rticle Fig. 1. Lung tumor iossys using heterozygous -deficient mice., Experimentl design.,d, Lung tumor multiplicity in urethne- nd MNU-treted mice, r

Transcription

1 Wildtype cn inhiit lung crcinogenesis in mice rticle Zhongqiu Zhng 1, Yin Wng 2, Hris G. Vikis 3, Leis Johnson 4, Gongjie Liu 1, Jie Li 1, Mrshll W. Anderson 5, Roert C. Sills 6, H.L. Hong 6, Theodor R. Devereux 7, Tyler Jcks 4, Kun-Ling Gun 3 & Ming You 1 These uthors contriuted eqully to this work. Pulished online: 27 August 21, DOI: 1.138/ng721 Although the rs genes hve long een estlished s proto-oncogenes, the dominnt role of ctivted rs in cell trnsformtion hs een questioned. Previous studies hve shown frequent loss of the wildtype llele in oth mouse nd humn lung denocrcinoms. To ddress the possile tumor suppressor role of wildtype in lung tumorigenesis, we hve crried out lung tumor iossy in heterozygous -deficient mice. Mice with heterozygous deficiency were highly susceptile to the chemicl induction of lung tumors when compred to wildtype mice. Activting muttions were detected in ll chemiclly induced lung tumors otined from oth wildtype nd heterozygous -deficient mice. Furthermore, wildtype inhiited colony formtion nd tumor development y trnsformed NIH/3T3 cells nd mouse lung tumor cell line contining n ctivted llele. Allelic loss of wildtype ws found in 67% to 1% of chemiclly induced mouse lung denocrcinoms tht hror mutnt llele. Finlly, n inverse correltion etween the level of wildtype expression nd extrcellulr signl regulted kinse (ERK) ctivity ws oserved in these cells. These dt strongly suggest tht wildtype hs tumor suppressor ctivity nd is frequently lost during lung tumor progression. Introduction Rs oncogenes re frequently detected in humn nd rodent cncers. In humns, ctivted proto-oncogenes hve een oserved in more thn 8% of pncretic cncers, 5% of colorectl cncers nd 3% to 5% of lung denocrcinoms 1. The oncogenic lleles of rs genes hve een referred to s dominnt ecuse their trnsforming ility exists when norml lleles re lso expressed 2,3. However, recent evidence from oth in vivo nd in vitro studies suggests tht the dominnce of the rs oncogene my result from either over-expression of the mutnt rs llele or from deletion of the wildtype llele. The level of rs trnscription in mouse NIH/3T3 cells, s well s other rodent cells trnsformed in vitro with mutnt rs lleles, is much higher thn in control cells 4 8. The mutnt EJ Hrs1 llele, which ws the first oncogenic rs llele isolted from humn tumor cell line, contins not only muttion t codon 12 codon muttion, ut lso one in the lst intron tht increses the gene s expression t lest tenfold compred to the norml rs llele 9. Finney nd Bishop 1 used homologous recomintion to replce one wildtype Hrs1 llele with trnsforming mutnt Hrs1 llele. Although oth the norml nd mutnt Hrs1 lleles were eqully expressed, the heterozygous cells were not trnsformed. Spontneously trnsformed cells rose from cultures of the heterozygous cells nd the trnsformed cells hd mplified the mutnt llele. These dt suggest tht the dominnce of mutted rs lleles with respect to trnsformtion depend upon highly elevted trnscription compred to expression of the wildtype llele. Severl oservtions suggest tht loss of the wildtype rs llele my fcilitte trnsformtion nd tumorigenesis medited y the oncogenic rs llele. Hegi et l 11 reported tht 14% (7 out of 49) of methylene chloride (MeCl) induced mouse lung crcinoms exhiited llelic loss of the wildtype llele while ech retining the ctivted llele. Tumors tht did not contin mutted llele did not show loss of the norml llele. Similr results hve een reported for mouse skin tumors hroring ctivted Hrs1 genes, where the loss of the wildtype llele occurred only in tumors contining mutnt Hrs1 llele 12,13. Reports of vrious GDP-ound dominnt negtive rs mutnts inhiiting cell trnsformtion y ctivted rs provide further evidence tht wildtype rs, which is minly in GDP-ound form, my hve n inhiitory effect on oncogenic trnsformtion in the presence of ctive rs lleles 14,15. Recently, rs effector homolog, RASSF1A, residing t the lung tumor suppressor locus 3p21.3, ws found to e frequently inctivted y the loss of one llele nd hypermethyltion of the remining llele 16. Expression of RASSF1A in lung cncer cells ws shown to reduce colony formtion, suppress nchorge-independent growth nd inhiit tumor formtion in nude mice, suggesting tht RASSF1A is lung tumor suppressor gene 16. We sought to determine the effect of wildtype in lung tumorigenesis. Mice lcking oth lleles re not vile nd die etween 12 nd 14 dys of gesttion due to fetl liver defects nd nemi 17 ; therefore, they could not e tested. However, het- 1 Division of Humn Cncer Genetics nd 2 School of Pulic Helth, The Ohio Stte University Comprehensive Cncer Center, 42 West 12th Avenue, Columus, Ohio, USA. 3 Deprtment of Biologicl Chemistry, University of Michign Medicl School, Ann Aror, Michign, USA. 4 Deprtment of Biology nd Howrd Hughes Medicl Institute, Msschusetts Institute of Technology, Cmridge, Msschusetts, USA. 5 Deprtment of Environmentl Helth, University of Cincinnti, Cincinnti, Ohio, USA. 6 Lortory of Experimentl Pthology nd 7 Lortory of Moleculr Crcinogenesis, Ntionl Institute of Environmentl Helth Sciences, Reserch Tringle Prk, North Crolin, USA. Correspondence should e ddressed to M.Y. (e-mil: you-1@medctr.osu.edu) or Y.W. (e-mil: wng.68@osu.edu). nture genetics volume 29 septemer 21 25

2 rticle Fig. 1. Lung tumor iossys using heterozygous -deficient mice., Experimentl design.,d, Lung tumor multiplicity in urethne- nd MNU-treted mice, respectively. c,e, Lung tumor lod in urethnend MNU-treted mice, respectively. Blnk rs represent +/+ mice nd lck rs re +/ mice. A/J (A/J 129/Sv-)F 1 ; 129/SvlmJ (129/SvlmJ 129/Sv-)F 1 ; C57BL/ 6J (C57BL/6J 129/Sv-)F 1. Asterisks indicte P<.1 compred to wildtype nimls. erozygous -deficient mice re n excellent lterntive to ssess the role of wildtype in lung tumorigenesis ecuse nerly 1% of the lung tumors from inred strins of mice exhiit n ctivted llele 5. Interestingly, we find tht the loss of wildtype llele predisposes these mice to the chemicl induction of lung tumors. Tken together, these findings strongly support role for wildtype s tumor suppressor during lung crcinogenesis. Results Lung tumor formtion in +/ mice We crried out mouse lung tumor iossy to determine whether heterozygous - deficient mice would e more susceptile to chemicl induction of lung tumors thn homozygous wildtype littermtes. We gve six-week-old (A/J 129/Sv- +/ )F 1, (129/ SvlmJ 129/Sv- +/ )F 1 or (C57BL/6J 129/Sv- +/ )F 1 mice, either wildtype or heterozygous for, single intrperitonel (i.p.) injection of urethne t dose of 1 mg/g ody weight (Fig. 1). At 18 weeks fter tretment with urethne, ll three groups of heterozygous -deficient mice hd developed significntly more nd lrger lung tumors thn their homozygous wildtype counterprts. Urethne tretment produced four times s mny tumors per lung in (A/J 129/Sv- +/ )F 1 heterozygous -deficient mice s in wildtype (A/J 129/Sv- +/+ )F 1 littermtes (Fig. 1). Similrly, urethne tretment produced four to five times s mny tumors per lung in (129/SvlmJ 129/Sv- +/ )F 1 nd (C57BL/6J 129/Sv- +/ )F 1 heterozygous -deficient mice s in wildtype littermtes (Fig. 1). The effects on totl lung tumor volume were even more striking: we found over 3-fold, 19-fold nd 8-fold volume increses in heterozygous -deficient mice with n A/J 129/SvJ ckground, 129/SvlmJ 129/Sv ckground nd C57BL/6J 129/Sv mouse ckground, respectively (Fig. 1c). d A/J 129/ Sv-Krs +/ (A/J 129/ Sv- +/ ) F 1 (A/J 129/ Sv- +/+ ) F 1 129/ SvlmJ (129/ SvlmJ 129/ Sv- +/ ) F 1 129/ Sv-Krs +/ (129/ SvlmJ 129/ Sv- +/+ ) F 1 C57BL/6J (C57BL/6J 129/ Sv- +/ ) F 1 129/ Sv-Krs +/ tumors per mouse tumors per mouse A/J A/J 129/SvlmJ 129/SvlmJ (C57BL/6J 129/ Sv- +/+ ) F 1 Krs C57BL/6J +/+ 2 +/ C57BL/6J +/+ +/ c e tumor lod per mouse (mm 3 ) tumor lod per mouse (mm 3 ) crcinogen crcinogen crcinogen crcinogen crcinogen crcinogen A/J A/J C57BL/6J More notly, most of the lrge lung tumors (>6%) from the heterozygous -deficient mice were denocrcinoms (Fig. 2,d,f). In contrst, ll the tumors from wildtype mice treted with either urethne or N-methyl-N-nitrosoure (MNU) were smll lung denoms (Fig. 2,c,e), consistent with studies suggesting tht wildtype inhiits tumor progression 18. These denoms were chrcterized y monomorphic growth pttern nd were generlly comprised of well-differentited cells (Fig.2c,e). Approximtely 6% of the lung tumors of the heterozygous -deficient mice were denocrcinoms (Fig. 2d,f). Mouse lung denocrcinoms were composed of cells with vrying degrees of differentition (Fig. 2f). These tumors showed complete loss of norml lveolr rchitecture, incresed nucler/cytoplsmic rtio, nucler crowding 129/SvlmJ 129/SvlmJ C57BL/6J +/+ +/ +/+ +/ 26 nture genetics volume 29 septemer 21

3 rticle numer of cells ( 1 5 ) nd cytologic typi, heterogeneity of growth ptterns nd invsion into djcent ronchioles or vessels. These results suggest tht loss of wildtype contriutes significntly to the development of undifferentited mlignnt lung tumors. These oservtions were unexpected nd indicte tht the wildtype llele of my ct s tumor suppressor during chemiclly induced lung crcinogenesis. We crried out second lung tumor iossy using MNU s the crcinogen to confirm the urethne dt. MNU is direct-cting lkylting gent tht does not require metolic ctivtion, wheres urethne is procrcinogen tht does require metolic ctivtion. (A/J 129/Sv-+/ )F1, (129/SvlmJ 129/Sv-+/ )F1 nd (C57BL/6J 129/Sv-+/ ) F1 mice were treted with MNU using protocol similr to tht descried for urethne. Tretment of -deficient mice with MNU produced 4- to 6-fold increse in tumor numers nd 32to 5-fold increse in tumor volume in ll three mouse ckgrounds (Fig. 1d,e). These results indicte tht the inhiitory effect of the wildtype llele on mouse lung crcinogenesis is independent of the type of crcinogen dministered B dys in culture 6 c d e f -ctivting muttions in lung tumors We nlyzed lung tumors for -ctivting muttions. Sequence nlysis of the first nd second exons of showed tht ll urethne-induced tumors nlyzed from wildtype mice contined n AT TA trnsversion t the second position of codon 61 (We Tle A). A similr frequency nd type of muttion ws seen in lung tumors from heterozygous -deficient mice treted with urethne. Similrly, ll MNU-induced lung tumors from either wildtype mice or heterozygous deficient mice contined GC AT trnsition t the second position of codon 12 in (We Tle A). The AT TA trnsversion t the second position of codon 61 nd the GC AT trnsition t the second position of codon 12 re consistent with those muttions oserved previously in urethne- nd MNUinduced lung tumors from vrious mouse strins, respectively5. Effect of wildtype on growth chrcteristics of tumor cell lines Bsed on the niml iossy dt, we concluded tht the wildtype llele of cts s tumor suppressor during chemiclly induced lung crcinogenesis. To further estlish the tumor suppressor role of wildtype, we crried out trnsfection experiment to determine whether wildtype could inhiit growth of trnsformed NIH/3T3 cell line nmed R16 nd c numer of colonies Fig. 2. Lung tumors from heterozygous -deficient mice.,, Gross photomicrogrphs of lungs from (A/J 129/Sv-+/+)F1 nd (A/J 129/Sv-+/ )F1 mice, respectively. Note the mrked increse in tumor multiplicity in deficient mice compred to wildtype mice. c,d, Light photomicrogrphs of lung tumors (denoms vs. crcinoms) t 4 mgnifiction from (A/J 129/Sv+/+)F1 nd (A/J 129/Sv-+/ )F1 mice, respectively. e,f, Lung tumors t 4 mgnifictions from (A/J 129/Sv-+/+)F1 nd (A/J 129/Sv-+/ )F1 mice, respectively. Neoplstic cells in lveolr ronchiolr denoms (e) re monomorphic, wheres neoplstic cells in lveolr ronchiolr crcinoms (f) re pleomorphic. Nuclei vry in size nd shpe nd contin multiple prominent nucleoli. 4B B nture genetics volume 29 septemer 21 Fig. 3. Growth suppression y wildtype in trnsformed NIH/3T3 cell line (R16)., Growth curves of the control vs. 4B-trnsfected R16 cells. R16 cells t the sme pssge level were trnsfected under identicl conditions with µg of purified plsmid DNA of either pcr3.1 lone or wildtype 4B. G418-resistnt R16 cells were counted on dys 1 6. Ech dt point is men of two experiments.,c, Inhiition of colony formtion y trnsfected wildtype 4B. One thousnd G418-resistnt R16 cells were seeded into ech of the four (1-cm) dishes, nd incuted in DMEM plus 1% FBS nd 5 µg/ml G418 for 12 dys. Cells were then fixed with 1% uffered formlin nd stined with crystl violet, nd visile colonies (>1.5 mm in dimeter) counted. Asterisks indicte P<.5 compred to -trnsfected cells. 27

4 rticle c Fig. 4. Growth suppression y wildtype in mouse lung tumor cell line (LM2)., Growth curves of the control versus 4B trnsfected LM2 cells. LM2 cells of the sme pssge were trnsfected under identicl conditions with µg of purified plsmid DNA of either pcr3.1 lone or wildtype 4B. G418-resistnt LM2 cells were sucloned into stle clones. One clone, LM2-4S-7, expressed reltively high level of trnsfected wildtype nd ws designted s LM2-4B H. Another clone, LM2-4S-4, expressed n pproximtely threefold lower level of trnsfected wildtype nd ws designted s LM2-4B L. G418-resistnt control, LM2-4B H nd LM2-4B L cells were counted on dys 1 4. Ech dt point is men of two experiments. Asterisks indicte P<.5 compred to -trnsfected cells.,c, Inhiition of colony formtion y trnsfected wildtype 4B. One thousnd G418-resistnt control, LM2-4B H nd LM2-4B L cells were seeded into ech of the four (1-cm)dishes, nd incuted in CMRL 166 plus 1% FBS nd 5 µg/ml G418 for 12 dys. The cells were then fixed nd stined nd visile colonies counted. Asterisks indicte P<.5 compred to -trnsfected cells. d, RT-PCR of unique sequences crried y the trnsfected 4B clones. Lnes 1-14: LM2-4S-1, LM2-4S-2, LM2-4S-3, LM2-4B L, LM2-4B H, LM2-4S-8, LM2-4S-9, LM2-4S-1, LM2-4S-11, LM2-4S-L1, LM2-4S-L3, LM2-4S-L4, LM2-4S-M nd control. mouse lung tumor cell line nmed LM2. R16 ws derived from NIH/3T3 cells trnsformed with mouse lung tumor DNA contining GC AT trnsition t the second position of codon 12 in. R16 cells exhiit high-level expression of mutnt 5 (round 1-fold higher thn tht of the wildtype llele). LM2 is metsttic tumor cell line estlished from urethne-induced lung tumors in the A/J mouse strin 19. It contins n AT GC trnsition t the second position of codon 61 in. As shown in Fig. 3, trnsfection of wildtype into R16 cells significntly inhiited cell growth (8% inhiition y dy 6). Although more thn 65 colonies grew in empty control cells, fewer thn 1 rose from the wildtype -trnsfected NIH/3T3 cells (Fig. 3,c). Trnsfection of the wildtype gene into LM2 significntly inhiited cell growth (9% inhiition y dy 4) in one of the selected clones of the G418- resistnt cells (LM2-4B H) (Fig. 4). LM2-4B H expressed reltively high level of trnsfected wildtype (Fig. 4d). Although more thn 2 colonies grew in empty control cells, fewer thn 1 were seen in LM2-4B H cells (Fig. 4d). An verge of 3 colonies from LM2 cells expressed n pproximtely threefold lower level (designted s LM2-4B L) of the trnsfected wildtype (Fig. 4d), suggesting tht the inhiitory effect of wildtype is dose dependent (Fig. 4 d). Becuse the wildtype llele my ffect expression of the mutnt llele tht is thought to cuse incresed lung tumor development, we next tested whether the inhiitory effect of trnsfected wildtype could e explined y decrese in protein expression of oncogenic. There re no ntiodies ville tht recognize this specific mutnt ; therefore, we used n lterntive method. GTP-ound ut not GDP-ound d Rs cn specificlly ssocite with the Rs inding domin (RBD) of c-rf. Bcterilly expressed GST-RBD ws used s n ffinity mtrix to isolte the GTP-ound, oncogenic form of in the LM2 cell lines. As shown in Fig. 5, equivlent mounts of oncogenic were isolted in ll the cell lines tested tht hd vrying degrees of expression of trnsfected wildtype. LM2-4S-11 nd LM2-4B H expressed reltively high levels of trnsfected wildtype, wheres LM2-4S-3, LM2-4B L, nd LM2-4S-M1 hd reltively low level of trnsfected wildtype. As positive control, 293 cells were trnsfected with either V12 (GTP-ound) or N17 (GDP-ound; Fig. 5), nd only V12 ws ssocited with GST-RBD (Fig. 5). Therefore, the expression of oncogenic is not ffected y overexpression of the wildtype form. Effect of wildtype expression on ERK ctivity Becuse ctivtion of MAP kinse is known to ply n importnt role in cellulr trnsformtion, we ssessed whether expression of wildtype would ffect ERK ctivity. ERK ctivity ws determined y immunolotting with nti-phospho-erk ntiody. ERK ctivity is directly regulted y phosphoryltion of the ctivtion loop, which is recognized y nti-phospho-erk; thus, ERK s kinse ctivity directly correltes with signls detected y nti-phospho- ERK immunolot. As shown in Fig. 5, we sw n inverse correltion etween wildtype expression nd ERK ctivity. LM2-4B H nd LM2-4S-11 cell lines hd reltively high level of expression (Fig. 4d) nd displyed significntly lower ERK ctivity thn control cells (Fig. 5). In contrst, LM2-4B L, LM2-4S-3 nd LM2-4S-M1 cells hd reltively lower level expression (Fig. 4d) nd reltively norml ERK ctivity 28 nture genetics volume 29 septemer 21

5 rticle Fig. 5. Activtion sttus of nd ERK in LM2 cells expressing wildtype., rs ctivtion. Lystes from the LM2 cell lines were incuted with GST-RBD coupled to glutthione grose or glutthione grose lone (left pnel). Bound ws detected y western lot with α-krs2 F234 ntiody (Snt Cruz Biotechnology). HEK 293 cells were trnsfected with expression s for KrsV12 nd N17, lysed nd sujected to the sme inding ssy s ove (right pnel)., ERK ctivity. Totl cell lystes were proed with nti-erk (top pnel) nd nti-phospho-erk (ottom pnel) ntiodies. HEK293 cells without stimultion with EGF were included s negtive control nd HEK293 cells stimulted with EGF were used s positive control. The doulets in the immunolot correspond to ERK1 (44 kd) nd ERK2 (42 kd). α-erk α- phospho-erk K- Rs (Fig. 5). These dt provide possile moleculr mechnism for the inhiitory effect of wildtype on cellulr trnsformtion. However, we oserved significnt growth inhiition even in cell lines tht express low levels of wildtype (such s LM2-4B L in Fig. 4) with no significnt effect on ERK ctivity (Fig. 5), suggesting tht lterntive mechnism(s) lso exists. In vivo tumor growth chrcteristics of wildtype trnsfected cell lines Next, we tested the ility of wildtype to inhiit tumor development y R16 nd LM2 cells in nude mice. Wildtype 4B or n empty ws trnsfected into R16 nd LM2 cells. After G418 selection, pproximtely 1 million cells (from either the wildtype -trnsfected group or the control) were injected sucutneously into ech of the two flnks of nude mice. The nude mice were exmined dily, nd tumor ltency (dys) s well s tumor size (mm 3 ) were recorded. The experiment ws terminted t 13 to 22 dys fter injection. Tumors were removed from the mice nd weighed. As shown in Fig. 6-d, lrge tumors developed in ll five mice injected with control cells, wheres only smll tumors were oserved in the five mice injected with R16 cells nd LM2 cells crrying wildtype. Tumors in the wildtype trnsfected group were significntly smller (.3 g nd.5 g) (P<.1) compred thn tumors in control mice ( 1.9 g nd.6 g; Fig. 6d). In conclusion, these results indicte tht wildtype cn inhiit the tumorigenic potentil of R16 nd LM2 cells. LOH of the distl chromosome 6 in mouse lung tumors Previous studies hve noted llelic loss of mrkers in the region of in B6C3F1 mouse lung neoplsms 11. In tht study, only 7 of 49 MeCl-induced nd 8 of 58 spontneous lung tumors hd muttions, nd only the 15 tumors with muttions exhiited loss of heterozygosity (LOH) t mrker D6MIT14 ner, indicting the loss of the wildtype llele. In this study, we nlyzed dditionl mouse lung tumor sets to further exmine the reltionship etween muttions nd LOH on distl chromosome 6. As summrized in Tle 1, 4 vndium pentoxide (V 2 PO 5 ) induced lung denocrcinoms were exmined for ctivtion, nd 29 (73%) hd muttions. These tumors were lso typed for LOH in the region of t mrker D6MIT14, nd 18 exhiited llelic loss (Tle 1). The muttions found most frequently in these V 2 PO 5 -induced tumors were either GA AT trnsition or GA TA trnsversion in the second se of codon 12 (dt not shown). D6MIT14 mps to within.5 cm of 2. Allelic losses LM2-4S LM2-4S (+ EGF) LM2-4B H LM2-4B L LM2-4B L LM2-4S-M1 uffer LM2-4B H (+ EGF) V12 N17 LM2-4B L LM2-4B H LM2-4S-3 LM2-4S-11 LM2-4S-M1 GST-RBD GSHeds GST-RBD ERK1 ERK2 t D6MIT14 correlted closely with muttions in the tumors, with 16 of 18 (89%) tumors with llelic loss lso hving muttion. muttion nlysis of chloroprene-induced mouse lung tumors hs een reported previously, with the most prevlent ltertion eing n AT TA trnsversion in the second se of codon Moreover, the wildtype llele ws lost in mny of these tumors 21. Using the codon 61 muttion (CAA CTA) nd D6MCO12, which is pproximtely 5 cm proximl to, we exmined the extent of LOH in these smples. As shown in Fig. 7 & c nd Tle 1, 16 of 19 (84%) tumors with llelic loss lso hve muttion, indicting close correltion etween llelic loss t these mrkers nd ctivtion. These results lso suggest tht the lower incidence nd smller size of lung tumors in the wildtype mice my e consequence of the mintennce of the wildtype llele. We crried out PCR-RFLP nlysis on 18 urethne-treted lung tumors from wildtype mice, 6 ech from (A/J 129/Sv- +/+ )F 1, (129/SvlmJ 129/Sv- +/+ )F 1 nd (C57BL/6J 129/Sv- +/+ )F 1 mice. None of these 18 lung tumors contined n llelic loss. Representtive results of these nlyses from (C57BL/6J 129/Sv- +/+ )F 1 mice re shown in Fig. 7. Discussion An ctivted rs gene is one of the most frequently detected oncogenes in humn nd rodent cncers. Muttions in the coding region of rs genes cn result in the constitutive ctivtion of p21 protein. These muttions, which occur predominntly in codons 12, 13 nd 61, convert the norml proto-oncogenes to oncogenes y continully upregulting the rs/erk signling pthwys in the sence of externl stimuli. Thus, signling pthwy tht medites cell prolifertion is constitutively ctivted 22,23. The ctivted rs genes hve often een regrded s dominnt oncogenes ecuse their trnsforming ility exists when norml lleles re lso expressed 2,3. However, studies from Finney et l. 1 showed tht single point muttion in Hrs1 is not sufficient for neoplstic trnsformtion of estlished cell lines nd tht t lest one dditionl event, either mplifiction of the mutnt llele or loss of the wildtype llele, is required. These oservtions hve led to the hypothesis tht the ctivted rs llele is not y itself dominnt over the norml llele, nd the norml rs llele my ct s suppressor of rs-induced cell trnsformtion or tumorigenesis. The present study hs systemticlly evluted the functionl role of the wildtype llele in mouse lung tumorigenesis. We hve demonstrted tht the presence of wildtype is ssocited with reduced mouse lung crcinogenesis nd tumorigenic phenotype of the cell lines. nture genetics volume 29 septemer 21 29

6 rticle Fig. 6. Nude mouse tumorigenicity ssys of wildtype trnsfected tumor cells.,, Inhiition of nude mouse tumor development (left side, control; right side, 4B trnsfected cells). c, Mesurement of the tumor size. d, Mesurement of the finl nude mouse tumor weight. Asterisks indicte P<.5 compred to trnsfected cells. There re t lest three lines of evidence to support the notion tht wildtype (p21 ) is tumor suppressor protein. First, mice with c heterozygous deficiency exhiit significntly incresed susceptiility to chemicl induction of lung tumors compred to wildtype mice. This suggests tht the remining wildtype llele in wildtype mice inhiits lung crcinogenesis. Using F 1 mouse hyrids from three genetic ckgrounds, nd two different chemicl crcinogens, we found tht heterozygous - deficient mice exhiit n impressive 4- to 6-fold increse in lung tumor multiplicity nd stggering 3- to 5-fold increse in tumor lod in mice with high susceptiility to tumors compred to wildtype mice (Fig. 1). Moreover, most of the lung tumors from heterozygous -deficient mice were denocrcinoms, in contrst to the denoms found in wildtype mice (Fig. 2). These results strongly suggest tht wildtype hs n importnt role in inhiiting tumor progression. The second line of evidence is the inhiitory effect of the wildtype llele on the growth nd tumorigenic potentil of the tumor cell lines. Introduction of wildtype gene into R16 or LM2 cells resulted in growth inhiition, reduced colony formtion nd mrked decrese in xenogrft tumor volume in nude mice. The recently descried rs effector protein, RAS2SF1A, suppressed the growth nd tumorigenicity of lung cncer cells in similr mnner suggesting tht RAS2SF1A my e n effector for wildtype rs signling 16. These results indicte tht wildtype cts s negtive regultor of cell growth in tumor cell lines. The third line of evidence is the consistent findings of LOH t the locus in B6C3F1 mouse lung tumors, especilly in lung denocrcinoms. We hve previously crried out whole-genome LOH nd deletion nlyses in B6C3F1 hyrid mouse lung denocrcinoms, nd mpped one of the most commonly deleted regions to chromosome 6 where the locus is locted 11. The d work presented here on two dditionl groups of B6C3F1 mouse lung tumors confirms our erlier oservtion 11,21. In most tumors, there ws cler correltion etween the presence of mutnt llele nd LOH of the region in these tumors. LOH of chromosome 12p, region syntenic to mouse distl chromosome 6 where is locted, hs een oserved in 3% to 5% of humn lung denocrcinoms nd lrge-cell crcinoms of the lung 24,25. The uthors of these studies suggested tht the smllest commonly deleted region on 12p12 13 ws flnked distlly y D12S269 nd proximlly y D12S38 (ref. 24). The locus is locted etween these two mrkers. These studies did not nlyze the correltion etween llelic loss on 12p12 13 nd the muttions. Given tht the percentge of lung denocrcinoms tht contin llelic loss on 12p12 13 is similr to the percentge of tumors tht exhiit muttions, it is possile tht llelic loss my occur with ech muttion in the llele. The mechnism y which wildtype cts to suppress mouse lung crcinogenesis is not cler. Morphologiclly, loss of wildtype resulted in highly undifferentited lung denocrcinoms in short period of time (out 4 months), suggesting tht wildtype my promote differentition of pulmonry cells. Previous studies hve shown tht rs genes re cple of inducing mitogenesis, cell trnsformtion nd differentition in certin cell types 2,26. For exmple, the rs genes were involved in nerve growth fctor (NGF) induced differentition of cultured neurons With rt Tle 1 LOH on distl chromosome 6 ssocited with ctivtion in mouse lung tumors Tumor Frequency of Frequency of LOH muttions in Strin Tretment type ctivtion on chromosome 6 tumors with llelic loss B6C3F1 none denom 2/14 (14%) 3/14 (21%) 2/3 (67%) B6C3F1 none denocrcinom 19/58 (33%) 8/58 (14%) 8/8 (1%) B6C3F1 MeCl denocrcinom 1/49 (2%) 7/49 (15%) 7/7 (1%) B6C3F1 V 2 PO 5 denocrcinom 29/4 (73%) 18/4 (45%) 16/18 (89%) B6C3F1 chloroprene denom 13/16 (81%) 13/16 (81%) 12/13 (92%) B6C3F1 chloroprene denocrcinom 6/9 (67%) 6/9 (67%) 4/6 (67%) LOH nd muttion dt re otined from Hegi et l. 11. muttion dt re from Sills et l nture genetics volume 29 septemer 21

7 rticle Fig. 7. LOH on chromosome 6 in mouse lung tumors., A representtive figure for PCR-RFLP nlysis of intron 2 polymorphic region for LOH sttus in lung tumors from (C57BL/6J 129/Sv-Krs +/+ )F 1 wildtype mice. Lne 1, A/J mouse control DNA which hs the sme genotype s tht of 129/sv mouse; lne 2, C57BL/6J mouse control DNA; lnes 3 7, lung tumors from (C57BL/6J 129/Sv- +/+ )F 1 wildtype denoms., A representtive figure for LOH nlysis of chloroprene-induced B6C3F1 mouse lung denocrcinoms using codon 61 muttion (CAA CTA) s mrker. Pnels 1,2,4 6, chloroprene-induced B6C3F1 mouse lung denocrcinoms with LOH; pnel 3, chloroprene-induced B6C3F1 mouse lung denocrcinom without LOH; pnel 7, B6C3F1 mouse control DNA. c, A representtive figure for the mrker D6MCO12. Lne 1, C3H/HeJ mouse control DNA; lne 2, C57BL/6J mouse control DNA; lne 3, B6C3F1 mouse control DNA; lnes 4 18, chloroprene-induced B6C3F1 mouse lung denocrcinoms. pheochromocytom cells (PC12), trnsfection of rs genes or microinjection of Rs proteins into the cell leds to the development of neurites Thus, rs genes function to promote cell differentition or prolifertion depending on cell type. It is conceivle tht wildtype Rs uses pthwy involving seprte, novel rs effector(s) to control differentiting ctivity in pulmonry cells. In fct, wildtype Rs is primrily GDP ound nd my e n ctive component in signl-trnsduction pthwys for promoting differentition. This is supported y experiments using the Rs2N17 mutnt, which is lso GDP ound. Rs2N17 is dominnt negtive muttion cple of locking endogenous Rs ctivtion. Cotrnsfection of Rs2N17 inhiited Rs2V12 (GTP-ound form) induced trnsformtion, indicting tht Rs2N17 is codominnt with Rs2V12 (ref. 34). We hve shown in the present study tht ERK ctivity cn e inhiited y overexpression of wildtype. ERK is the MAP kinse tht cn e directly regulted y phosphoryltion of the ctivtion loop. These results suggest tht possile moleculr mechnism for the inhiitory effect of wildtype on cellulr trnsformtion is through suppression of ERK ctivity. Severl groups hve demonstrted tht overexpression of wildtype rs induces trnsformtion of NIH/3T3 nd primry rt emryo firolst cells Although these dt contrst with ours, the context of the experimentl designs must e considered. A study of trnsformtion of rt-l cells showed drmticlly tht the tumorigenic selection pressure tended to mplify the oncogenic Hrs1 llele nd not the wildtype llele in cells tht contined single copy of ech llele 1. It is not cler t present why extremely high levels of wildtype rs expression in the sence of n oncogenic llele cn trnsform some cell types in vitro. However, our dt suggest tht expression of the wildtype rs llele could suppress tumorigenicity in the presence of mutnt llele. Amplifiction of wildtype rs hs lso een reported in some tumor types, ut is very infrequent. In mouse models of skin nd lung tumorigeneses nd of thymic lymphoms, oncogenic rs lleles re significntly overexpressed reltive to the wildtype llele 12,13,38,39. This imlnce of expression fvoring the mutnt rs lleles results from either loss of the norml llele nd/or mplifiction of the mutnt llele. In contrst, mplifiction of wildtype rs genes hs not een oserved in most in vivo rodent models of crcinogenesis, lthough n mplified wildtype c gene ws detected in mouse drenocorticl tumor cells 4. Amplifiction of rs genes in primry humn tumors hs een exmined in numerous studies. A totl of 243 lung tumors were exmined nd 1 (4%) exhiited mplifiction of one of the rs genes 36, Given tht 8 of these were oserved in lung denocrcinoms, it is possile tht some of the mplifiction occurred in n oncogenic rs llele. Humn colon, rest nd endometril tumors lso exhiit very low incidence of rs mplifiction (<3%) One study did demonstrte reltively high incidence (3%) of rs gene mplifiction in hed nd neck tumors t lte stges (III nd IV) of progression 47. In ll cses, the functionl role of mplified rs cnnot e estlished, ecuse mny other cncer-relted genes were complified s n mplicon in those tumors. In summry, we oserved tht wildtype inhiits mouse lung crcinogenesis nd tumorigenic properties of lung tumor cell lines. This oservtion rgues ginst the long-estlished dominnt role of n ctivted gene in cell trnsformtion nd crcinogenesis. We elieve tht we hve uncovered novel tumor-suppressor function of gene identified nd chrcterized s clssicl proto-oncogene. seems to hve dul function. On the one hnd, it promotes cncer development s ginof-function oncogene nd, on the other hnd, it inhiits cncer s loss-of-function tumor suppressor gene. Methods Regents. We purchsed urethne (ethyl crmte) (>99% pure) nd N- methylnitrosoure (MNU; 99% pure) from Sigm. We prepred chemicl crcinogens immeditely efore use in iossys. We dissolved oth urethne nd MNU in norml sline. Animls nd genertion of F1 heterozygotes. We otined six-week-old A/J, 129/SvlmJ nd C57BL/6J femle mice from Jckson Lortories (Br Hror, Mine). The 129/Sv- +/ mice were developed s reported previously 17. We housed the nimls in plstic cges with hrdwood edding nd dust covers, in HEPA-filtered, environmentlly controlled room (24 ± 1 C, 12 hr/12 hr light/drk cycle). Animls te Rodent L Chow (no. 51; Purin) nd drnk wter d liitum. Following 7-dy qurntine, we pired the nimls to develop reeding colonies for production of (A/J 129/Sv- +/ )F 1, (129/SvlmJ 129/Sv- +/ )F 1 nd (C57BL/6J 129/Sv- +/ )F 1 mice. We monitored ody weights of ll nimls monthly for the durtion of the studies. nture genetics volume 29 septemer 21 31

8 rticle genotype. We took til clippings from ech (A/J 129/Sv-)F 1 (129/SvlmJ 129/Sv-)F 1 nd (C57BL/6J 129/Sv-)F 1 mouse, homogenized them nd incuted them overnight t 37 C in lysis solution (.4 mg/ml pronse, 1% (w/v) sodium dodecyl sulfte, 1 mm Tris, 4 mm NCl, nd 2 mm EDTA), nd crried out phenol chloroform extrction nd precipittion with ice-cold lcohol. We then genotyped the DNA from ech mouse for the presence of the trgeted muttion using the polymerse chin rection (PCR). We used pir of PCR primers (oimr13: 5 CTTGGGTGGAGAGGCTATTC 3, oimr14: 5 AGGT GAGATGACAGGAGATC 3 ) to mplify 28-p product from the neo insert from the neo cssette used in constructing the trgeting. We used nother pir of PCR primers (oimr15: 5 CAAAT GTTGCTTGTCTGGTG 3 TCR Cd-1, oimr16: 5 GTCAGTCGAGTG CACAGTTT 3 ) to mplify 15-p product s n internl stndrd. DNA with oth wildtype lleles ( +/+ ) displyed only single 15-p frgment, wheres DNA with wildtype llele nd trgeted muttion ( +/ ) llele showed 15-p nd 28-p nds. We repeted this screening t lest once for confirmtion. We then mted the heterozygote mle 129/Sv- +/ mice with A/J 129/SvlmJ nd C57BL/6J femles. Fifty percent of the offspring hd trgeted muttion (tm1), nd the remining 5% hd only the wildtype llele. Lung tumorigenesis studies. The experimentl design for oth urethnend MNU-induced lung tumorigenesis studies is shown in Fig. 1. We rndomly divided six-week-old (A/J 129/Sv- +/ )F 1, (129/SvlmJ 129/Sv- +/ )F 1 nd (C57BL/6J 129/Sv- +/ )F 1 hyrid mice into 12 groups y genotype nd type of crcinogen tretment. For urethne tretment, we used 1 mle mice, including 17 (A/J 129/Sv- +/+ )F 1 mice, 12 (A/J 129/Sv- +/ )F 1 mice, 15 (129/SvlmJ 129/Sv- +/+ )F 1 mice, 19 (129/SvlmJ 129/Sv- +/ )F 1 mice, 19 (C57BL/6J 129/Sv- +/+ )F 1 mice nd 18 (C57BL/6J 129/Sv- +/ )F 1 mice. We gve ll nimls single i.p. injection of urethne (1 mg/g ody weight) in.2 ml phosphteuffered sline. For MNU tretment groups, we used 83 mle mice in the iossy, including 14 (A/J 129/Sv- +/+ )F 1 mice, 13 (A/J 129/Sv- +/ )F 1 mice, 14 (129/SvlmJ 129/Sv- +/+ )F 1 mice, 15 (129/SvlmJ 129/Sv- +/ )F 1 mice, 13 (C57BL/6J 129/Sv- +/+ )F 1 mice, nd 14 (C57BL/6J 129/Sv- +/ )F 1 mice. We gve ll nimls single i.p. injection of MNU (5 mg/kg ody weight) in.2 ml phosphteuffered sline. Becuse lung tumor development in mice is highly dependent upon genetic ckground, we used three different F 1 mice to void possile strin-specific effects. Eighteen weeks fter tretment with urethne nd fter tretment with MNU, we killed nimls from ll 12 groups y CO 2 sphyxition. We removed portion of lung tumors nd norml tissue nd flsh froze them in liquid nitrogen. We fixed representtive portion of ech tumor in Tellyesniczky s solution for histopthologicl exmintion. We exmined ech lung with dissecting microscope to otin the tumor count nd size. We determined tumor volumes y mesuring the three-dimensionl size of ech tumor nd y using the verge of the three mesurements s the dimeter. We determined the rdius (r; dimeter/2) nd clculted the totl tumor volume s volume=(4/3)πr 3. Sttisticl nlysis. We used one-wy ANOVA to determine the difference in the numer of pulmonry tumors per mouse etween control nd treted groups. We used two-wy ANOVA to determine the difference in oth the numer nd the size of lung tumors etween control nd treted groups. Anlysis of muttions y PCR-direct sequencing. We isolted DNA from lung tumors using the TRIzol regent (Gico-BRL). We descried the sequences of PCR primers for exons 1 nd 2 previously 5. We lso crried out the PCR rections nd direct sequencing of PCR products s descried previously 5. Plsmid construction. To construct n pproprite expression contining wildtype, we generted full-length mouse cdna for wildtype 4B y RT-PCR of totl mrna isolted from norml lungs of A/J mice using primers derived from the mouse cdna sequences 48. We mde the wildtype 4B expression construct y ligtion of cdnas into pcr3.1 mmmlin expression plsmid (Invitrogen, Crlsd, Cliforni). We then purified the expression construct using Mxi-tip 5 columns (Qigen) nd sequenced it for confirmtion prior to use in trnsfection experiments. Cell growth nd colony formtion ssys. We used R16 nd LM2 cells with mutnt llele 5,19. R16 is derived from NIH/3T3 cells trnsformed with mouse lung tumor DNA contining GC AT trnsition t the second position of codon 12 in (ref. 5). LM2 is metsttic tumor cell line estlished from urethne-induced lung tumors in the A/J strin 19. LM2 contins n AT GC trnsition t the second position of codon 61 in. We trnsfected R16 nd LM2 cells of the sme pssge under identicl conditions with µg of purified plsmid DNA of the following clones: pcr3.1 lone nd wildtype 4B using Lipofectmine (Life Technologies). We ssyed the G418-resistnt R16 cells directly nd sucloned G418-resistnt LM2 cells into stle clones. We used these cells for nlysis of growth rtes nd colony forming efficiencies nd determined the growth rtes using 12- well dishes with 2, cells seeded into ech well. We incuted R16 cells in duplicte wells in Dulecco s modified Egle s medium (DMEM) plus 1% FBS nd 5 µg/ml G418. We cultured LM2 cells in CMRL 166 plus 1% FBS nd 5 µg/ml G418 nd counted them on dys 1, 2, 4, 6 nd 8 fter plting (see Figs. 3 nd 4). For the colony-formtion ssy, we used four dishes, ech 1 cm in dimeter, for ech suclone of trnsfected cells. We seeded 1, cells into ech dish nd incuted them in DMEM plus 1% FBS nd 5 µg/ml G418 for 12 dys. We then fixed cells with 1% uffered formlin, stined them with crystl violet, nd counted visile colonies (>1.5 mm in dimeter). We monitored expression of the trnsfected wildtype 4B in these suclones, nd in selected colonies from the colony formtion ssy, y RT-PCR nd using unique sequences crried y the trnsfected clone. Specificlly, we generted cdna from RNA isolted from G418-resistnt cells tht hve een trnsfected with wildtype 4B. We then performed PCR on these cdnas using primer specific for sequence locted ehind trnscription strt position (5 TAAT ACGACTCACTATAGGG 3 ) nd 4B intrgenic coding sequence (5 CTCTATCGTAGGGTCGTAC 3 ). Athymic mouse tumorigenicity. We used the sme clones tht were used for the colony formtion ssys to nlyze tumor growth in nude mice. We otined thymic mice (4 6 weeks old) from the Jckson Lortory. We injected pproximtely 1 million cells in log phse growth sucutneously into ech flnk of nude mice; five nimls were used per suclone. We monitored the helth of the nimls nd the size of tumors dily nd recorded tumor ltency (time of ppernce) nd size (mm 3 ). We killed mice t two to four weeks fter cell injection, mesured tumor weights nd confirmed the expression of the wildtype clone in ll nude mouse tumors y RT-PCR. LOH nlysis. The Ntionl Toxicology Progrm (NTP) provided two sets of mouse lung tumors from the B6C3F1 mouse for muttion nd LOH nlyses. The first set ws from mice exposed to, 1, 2 or 4 mg/m 3 of V 2 PO 5 y inhltion for 2 y. The second set ws from mice treted with chloroprene. Lung tumor multiplicity dt nd muttion nlysis of chloroprene-induced tumors were reported 21,49. We performed llelotypic nlysis t mrker D6MIT14 with 42 mouse lung tumors in the V2PO5 study (2 from untreted mice nd 4 from V 2 PO 5 exposed mice). We purchsed D6MIT14 from Reserch Genetics, Inc., crried out stndrd PCR rections nd scored llelic losses when visile difference could e oserved. We fixed chloroprene-induced lung tumors in formlin nd prffin emedded; therefore, we were unle to otin stisfctory PCR results with the D6MIT14 mrker. In order to ssess LOH ner, we used mrker D6MCO12 (primer sequences: D6MCO12-1F, 5 GATGTC AAACGTGAGAGTGTC 3, nd D6MCO12-1R, 5 GCGCTGACTCGC TTCTTCCAT 3 ) tht is polymorphic etween the C57BL/6 nd C3H mice, nd single strnd conformtion polymorphism nlysis technique. We further confirmed results using codon 61 muttion (CAA CTA) s mrker. Immunoprecipittions nd immunolots. We lysed LM2 cells in mild lysis uffer (1 mm Tris-HCl ph-7.5, 1 mm NCl, 1% NP-4, 5 mm MgCl 2,.2 mm PMSF, 2 µg/ml leupeptin, 5 µg/ml protinin, 1 mm enzmidine) nd clered y centrifugtion. We determined protein concentrtions y Brdford ssy (BioRd) nd equlized them prior to incution with either 4 µg GST-RBD of Rf 5, pre-coupled to glutthione grose or glutthione grose lone. After 2 h of mixing, we wshed eds nd eluted ound proteins with SDS smple tretment uffer. We visulized ound protein y western lot with α-krs2 F234 ntiody (Snt Cruz Biotechnology). We lso trnsfected 293 cells with either pcdna3-krs2v12 or pcdna3-krs2n17 nd 32 nture genetics volume 29 septemer 21

9 rticle sujected them to the sme protocol s ove. To nlyze ERK ctivity, we cultured HEK293 nd LM2 cells in DMEM nd CMLR166 medi supplemented with 1% FBS, respectively. We used 5 ng/ml of EGF to stimulte ERK ctivity for 1 min. We lysed cells directly in SDS smple tretment uffer nd nlyzed them y Western lotting with nti-erk ntiody or nti-phospho- ERK ntiody (Sigm). Note: Supplementry informtion is ville on the Nture Genetics We site ( Acknowledgments We re grteful to A. de l Chpelle, G. Leone, G. Stoner nd H. Schut for their criticl reding of this mnuscript nd helpful discussions. We thnk A. Mlkinson for LM2 cells nd E. Wiley for secretril ssistnce. Some of the work ws performed t Medicl College of Ohio (Toledo, Ohio). This work ws supported y NIH grnts R1CA58554 (M.Y.), R1CA78797 (Y.W.) nd R1GM62694 (K.-L.-G.). Received 12 Mrch; ccepted 25 June Anderson, M., Reynolds, S., You, M. & Mronpot, R. Role of proto-oncogene ctivtion in crcinogenesis. Environ. Helth Perspect. 98, (1992). 2. Brcid, M. Rs genes. Annu. Rev. Biochem. 56, (1987). 3. Mrshll, C. How does p21rs trnsform cells? Trends Genet. 7, (1991). 4. Hu, V., Wng, W. & Dueserg, P. Dominnt trnsformtion y mutted humn rs genes in vitro requires more thn 1 times higher expression thn is oserved in cncers. Proc. Ntl Acd. Sci. USA 94, (1997). 5. You, M., Cndrin, U., Mronpot, R., Stoner, G. & Anderson, M. Activtion of the K-rs protooncogenes in spontneously occurring nd chemiclly induced lung tumors of the strin mouse. Proc. Ntl Acd. Sci. USA 86, (1989). 6. Guerrero, I., Clzd, P., Myer, A. & Pellicer, A. A moleculr pproch to leukemogenesis: mouse lymphoms contin n ctivted c-rs oncogene. Proc. Ntl. Acd. Sci. USA 81, (1984). 7. Spndidos, D. & Wilkie, N. Mlignnt trnsformtion of erly pssge rodent cells y single mutted humn oncogene. Nture 31, (1984). 8. Sorrentino, V., McKinney, M., Drozdoff, V., Hume, C. & Fleissner, E. Spontneous or crcinogen-medited mplifiction of mutted rs gene promotes neoplstic trnsformtion. Oncogene Res. 2, (1988). 9. Cohen, J. & Levinson, A. A point muttion in the lst intron responsile for incresed expression nd trnsforming ctivity of the c-h-rs oncogene. Nture 334, (1988). 1. Finney, R. & Bishop, M. Predisposition to neoplstic trnsformtion cused y gene replcement of H-rs1. Science 26, (1993). 11. Hegi, M.E. et l. Allelotype nlysis of mouse lung crcinoms revels frequent llelic losses on chromosome 4 nd n ssocition etween llelic imlnces on chromosome 6 nd K-rs ctivtion. Cncer Res. 54, (1994). 12. Bremner, R. & Blmin, A. Genetic chnges in skin tumor progression: correltion etween presence of mutnt rs gene nd loss of heterozygosity on mouse chromosome 7. Cell 61, (199). 13. Buchmnn, A., Ruggeri, B., Klein-Sznto, A.J. & Blmin, A. Progression of squmous crcinom cells to spindle crcinoms of mouse skin is ssocited with n imlnce of H-rs lleles on chromosome 7. Cncer Res. 51, (1991). 14. Stewrt, S. & Gun, K.L. The dominnt negtive Rs mutnt, N17Rs, cn inhiit signling independently of locking Rs ctivtion. J. Biol. Chem. 275, (2). 15. Shichinohe, T. et l. Suppression of pncretic cncer y the dominnt negtive rs mutnt, N116Y. J. Surg. Res. 66, (1996). 16. Dmmnn, R. et l. Epigenetic inctivtion of RAS ssocition domin fmily protein from the lung tumour suppressor locus 3p21.3. Nture Genet. 25, (2). 17. Johnson, L. et l. K-rs is n essentil gene in the mouse with prtil functionl overlp with N-rs. Genes Dev. 11, (1997). 18. Shimkin, M.B. & Stoner, G.D. Lung tumors in mice: ppliction to crcinogenesis iossy. Adv. Cncer Res. 21, 1 58 (1975). 19. McDoniels-Silvers, A.L., Herzog, C.R., Tyson, F.L., Mlkinson, A.M. & You, M. Inctivtion of oth R nd p53 pthwys in mouse lung epithelil cell lines. Exp. Lung Res. 27, (21). 2. Mnenti, G. et l. Linkge disequilirium nd physicl mpping of Ps1 in mice. Genome Res. 9, (1999). 21. Sills, R.C., Hong, H.L., Melnick, R.L., Boormn, G.A. & Devereux, T.R. High frequency of codon 61 K-rs A T trnsversions in lung nd Hrderin glnd neoplsms of B6C3F1 mice exposed to chloroprene (2-chloro-1,3-utdiene) for 2 yers, nd comprisons with the structurlly relted chemicls isoprene nd 1,3- utdiene. Crcinogenesis 2, (1999). 22. Lowry, D. & Willumsen, B. Function nd regultion of Rs. Ann. Rev. Biochem. 62, (1993). 23. McCormick, F. Activtors nd effectors of Rs p21 proteins. Curr. Opin. Genet. Dev. 4, (1994). 24. Tkeuchi, S. et l. Frequent loss of heterozygosity in region of the k1p1 locus in non smll cell lung cncer: evidence for new tumor suppressor gene on the short rm of chromosome 12. Cncer Res. 56, (1996). 25. De Gregorio, L. et l. Prognostic vlue of loss of heterozygosity nd K-Rs muttions in lung denocrcinom. Int. J. Cncer 79, (1998). 26. Cowley, S., Pterson, H., Kemp, P. & Mrshll, C. J. Activtion of MAP kinse is necessry nd sufficient for PC12 differentition nd for trnsformtion of NIH 3T3 cells. Cell 77, (1994). 27. Borsio, G.D. et l. rs p21 protein promotes survivl nd fier outgrowth of cultured emryonic neurons. Neuron 2, (1989). 28. Borsio, G.D., Mrkus, A., Wittinghofer, A., Brde, Y.A. & Heumnn, R. Involvement of rs p21 in neurotrophin-induced response of sensory, ut not sympthetic neurons. J. Cell Biol. 121, (1993). 29. Heumnn, R. Neurotrophin signlling. Curr. Opin. Neuroiol. 4, (1994). 3. Greene, L.A. & Tischler, A.S. Estlishment of nordrenergic clonl line of rt drenl pheochromocytom cells which respond to nerve growth fctor. Proc. Ntl Acd. Sci. USA 73, (1976). 31. Nod, M. et l. Srcom viruses crrying rs oncogenes induce differentitionssocited properties in neuronl cell line. Nture 318, (1985). 32. Br-Sgi, D. & Fermisco, J.R. Microinjection of the rs oncogene protein into PC12 cells induces morphologicl differentition. Cell 42, (1985). 33. Guerrero, I., Wong, H., Pellicer, A. & Burstein, D. E. Activted N-rs gene induces neuronl differentition of PC12 rt pheochromocytom cells. J. Cell Physiol. 129, (1986). 34. Feig, L.A. & Cooper, G.M. Inhiition of NIH 3T3 cell prolifertion y mutnt rs protein with preferentil ffinity for GDP. Mol. Cell Biol. 8, (1988). 35. Chng, E.H., Furth, M.E., Scolnick, E.M., & Lowy, D.R. Tumorigenic trnsformtion of mmmlin cells induced y norml humn gene homologous to the oncogene of Hrvey murine srcom virus. Nture 1, (1982). 36. Pulcini, S., Sntos, E., Long, L.K., Sorrention, V., & Brcid, M. rs gene mplifiction nd mlignnt trnsformtion. Mol. Cell. Biol. 5, (1985). 37. Cichutek, K. & Dueserg, P. H. Recominnt BALB nd Hrvey srcom viruses with norml proto-rs-coding regions trnsform emryo cells in culture nd cuse tumors in mice. J. Virol. 63, (1989). 38. Coromins, M., Perucho, M., Newcom, E. W. & Pellicer, A. Differentil expression of the norml nd mutted Krs lleles in chemiclly induced thymic lymphoms. Cncer Res. 51, (1991). 39. Chen, B., Johnson, L., Wiest, J.S., Anderson, M.W. & You, M. The second intron of the K-rs gene contins regultory elements ssocited with mouse lung tumor susceptiility. Proc. Ntl Acd. Sci. USA 91, (1994). 4. Schw, M., Alitlo, K., Vrmus, H.E., Bishop, J.M., & George, D.A cellulr oncogene (c-ki-rs) is mplified, overexpressed, nd locted within kryotypic normlities in mouse drenocorticl tumour cells. Nture 33, (1983). 41. Heighwy, J. & Hsleton, P. S. c-ki-rs mplifiction in humn lung cncer. Br. J. Cncer 53, (1986). 42. Shirishi, M., Noguchi, M., Shimosto, Y., & Sekiy, T. Amplifiction of protooncogenes in surgicl specimens of humn lung crcinoms. Cncer Res. 49, (1989). 43. Sleos, R.J.C., Eyers, S.G., Wgenr, S.S., & Rodenhuis, S. Cellulr protoonocogenes re infrequently mplified in untreted non smll cell lung cncer. Br. J. Cncer 59, 76 8 (1989). 44. Field, J.K. & Spndidos, D.A. The role of rs nd myc oncogenes in humn solid tumours nd their relevnce in dignosis nd prognosis (review). Anticncer Res. 1, 1 22 (199). 45. Brison, O. Gene mplifiction nd tumor progression. Biochim. Biophys. Act 1155, (1993). 46. Esteller, M., Grci, A., Mrtinez-Plones, J. M., Xercvins, J. & Reventos, J. The clinicopthologicl significnce of K-rs point muttion nd gene mplifiction in endometril cncer. Eur. J. Cncer 33, (1997). 47. Srnth, D. et l. Oncogene mplifiction in squmous cell crcinom of the orl cvity. Jpn. J. Cncer Res. 8, (1989). 48. George, D. L. et l. Structure nd expression of mplified cki-rs gene sequences in Y1 mouse drenl tumor cells. EMBO J. 4, (1985). 49. Ntionl Toxicology Progrm Toxicology nd crcinogenesis studies of chloroprene (CAS no ) in F344/N rts nd B6C3F1 mice (inhltion studies). NTP Technicl Report 467, NIH Puliction no , NIEHS, NIH, Reserch Tringle Prk, North Crolin (1996). 5. Herrmnn C., Mrtin, G.A. & Wittinghofer, A. Quntittive nlysis of the complex etween p21rs nd the Rs-inding domin of the humn Rf-1 protein kinse. J Biol. Chem. 27, (1995). nture genetics volume 29 septemer 21 33