the Mterils nd methods section. These dt correspond to the ow cytometry histogrms shown in Figure 9c cycle distriution, since (1) the dose- nd timedependent ltertions in cell cycle distriution induced y ADR nd U.V. did not correlte well with ltertions in BRCA1 nd BRCA2 mrna levels; nd (2) U.V. rdition nd drimycin ± oth of which potently down-regulted BRCA1 nd BRCA2 ± cused qulittively distinct cell cycle ltertions. Thus, our ndings suggest tht humn rest cncer cells respond to certin types of DNA dmge y down-regulting BRCA1 nd BRCA2 expression. While the BRCAl nd BRCA2 mrna responses occurred y 6 ± 12 h fter ADR tretment, downregultion of the BRCA1 protein required longer times (424 h), presumly ecuse the protein hs longer hlf-life thn the mrna. The lck of immedite quntittive down-regultion of BRCA1 protein does not neccessrily men tht BRCA1 is not involved in very erly cellulr responses to DNA dmge. One recent study indictes tht DNA dmge of MCF-7 cells (y U.V., gmm rys, or mitomycin C) cused very rpid (51 h) redistriution of BRCA1 nd severl BRCA1 inding prtners (Rd51 nd BARD1) to multi-protein complexes contining proliferting cell nucler ntigen (PCNA) nd dmged DNA (cully et l., 1997). In prllel with nucler redistriution in - phse, hyper-phosphoryltion of BRCA1 ws oserved. The uthors speculted tht BRCAl loclizes t sites of repliction-relted DNA repir, nd tht BRCA1 my prticipte in n -phse DNA-dmge check-point response. Interestingly, BRCA1-medited cell cycle rrest ws found to require the p21w /cipl protein; nd BRCA1 ws found to trnsctivte p21 promoterreporter constructs even in the sence of the p53 inding sites (omsundrm et l., 1997). In nother study utilizing norml mmmry epithelil cells, consitutive expression of BRCA1 cdna contstruct encoding only the C-terminl trnscription ctivtion domin led to more rpid cell cycle progression nd filure of nocodzole, mitotic spindle poison, to rrest cells in M (Lrson et l., 1997). Thus, BRCA1 my lso e involved in G2-M cell cycle check-point mechnism. In the context of these considertions, we speculte tht the delyed loss of BRCA1 in ADR nd U.V.- treted cell lines my e prt of survivl response tht llows cells tht hve su ciently repired their DNA dmge to re-enter the cell cycle or tht protects these cells ginst BRCA1-medited poptosis. This ide is consistent with the oservtions tht overexpression of BRCA1 cuses inhiition of cell prolifertion nd renders cells more susceptile to the induction of poptosis (Holt et l., 1996; ho et l., 1996); wheres, ntisense inhiition of BRCA1 expression stimultes cell prolifertion nd renders

10 2238 cells more resistnt to the induction of poptosis (Thompson et l., 1995; Ro et l., 1996). It hs een reported tht rest cncers from ptients with germline muttions of BRCA1 or BRCA2 hve 2 ± 3-fold increse of chromosoml loss s compred to spordic cncers (Tirkkonen et l., 1997). This nding is lso consistent with the ide tht the loss of BRCA1 my permit the survivl nd susequent prolifertion of cells with residul DNA dmge. Tken together with the recent reports tht the BRCA1 nd BRCA2 proteins cn ssocite with the DNA recominse/repir protein Rd51, these oservtions suggest possile roles for BRCA1 nd BRCA2 in the sensing of nd/or response to some forms of DNA dmge. The p53 dependence of ADR-induced BRCA1 nd BRCA2 response suggests tht p53 my collorte with BRCA1 nd BRCA2 in the detection of nd response to DNA dmge. The mechnism of this presumed collortion is uncler. One possiility is tht p53 induces trnscriptionl silencing of the BRCA1 nd BRCA2 genes, possile mechnism for the p53-induced down-regultion of the Bcl-2 cell survivl gene (Miyshit et l., 1994). However, there re other possile mechnisms for the ADR-induced decreses in BRCA1 nd BRCA2 levels, including post-trnscriptionl ltertions leding to decresed hlf-life of the BRCA1 nd BRCA2 mrnas. Recently, p53 hs een found to ind to severl di erent proteins, including components of the TFIIH RNA polymerse II sl trnscription fctor (helicses ERCC2 nd ERCC3), other trnscription fctors (TATA ox-inding protein, TAF70, TAF30), the protein kinse c-al, nd two novel p53-inding proteins designted 53BP1 nd 53BP2 (Frmer et l., 1996; Bork et l., 1997; Dtt et l., 1996; Numovski nd Clery, 1996; Gorin nd Pvletich, 1996; Clleut nd Mornon, 1997). 53BP1 nd 53BP2 ind to the region of the p53 sequence-speci c DNAinding domin (etween residues 102 nd 292), ut the precise inding sites for DNA inding nd inding to these two proteins my not e identicl (Thukrl et l., 1996). Interestingly, protein sequence nlysis suggests the presence of domins homologous to 53BP1 in the C- terminl region of BRCA1 nd in other proteins thought to e involved in DNA-dmge cell cycle checkpoints nd/or in DNA repir (Koonin et l., 1996). The 53BP1-like domin in the C-terminus of BRCA1 corresponds closely to the recently identi ed miniml trnsctivtionl domin of BRCA1 (Chpmn nd Verm, 1996; Monteiro et l., 1996). An interferon-inducile trnscriptionl inhiitor (p202 in the mouse) inds to the murine homolog of 53BP1 nd inhiits the expression of reporter genes under the control of severl p53-ctivtle promoter segments (p21 wf/cip1 nd Mdm2) (Dtt et l., 1996). 53BP2 cn directly ind to nd inhiit the ctivity of protein phosphtse 1 (PP1), suggesting tht it might e involved in dephosphoryltion nd regultion of p53 (Helps et l., 1995). These considertions rise the possiility tht selective competing interctions mong memers of this group of proteins (p53, 53BP1, 53BP2, BRCA1, PP1, nd p202-like proteins) my medite di erent spects of the cellulr response to DNA dmge. Prticulrly intriguing re the possiilities tht p53 my either directly ind to the C- terminl 53BP1-like domin of BRCA1 or tht 53BP1 my compete with this domin for inding to other fctors (e.g. p202-like proteins) nd therey regulte p53-medited trnscriptionl ctivtion of trget genes. Although p53 my ply role in modulting the ility of rest cncer cells to down-regulte BRCA1 nd BRCA2 expression, it is cler from our studies tht vrious cytotoxic gents cn induce downregultion in rest cncer cell lines tht contin mutnt p53. It is interesting tht two gents tht potently down-regulte BRCA1 nd BRCA2 mrna expression (ADR nd U.V.) lso prdoxiclly induced down-regultion of p21 protein levels. This downregultion ws oserved in MCF-7 cells contining wild-type or mutnt p53; nd in wild-type MCF-7 cells, down-regultion of p21 expression occurred in spite of the ctivtion of p53. The mechnism(s) of p53- independent regultion of p21 expression hve not een elucidted; ut severl recent reports hve implicted p300 nd BRCA1 s potentil trnscriptionl ctivtors of p21. Thus, p53-medited trnscriptionl ctivtion of p21 promoter-reporter construct ws locked y speci c interction of denovirus E1A with the trnscriptionl dpter molecule p300 (omsundrm nd El-Deiry, 1997); nd trnsfection of BRCA1 into humn crcinom cells ctivted the p53-independent trnscription of p21 promoterreporter construct (omsundrm et l., 1997). It is unlikely tht the down-regultion of p21 is relted found in our study is cuslly linked to the down-regultion of BRCA1, since BRCA1 protein levels do not decline until fter 24 h. However, it is possile tht p300 or its homolog p265/cbp my e involved in the p53-independent regultion of p21 in ADR nd U.V. treted rest cncer cells. It is not known if p300 or p300-relted proteins ply signi cnt role in the cellulr response to DNAdmging gents. In conclusion, we found tht severl DNA-dmging gents induced down-regultion of BRCA1 nd BRCA2 mrna levels in MCF-7 nd other humn rest cncer cell lines. The sensitivity of MCF-7 cells to drimycin-induced down-regultion of BRCA1 nd BRCA2 ws correlted with the p53 functionl sttus of the cells. These ndings re consistent with the hypothesis tht BRCA1 nd BRCA2 prticipte in the detection nd/or repir of DNA dmge. Further reserch is required to estlish the mechnism(s) nd functionl signi cnce of down-regultion of BRCA1 nd BRCA2. Mterils nd methods Mterils All cell lines studied were initilly otined from the Americn Type Culture Collection. Cell culture regents were purchsed from BioWhittker. TriPure TM, G418, nd PCR regents were otined from Boehringer Mnnheim. Lipofectmine TM, reverse trnscriptse, nd PCR primers were products of Life Technologies. The p53 nd control plsmids were generous gifts of Dr Bert Vogelstein. Other regents were otined from igm Biochemicl Corp.

11 The primry ntiodies used for Western lotting were s follows: p53 [A-2 (pa1801), mouse monoclonl, Oncogene Reserch Products]; BRCA1 (C-20, rit polyclonl IgG, nt Cruz Biotechnology); p21 (H-164 mouse monoclonl, nt Cruz); nd -ctin (I-19, rit polyclonl IgG, nt Cruz). The BRCA1 ntiody ws rised ginst peptide corresponding to mino cids 1843 ± 1862 mpping to the C- terminus of humn BRCA1. Horserdish peroxidse-conjugted secondry ntiodies were purchsed from nt Cruz. Cell culture Cell lines were mintined in DMEM supplemented with 10% fetl clf serum (v/v), L-glutmine (5 mm), nonessentil mino cids (5 mm), penicillin (100 U/ml), nd streptomycin (100 mg/ml), s previously descried (Rosen et l., 1991). Genertion of p53 trnsfectnts Trnsfections were performed using Lipopectmine TM Regent (Life Technologies) ccording to the mnufcturer's instructions. MCF-7 cells, which contin wild-type p53, were trnsfected with plsmid pc53-cx3, which contins cdna encoding dominnt negtive mutnt p53 (p vl? l) nd the neomycin resistnce gene (Kern et l., 1992). Control cells were trnsfected with the prent vector pcmv-neo-m. Trnsfectnts were selected in 0.5 mg/ml G418 nd isolted using cloning rings. Trnsfected clones were screened for p53 functionl sttus y Western lotting of p53 in cells treted without nd with drimycin (see Results) nd U.V. rdition (dt not shown). Cell clones tht stly expressed mutnt p53 or neo only were frozen nd stored in liquid nitrogen. Tretment with cytotoxic drugs nd U.V. rdition Cells were grown in 100 mm plstic Petri dishes to out 40 ± 50% of con uence nd then exposed to ADR (5 mm61 h) in DMEM supplemented with 5% fetl clf serum. Cells were then wshed twice in serum-free medium nd incuted t 378C in fresh DMEM contining 5% serum for 24 h. Control cells were treted identiclly, except tht no ADR ws dded. Cells were then soluilized in TriPure TM for RNA extrction or in protein lysis u er for Western lotting. In some cses, di erent doses of ADR nd di erent post-adr incution times were tested; nd in other experiments, di erent cytotoxic drugs were utilized (s descried in the Results nd Figure legends). U.V. irrdition ws performed t 258C using U.V.-C. rdition (254 nm) from Philips U.V. lmp t dose rte of 10 J/m 2 min. The dose intensity ws mesured using Blck- Ry W meter (model J-225, UVP Inc.). Culture medium ws removed immeditely efore U.V. tretment; nd fresh medium ws dded ck immeditely fter tretment. Cells were then post-incuted t 378C for 24 h s descried ove. emi-quntittive RT ± PCR nlysis Totl cell RNA ws extrcted from cell monolyers using TriPure TM regent, ccording to the mnufcturer's instructions. The extrcted RNA ws treted with DNse nd puri ed y phenol-chloroform extrction. Aliquots of RNA (5 mg) were then reverse trnscried using uperscript II TM reverse trnscriptse (Life Technologies). Aliquots of cdna corresponding to 0.5 mg of originl RNA were used for PCR mpli ction. PCR mpli ction ws performed in Perkin-Elmer DNA therml cycler. DNA ws rst dentured for 3 min t 948C, then mpli ed using cycles of 1 min t 948C, 1 min t 508C,nd1mint 728C, with nl 7 min incution t 728C. The cycle numer ws djusted so tht ll rections were within the liner rnge of product mpli ction. The forwrd nd reverse PCR primers nd the expected sizes of the PCR products were s follows: BRCA1: 5'?3' TTGCGGGAGGAAAATGGGTAGTTA; BRCA2: 3'?5' TGTGCCAAGGGTGAATGATGAAG; 285 p 5'?3' CGTACACTGCTCAAATCATTC; 3'?5' GACTAACAGGTGGAGGTAAAG; 248 p -Actin: 5'?3' TTGTTACCAACTGGGACGATA; 3'?5' GATCTTGATCTTGGTGCT; 764 p The 287 p segment mpli ed from BRCA1 ws locted from positions 5239 to 5502 in the pulished cdna sequence (GenBnk ccession numer U15595, sumitted y Miki et l., 1994). The 248 p segment mpli ed from BRCA2 ws locted from positions 9833 to in the pulished cdna sequence (GenBnk ccession numer U43746, sumitted y Tvtigin et l., 1996). -ctin ws mpli ed s control, resulting in 764 p product locted from positions 265 to The identity of ech of the three PCR products ws con rmed y complete sequencing of the puri ed product, performed t the DNA sequencing fcility t Alert Einstein College of Medicine (Bronx, NY). PCR products were nlysed y electrophoresis through grose gels contining ethidium romide. DNA frgmenttion ssy Cells to e ssyed were detched with trypsin nd counted. mples were normlized to cell numer ( ± cells) nd wshed twice in phosphteu ered sline (PB). Apoptotic DNA ws ssessed y minor modi ction of the protocol descried y Hermnn et l. (1994). Cells were lysed in 0.1 ml of DNA lysis u er (1% NP-40, 20 mm EDTA, 50 mm Tris-HCl, ph 8.0) nd centrifuged for 5 min t 1600 g. The pellet ws re-extrcted with 0.1 ml of DNA lysis u er; nd the superntnts were comined. D ws dded to nl concentrtion of 1%; nd the lystes were treted with 5 mg/ml of RNse A for 2 h t 568C. Proteinse K ws dded to nl concentrtion of 2.5 mg/ml; nd the lystes were incuted for 2 h t 378C. DNA ws precipitted y the ddition of 0.1 ml of mmonium cette (3 M, ph5.5)nd 0.75 ml of ethnol nd incution for 30 min t 7808C. After microfuging, pellets were re-suspended in Tris-EDTA u er nd electrophoresed through 1.2% grose gels contining 0.1 mg/ml of ethidium romide. Western lotting Cells were centrifuged, wshed with phosphte-u ered sline (PB), nd lysed t 08C for 30 min in 100 ± 200 ml of lysis u er per 100 mm dish [1% NP-40, in PB contining 2mM 4-(2-minoethyl)-enzen-sulfonyl uoride, 10 mg/ml leupeptin, 10 mg/ml protinin, 10 mm NF, 1 mm N orthovndte, nd 5 mm N pyrophosphte). Protein concentrtions were determined using the BioRd dyeinding microssy. Equl liquots of protein (100 mg/lne) were electrophoresed through 8% or 12% D-polycrylmide gels fter oiling for 5 min in Lemmli smple u er. Proteins were then trnsferred to PVDF memrnes nd locked in Tris-Tween locking u er contining 5% non-ft dry milk. Memrnes were then lotted with the pproprite ntiody t dilution of 1 : 1000 (p53, p21, - ctin) or 1 : 300 (BRCA1) nd then incuted with horserdish peroxidse-conjugted secondry ntiody t dilution of 1 : Blotted proteins were visulized using the enhnced chemiluminescence detection system (Amershm Life ciences). Equlity of protein loding ws con rmed y fst green stining of the memrne nd y immunolotting for -ctin. Colored mrkers (BioRd Corp.) were used s moleculr size stndrds. 2239

12 2240 Growth curves Cells suspended in DMEM contining 5% fetl clf serum were plted t density of cells in 0.5 ml of medium per well in 24-well pltes on Dy 2. On Dy 0, cells were treted with ADR (5 mm61 h), s descried ove. At di erent times, cells were detched using trypsin, nd the entire contents of ech well ws counted using model ZM 901 Coulter Counter TM. Vlues re expressed s mens+s.d. of triplicte determintions. Cytotoxicity ssys Trypn lue dye exclusion ssy Cells to e ssyed were hrvested using trypsin nd stined with 0.4% trypn lue dye. Trypn lue positive nd negtive cells were counted using hemcytometer under phse contrst microscopy. At lest two elds of over 500 cells were ssessed for ech smple ssyed. Cell viility (`survivl frction') ws clculted s the percentge of cells tht excluded trypn lue dye. MTT dye conversion ssy MTT ssys were performed s descried efore (Alley et l., 1988). This ssy is sed on the the ility of vile cells to convert MTT, solule tetrzolium slt [3-(4,5-dimethylthizol-2-yl)-2,5 diphenyl tetrzolium romide] into n insolule formzn precipitte, which is quntitted y spectrophotometry following soluiliztion in dimethyl sulfoxide. Brie y, sucon uent cells in 96-well dishes were treted with cytotoxic gents nd then post-incuted for 3 dys in the sence of the gent. At this time, the cells were soluilized nd sornce redings were tken using Dyntech 96-well spectrophometer. The mount of MTT dye reduction ws clculted sed on the di erence etween sornce t 570 nm nd t 630. Cell `survivl' ws expressed s the mount of dye reduction reltive to tht of untreted control cells. Flow cytometry mples were prepred for ow cytometry s descried y Fn et l. (1995). Cells were detched using trypsin, wshed in PB, nd xed in 75% ethnol. Fixed cells were stored t 48C until use. Cells were then wshed in PB, treted with RNse (500 units/ml, igm) for 15 min t 378C nd stined with propidium iodide (50 mg/ml in PB). Cell cycle nlysis ws performed on Becton- Dickinson Fluorescence-Activted Cell orter t the ow cytometry fcility of the Alert Einstein College of Medicine (Bronx, NY). The dt were nlysed to otin cell cycle distriutions using the MODFIT progrm. Acknowledgements The uthors re grteful to Drs Dvid Rlph nd Timothy Connolly for their dvice, nd to Dr Bert Vogelstein for the generous gift of the p nd control plsmids. This work ws supported y UPH grnt R01-CA64869, Americn Cncer ociety grnt EDT-102. References Alley MC, cudieco DA, Monks A, Hursey ML, Czerwinski MJ, Fine DL, Aott BJ, Myo JG, hoemker RH nd Boyd MR. (1988). Cncer Res. 48, 589 ± 601. Bork P, Hofmnn K, Bucher P, Newld AF, Altschul F nd Koonin EV. (1997). Fse J., 11, 68 ± 76. Clleut I nd Mornon JP. (1997). FEB Lett. 400, 25 ± 30. Chpmn M nd Verm I. (1996). Nture, 382, 678 ± 679. Chen Y, Frmer AA, Chen C-F, Jones DC, Chen P-L nd Lee W-H. (1996). Cncer Res., 56, 3168 ± Dtt B, Li B, Chouey D, Nllur G nd Lengyel P. (1996). J. Biol. Chem. 271, ± Eston DF, Bishop DT, Ford D, Crockford BP nd the rest cncer linkge consortium. (1993). Am. J. Humn Genet., 52, 678 ± 701. Fn,mithML,RivetDJII,DuD,ZhnQ,KohnKW, Fornce Jr. AJ, nd O'Connor PM. (1995). Cncer Res., 55, 1649 ± Frmer G, Colgn J, Nktni Y, Mnley JL nd Prives C. (1996). Mol. Cell. Biol. 16, 4295 ± Gorin nd Pvletich, NP. (1996). cience, 274, 1001 ± Guds J, Li T, Nguyen H, Jensen D, Ruscher FJ nd Cown KH. (1996) Cell Growth nd Di er., 7, 712 ± 717. Helps NR, Brker HM, Elledge J nd Cohen PT. (1995). FEB Lett., 377, 295 ± 300. Hermnn M, Lorenz HM, Voll R, Grunke M, Woith W nd Klden JR. (1994). Nucl. Acids. Res., 22, 5506 ± Holt JT, Thompson ME, zo C, Roinson-Benion C, Arteg CL, King M-C nd Jensen RA. (1996). Nt. Genet., 12, 298 ± 302. Jensen RA, Thompson ME, Jetton TL, zo CI, vn der MeerR,HelouB,TronickR,PgeDL,KingMCnd Holt JT. (1996). Nt. Genet., 12, 303 ± 308. Kern E, Pietenpol JA, Thiglinghm, eymour A, Kinzler KW nd Vogelstein, B. (1992). cience, 256, 827 ± 830. Koonin VF, Altschul F nd Bork, P. (1996). Nt. Genet., 13, 266 ± 267. Lrson J, Tonkinson JL nd Li MT. (1997). Cncer Res., 57, 3351 ± Levine, AJ. (1997). Cell, 88, 323 ± 332. Miki Y, wensen J, httuck-eidens D, Futrel PA, Hrshmn K, Tvtigin, Liu Q, Cochrn C, Bennett LM,DingW,BellR,RosenthlJ,HusseyC,TrnT, McClure M, Frye C, Httier T, Phelps, R, Hugen-trno A, Ktcher H, Ykumo K, Gholmi Z, h er D, tone, Byer, Wry C, Bogden R, Dynth P, Wrd J, Tonin P, Nrod, Bristow P, Norris FH, Helvering L, Morrison P, Rosteck P, Li M, Brrett JC, Lewis C, Neuhusen, Cnnon-Alright L, Goldgr D, Wisemn R, Km A nd kolnick MH. (1994). cience, 266, 66 ± 71. Miyshit T, Krjewski, Krjewsk M, Wng HG, Lin HK, Lieermnn DA, Ho mnn B nd Reed JC. (1994) Oncogene, 9, 1799 ± Monteiro AN, August, A nd Hnfus H. (1996). Proc. Nt. Acd. ci., 93, ± Numovski L nd Clery ML. (1996) Mol. Cell. Biol., 16, 3884 ± Rjn JV, Wng M, Mrquis T nd Chodosh L. (1996). Proc. Nt. Acd. ci., 93, ± Ro VN, ho N, Ahmd M nd Reddy E. (1996). Oncogene, 12, 523 ± 528. Rosen EM, Golderg ID, Liu D, etter E, Donovn MA, Bhrgv M, Reiss M, Kcinski BM. (1991). Cncer Res., 57, 5315 ± cully R, Chen J, Ochs RL, Keegn K, Hoekstr M, Feunteun J nd Livingston DM. (1997). Cell, 90, 425 ± 443. cully R, Chen J, Plug A, Xio Y, Wever D, Feunteun J, Ashley T nd Livingston DM. (1997). Cell, 88, 265 ± 275. cully R, Gnesn, Brown M, De Cprio JA, Cnnistr A, Fenteun J, chnitt nd Livingston DM. (1996). cience, 272, 123 ± 125. ho N, Chi YL, hym E, Reddy P nd Ro VN. (1996). Oncogene, 13, 1±7.

13 hrn K, Morimtsu M, Alrecht U, Lim D-, Regel E, Dinh C, nds A, Eichele G, Hsty P nd Brdley A. (1997). Nture, 386, 804 ± 810. omsundrm K nd EL-Deiry W. (1997). Oncogene 14, 1047 ± omsundrm K, Zhng H, Zeng Y-X, Houvrs Y, Peng Y, Zhng H, Wu G, Licht JD, Weer BL nd El-Deiry W. (1997). Nture, 389, 187 ± 190. pillmn MA nd Bowcock AM. (1996). Oncogene, 13, 1639 ± tevensner T nd Bohr VA. (1993). Crcinogenesis, 14, 1841 ± Tvtigin V, imrd J, Rommens J, Couch F, httuck- Eidens D, Neuhusen, Merjver, Thorlcius, O t K, topp-lyonnet D, Belnger C, Bell R, Berry, Bogden R, Chen Q, Dvis T, Dumont M, Frye C, Httier T, Jmmulpti, Jnecki T, Jing P, Kehrer R, Lelnc J- F, Mitchell JT, McArthur-Morrison J, Nguyen K, Peng Y, mson C, chroeder M, nyder C, teele L, tringfellow M, troup C, wedlund B, wensen J, Teng D, Thoms A, Trn T, Trn T, Trnchnt M, Wever- Feldhus J, Wong AKC, hizuy H, Eyfjord JE, Cnnon- Alright L, Lrie F, kolnick MH, Weer B, Km A nd Goldgr DE. (1996). Nt. Genet., 12, 333 ± 337. Thoms JE, mith M, Ruinfeld B, Gutowski M, Beckmnn RP nd Polkis P. (1996). J. Biol. Chem., 271, ± Thompson M, Jensen RA, Oermiller P, Pge DL nd Holt JT. (1995). Nture Genet., 9, 444 ± 450. Thukrl K, Blin GC, Chng KK, nd Fields. (1996). Mol. Cell. Biol., 14, 8315 ± Tirkonnen M, Johnnson O, Agnrsson BA, Olsson H, Invrsson, Khru R, Tnner N, Isol J, Brkrdottir RB, Borg A nd Kllioniemi O-P. (1997). Cncer Res., 57, 1222 ± Vughn JP, Dvis PL, Jroe MD, Huper G, Evns AC, Weismn RW, Berchuck A, Inglehrt JD, Futrel PA nd Mrks JR. (1996). Cell Growth nd Di er., 7, 711 ± 715. Wosikowski K, Regis JT, Roey RW, Alvrez M, Buters JTM, Guds J nd Btes E. (1995). Cell Growth nd Di eren., 6, 1395 ±