Table 1. Clinicopathological features of melanoma samples (shown in Fig. 2) exhibiting higher XYZ mrna levels.
|
|
|
- Donna Reed
- 5 years ago
- Views:
Transcription
1 Sheikh MS et al., Privileged communication. Probe: N T N T N T N T N T N T Table 1. Clinicopathological features of melanoma samples (shown in Fig. 2) exhibiting higher mrna levels. Patient No. Age (yrs) Sex Tumor Type Tumor Stage P12549/00 49 Female Malignant melanoma I; T2N0M0 P7619/00 45 Female Malignant melanoma III; T4N0M0 Probe: control P7683/00 73 Male Malignant melanoma III; T4N0M0 C Male Malignant melanoma IV; N/A Fig. 2 mrna expression is increased in melanoma samples when compared to normal skin. Cancer profiling array blot was probed with cdna. Same blot was also probed with a human control cdna probe which shows different expression pattern. N: normal; T: tumor C Female Malignant melanoma III; T4N0M0 C620T 40 Female Malignant melanoma III; T4N0M0 C791T 43 Female Malignant melanoma I; T2N0M0
2 Sheikh MS et al., Privileged communication. β-actin Lanes: Fig. 3 Western blot analysis showing expression in normal melanocytes and in melanoma cell lines. Lane 1: normal melanocytes. Lanes 2-12 melanoma cells. Lanes 2-4 show derivatives of same A2058 cell line. Same blot was probed with beta-actin antibody
3 Melanoma Intensity: 4+ Melanoma Intensity: 3+ Sheikh MS et al., Privileged communication. Melanoma Intensity: 2+ Melanoma Intensity: 1+ Melanoma Intensity: 0 Normal Skin Intensity Melanocytes: 0 Fig. 4 Representative immunohistochemical staining showing expression of in melanoma and normal skin sections. Varying -specific staining is shown in red to pink. In the case of normal skin, most of the superficial cells in the epidermal layer are weakly positive. The basal layer shows weak staining with melanocytes (arrows) mostly negative for staining.
4 Sheikh MS et al., Privileged communication. C μg/ml C μg/ml β-actin β-actin Fig. 5 DTIC, an anticancer drug, down-regulates in A375 melanoma cells. Cells were treated with indicated concentration of DTIC for 96 hrs and Western blot analyses were performed with indicated antibodies. Fig. 6 Cisplatin, an anticancer drug, downregulates in UACC-62 melanoma cells. Cells were treated with indicated concentration of cisplatin for 24 hrs and Western blot analyses were performed with indicated antibodies. MCF7 MDA231 MDA468 BT549 C E C E A C E A C E A β-actin Fig.7 Etoposide (E) and adriamycin (A), anticancer drugs, down-regulate in various human breast cancer cell lines.
5 Cell Growth Cell Growth Scramble A375 Sheikh MS et al., Privileged communication G4-RNAi G8-RNAi Days Scramble G4-RNAi SK-Mel G8-RNAi Days Fig. 8 knockdown leads to growth inhibition in melanoma cells. MTT assays showing cell growth in scramble or knockdown cells. G4 and G8 are two different shrna constructs
6 Table 2. staining intensity in melanoma and normal skin specimens. keratinocytes (kera) and melanocytes (melano). staining Patient No. Sex Age Organ Pathology diagnosis Stage TNM Type 2+ T382-A1/A5 F 65 Left nasal cavity Epithelioid malignant melanoma Malignant 4+ T382-A2/A6 F 77 Skin Epithelioid malignant melanoma of left sole II T4N0M0 Malignant 1+ T382-A3/A7 M 75 Rectum Plasmacytoid malignant melanoma (fibrofatty tissue, blood vessel and peripheral nerve) Malignant 2+ T382-A4/A8 F 79 Vulva Plasmacytoid malignant melanoma III T4N1M0 Malignant 1+ T382-B1/B5 M 36 Skin Balloon cell malignant melanoma of left chest wall II T4N0M0 Malignant 3+ T382-B2/B6 F 42 Skin Balloon cell malignant melanoma of right thigh II T4N0M0 Malignant 3+ T382-B3/B7 F 52 Rectum Rhabdoid malignant melanoma Malignant +/- T382-B4/B8 M 63 Nose Perivascular cell malignant melanoma Malignant 3+ T382-C1/C5 M 60 Skin Sarcomatoid malignant melanoma of left buttocks III T4N1M0 Malignant 2+ T382-C2/C6 M 55 Skin Sarcomatoid malignant melanoma of left buttocks II T4N0M0 Malignant 3+ T386-A1/A2/A5/A6 F 75 Skin Malignant melanoma of left arm II T2N0M0 Malignant 3+ T386-A3/A4/A7/A8 M 74 Skin Malignant melanoma of left foot II T4N0M0 Malignant
7 0 T386-B1/B2/B5/B6 M 51 Skin Malignant melanoma of chest wall II T4N0M0 Malignant 2+ T386-B3/B4/B7/B8 M 51 Skin Malignant melanoma of left arm III T4N1M0 Malignant 4+ ME242-A1 F 40 Skin Malignant melanoma of lower jaw bone II T4N0M0 Malignant 3+ ME242-A2 F 75 Skin Malignant melanoma of left buttock I T2N0M0 Malignant 4+ ME242-A5 F 60 Skin Malignant melanoma of jaw bones II T4N0M0 Malignant 1+ ME242-A6 M 40 Skin Malignant melanoma of right chest wall II T4N0M0 Malignant 3+ ME242-B1 M 70 Oral cavity Malignant melanoma of right parotid gland and cervical part Malignant 2+ ME242-B2 M 71 Small intestine Malignant melanoma of small intestine Malignant 3+ ME242-B5 M 64 Esophagus Malignant melanoma of esophagus Malignant 2+ ME242-B6 F 55 Oral cavity Malignant melanoma of right gum Malignant 2+ ME242-C1 F 40 Oral cavity Malignant melanoma of gum of law right jaw bones (tumoral necrosis) Malignant 2+ ME242-C2 M 52 Oral cavity Malignant melanoma of pars palatalis Malignant 2+ ME242-C5 F 36 Oral cavity Malignant melanoma of oral cavity Malignant 3+ ME242-C6 M 79 Oral cavity Malignant melanoma of right maxillary sinus Malignant Patient No. Sex Age Organ Pathology diagnosis Stage TNM Type
8 staining T382-C3/C7 M 25 Skin Normal skin tissue Normal Melano: +/- T382-C4/C8 M 35 Skin Normal skin tissue Normal T386-C1/C2/C5/C6 F 50 Skin Normal skin tissue Normal T386-C3/C4/C7/C8 F 16 Skin Normal skin tissue Normal Kera: + ME242-A3 M 35 Skin Adjacent normal skin tissue NAT Melano: +/- Kera: + ME242-A4 F 40 Skin Normal skin tissue of scalp Normal ME242-A7 F 40 Skin Adjacent normal skin tissue of abdominal part Normal ME242-A8 F 62 Skin Normal skin tissue (sparse) NAT
9 Melano: +/- ME242-B3 M 45 Skin Adjacent normal skin tissue of scalp (hair follicle and sebaceous glands tissue) NAT ME242-B4 F 57 Skin Adjacent normal skin tissue of scalp NAT ME242-B7 M 19 Skin Normal skin tissue of abdominal part Normal ME242-B8 F 51 Skin Adjacent normal skin tissue of left upper quadrant of the abdomen (sparse) NAT ME242-C3 F 49 Skin Adjacent normal skin tissue NAT ME242-C4 M 31 Skin Ajacent normal skin tissue of femoribus internus NAT ME242-C7 F 42 Skin Adjacent normal skin tissue of left breast NAT Kera: + ME242-C8 F 45 Skin Adjacent normal skin tissue of scalp (sparse) NAT
10 Melano: +/-
11 Table 3. staining intensity in melanoma compared to melanocytes in normal skin. Tissue type Number of samples Staining intensity Negative (0) Weak (+/-) Weak (1+) Moderate (2+) Strong (3+) Very strong (4+) Melanoma % (1/26) 3.85% (1/26) 11.54% (3/26) 34.62% (9/26) 34.62% (9/26) 11.54% (3/26) Normal 16 75% (12/16) 25% (4/16)
Knockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling
SUPPLEMENTARY INFORMATION Knockdown of Malic Enzyme 2 Suppresses Lung Tumor Growth, Induces Differentiation and Impacts PI3K/AKT Signaling Jian-Guo Ren 1, Pankaj Seth 1, Clary B. Clish 2, Pawel K. Lorkiewicz
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
THE INTEGUMENTARY SYSTEM. Body Membranes & Skin
THE INTEGUMENTARY SYSTEM Body Membranes & Skin TYPES OF MEMBRANES Epithelial Membranes includes layer of epithelial cells and connective tissue Serous Cutaneous Mucous Connective Tissue Membranes solely
ENCR RECOMMENDATIONS
E N C R EUROPEAN NETWORK OF CANCER REGISTRIES (ENCR) ENCR RECOMMENDATIONS Non-Melanoma Skin Cancers Members of the Working Group: Dr T. Davies, East Anglian Cancer Registry, Cambridge, UK Mrs M. Page,
Integumentary System
Integumentary System The integumentary system is commonly known as the Skin Largest organ of human body 10% total body weight and would cover over 20 square feet Functions of Skin 1. Protection Barrier
4 Skin and Body Membranes Study Guide
Name: SKIN AND BODY MEMBRANES: 4 Skin and Body Membranes Study Guide Period: Body membranes, which cover body surfaces, line its cavities, and form protective sheets around organs, fall into two major
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Skin is a multilayered organ that covers and protects the body.
Section 1: Skin is a multilayered organ that covers and protects the body. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the four tissue types that are found in
CHAPTER 5 INTEGUMENTARY
CHAPTER 5 INTEGUMENTARY skin under the skin other stuff cutaneous layer hypodermis (subcutaneous) accessory structures Cutaneous layer = skin epithelial layers = connective tissue layer = dermis Subcutaneous
Malignant tumors of melanocytes: Part 1. Deba P Sarma, MD., Omaha
Malignant tumors of melanocytes: Part 1 Deba P Sarma, MD., Omaha The melanocytic tumor is one of the most difficult and confusing areas in Dematopathology. It is true that most (95%) of such lesions are
SKIN. 3. How is the skin structured around the finger joints to allow for flexible movement of the fingers?
SKIN Objectives for Exam #1: 1. List various skin structures and describe their functions. 2. Describe skin responses to increases and decreases in body temperature. 3. Provide examples of various skin
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
Human Anatomy Key Points Unit 1/ Study Guide
Human Anatomy Key Points Unit 1/ Study Guide I. Anatomy and Physiology a. Anatomy 1. Means cutting apart (dissection) 2. Study of the body and the relationships of its parts to each other. 3. Dissection
B. Incorrect! The ectoderm does not produce the dermis. C. Incorrect! The dermis is derived from the mesoderm.
Human Anatomy - Problem Drill 04: The Integumentary System Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. From the inner cell
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Objectives. 1. Recognizing benign skin lesions. 2.Know which patients will likely need surgical intervention.
The Joy of Pediatric Skin Dr. Claire Sanger University of Kentucky Plastic & Reconstructive Surgery Objectives 1. Recognizing benign skin lesions 2.Know which patients will likely need surgical intervention.
CH 05 THE INTEGUMENTARY SYSTEM
CH 05 THE INTEGUMENTARY SYSTEM This system consists of skin and its derivatives. The skin is one of the largest organs of the body in terms of surface area. The functions of the integumentary system include:
Unit 4 The Integumentary System
Unit 4 The Integumentary System I. Classification of Body Membranes A. Epithelial Membranes (3) 1. Cutaneous Membrane > Stratified Squamous > Sits on Dense Connective Tissue > Skin: Epidermis & Dermis
Carcinoma of Unknown Primary site (CUP) in HEAD & NECK SURGERY
Carcinoma of Unknown Primary site (CUP) in HEAD & NECK SURGERY SEARCHING FOR THE PRIMARY? P r o f J P P r e t o r i u s H e a d : C l i n i c a l U n i t C r i t i c a l C a r e U n i v e r s i t y O f
Dr Narmeen S. Ahmad. Lab 1
Dr Narmeen S. Ahmad Lab 1 1 Tissues are groups of cells with a common structure (form) and function (job). There are (4) types of tissue: 1. Epithelial 2. Connective 3. Muscle 4. Nervous 2 Epithelial cells
Date Lab Pd. Lecture Notes (57)
Name SECTION OBJECTIVES Describe the locations of the major body cavities List the organs located in each major body cavity Name the membranes associated with the thoracic and abdominopelvic cavities Name
Skin and Body Membranes Body Membranes Function of body membranes Cover body surfaces Line body cavities Form protective sheets around organs
Skin and Body Membranes Body Membranes Function of body membranes Cover body surfaces Line body cavities Form protective sheets around organs Classification of Body Membranes Epithelial membranes Cutaneous
Skin (Integumentary System) Wheater, Chap. 9
Skin (Integumentary System) Wheater, Chap. 9 Skin (Integument) Consists of skin and associated derivatives Largest organ of body (21 ft 2 ; 9 lbs.; has 11 miles of blood vessels) Functions: Protection
Ch 5: Integumentary System
Ch 5: Integumentary System You gotta have skin; All you really need is skin. Skin's the thing, that if you've got it outside, It helps keep your insides in. Alan Sherman (1924-1973) Developed by John Gallagher,
Skin and Body Membranes
4 Skin and Body Membranes PowerPoint Lecture Slide Presentation by Jerry L. Cook, Sam Houston University ESSENTIALS OF HUMAN ANATOMY & PHYSIOLOGY EIGHTH EDITION ELAINE N. MARIEB Skin and Body Membranes
NEO 111 Melanie Jorgenson, RN, BSN
NEO 111 Melanie Jorgenson, RN, BSN Inspection: performing deliberate, purposeful observations in a systematic manner Palpation: using the sense of touch Percussion: striking one object against another
7/10/18. Introduction. Integumentary System. Physiology. Anatomy. Structure of the Skin. Epidermis
Introduction Integumentary System Chapter 22 Skin is largest and heaviest organ of body (7% of body weight) Houses receptors for touch, heat, cold, movement, and vibration No other body system is more
Principles of Anatomy and Physiology
Principles of Anatomy and Physiology 14 th Edition CHAPTER 5 The Integumentary System Introduction The organs of the integumentary system include the skin and its accessory structures including hair, nails,
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Anatomy Fall Semester Set 1: Organization and Tissues
. 1. Which of the following describes anatomy? a. using devices to investigate parameters such as heart rate and blood pressure b. investigating human structure via dissections and other methods c. studying
Prelab #4 BLOOD; BONE MARROW; RESPIRATORY; INTEGUEMENT Page 1
Prelab #4 BLOOD; BONE MARROW; RESPIRATORY; INTEGUEMENT Page 1 Blood Slide 101 This a classic slide of blood cells using a Wright stain. Inspect red blood cells and their appearance. Note the approximate
Figure 4.1. Using Figure 4.1, identify the following: 1) The region that contains adipose tissue is indicated by letter. Diff: 2 Page Ref: 115
Essentials of Anatomy and Physiology, 9e (Marieb) Chapter 4 Skin and Body Membranes Short Answer Figure 4.1 Using Figure 4.1, identify the following: 1) The region that contains adipose tissue is indicated
The Human Body. Lesson Goal. Lesson Objectives 9/10/2012. Provide a brief overview of body systems, anatomy, physiology, and topographic anatomy
The Human Body Lesson Goal Provide a brief overview of body systems, anatomy, physiology, and topographic anatomy Medial Lateral Proximal Distal Superior Inferior Anterior Lesson Objectives Explain the
Anatomy Fall Semester Set 1: Organization and Tissues
. 1. Which of the following describes anatomy? a. using devices to investigate parameters such as heart rate and blood pressure b. investigating human structure via dissections and other methods c. studying
LESSON ASSIGNMENT. The Human Integumentary and Fascial Systems. After completing this lesson, you should be able to:
LESSON ASSIGNMENT LESSON 3 The Human Integumentary and Fascial Systems. TEXT ASSIGNMENT Paragraphs 3-1 through 3-14. LESSON OBJECTIVES After completing this lesson, you should be able to: 3-1. Define integumentary
1.45_Internet Assignment #1: The Human Body: An Orientation
1.45_Internet Assignment #1: The Human Body: An Orientation Go to the following website to complete the following Activities, Quizzes, and Reading: http://wps.aw.com/bc_marieb_hap_9_oa/218/55856/14299219.cw/index.html
Anatomy Ch 6: Integumentary System
Anatomy Ch 6: Integumentary System Introduction: A. Organs are body structures composed of two or more different tissues. B. The skin and its accessory organs make up the integumentary system. Types of
Introduction to The Human Body
1 Introduction to The Human Body FOCUS: The human organism is often examined at seven structural levels: chemical, organelle, cell, tissue, organ, organ system, and the organism. Anatomy examines the structure
Skin Basics. About skin. Reviewed By: Kimberly Bazar, M.D., AAD Mary Ellen Luchetti, M.D., AAD
Page 1 of 5 Skin Basics Reviewed By: Kimberly Bazar, M.D., AAD Mary Ellen Luchetti, M.D., AAD Summary The skin is the largest organ in the body. It consists of three layers the epidermis, the dermis and
What is Anatomy & Physiology?
What is Anatomy & Physiology? Big Ideas: 1. How does the body maintain homeostasis? 2. How are structure and function interdependent? anatomy - structure of body parts and how they are organized anatomy
Introduction. Results. Discussion. Histopathologic and immunohistochemical findings. Results. conclusions,
1/5 2/5 Carcinoma distinctive carcinoma. form erysipeloides (CE), metastasis. which clinically Itfrom has resembles been termed erysipelas, is an uncommon, but may extend It164 toclassically back, presents
Inpatient ICD-9-CM Mapping to ICD-10 PCS Procedures Involving the Application of Integra Bilayer Wound Matrix
Inpatient ICD-9-CM Mapping to ICD-10 PCS Procedures Involving the Application of Integra Bilayer Wound Matrix Effective October 1, 2015, the Centers for & Medicaid Services (CMS) is implementing International
The Integumentary System
The Integumentary System The Integumentary System Integument is skin Skin and its appendages make up the integumentary system (See if you can name some appendages) A fatty layer (hypodermis) lies deep
59 yo male with past medical history of prostate carcinoma, presented with upper abdominal pain
December 2016 59 yo male with past medical history of prostate carcinoma, presented with upper abdominal pain Contributed by: Divya Sharma, MD. Fellow, Gastrointestinal Pathology, Department of Pathology
Dissection: The Fetal Pig
Lab Exercise Dissection: The Fetal Pig Objectives - To learn some of anatomical structures of the fetal pig. - To be able to make contrasts and comparisons of structures between different animal phyla
Describe the functions of the vertebrate integumentary system. Discuss the structure of the skin and how it relates to function.
Chapter 5 Describe the functions of the vertebrate integumentary system. Discuss the structure of the skin and how it relates to function. Explain the basis for different skin colors. Describe the structure
Unit 4 - The Skin and Body Membranes 1
Unit 4 - The Skin and Body Membranes 1 I. Unit 4: Skin and Body Membranes A. Body Membranes 1. Function of body membranes a) Cover body surfaces b) Line body cavities c) Form protective sheets around organs
Inpatient ICD-9-CM Mapping to ICD-10 PCS Procedures Involving the Application of PriMatrix AG Antimicrobial Dermal Repair Scaffold
Inpatient ICD-9-CM Mapping to ICD-10 PCS Procedures Involving the Application of PriMatrix AG Antimicrobial Dermal Repair Scaffold Effective October 1, 2015, the Centers for & Medicaid Services (CMS) is
Clinical Anatomy, Embryology and Imaging BMS 6115C. Summer Semester 2009 Lynn J. Romrell, Ph.D. Course Director. Course Schedule
Anatomy, Embryology and Imaging BMS 6115C Summer Semester 2009 Lynn J. Romrell, Ph.D. Course Director Course Schedule Color codes for course activities: Anatomy Sessions Anatomic Radiology Sessions Embryology
Cancer in Estonia 2014
Cancer in Estonia 2014 Estonian Cancer Registry (ECR) is a population-based registry that collects data on all cancer cases in Estonia. More information about ECR is available at the webpage of National
Hippocratus Ayurvedic Acupressure Part II Index
Hippocratus Ayurvedic Acupressure Part II Index Treatment of Hyperacidity & Gastritis / Ulcers Prevention of Loss of Energy Part I 1. Acute Gastritis 1 2. Heart and throat burning 2 3. Abdomen distention
FINALIZED SEER SINQ QUESTIONS
0076 Source 1: WHO Class CNS Tumors pgs: 33 MP/H Rules/Histology--Brain and CNS: What is the histology code for a tumor originating in the cerebellum and extending into the fourth ventricle described as
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Ch. 4: Skin and Body Membranes
Ch. 4: Skin and Body Membranes I. Body Membranes A. Function of body membranes 1. Cover body surfaces 2. Line body cavities 3. Form protective sheets around organs II. Classification of Body Membranes
Effect of Propecia on the Hair Follicle in Male Androgenetic Alopecia: A Confocal Laser Scanning Microscopy and Video Imaging Study
Effect of Propecia on the Hair Follicle in Male Androgenetic Alopecia: A Confocal Laser Scanning Microscopy and Video Imaging Study Investigators: Department of Dermatology, University of Minnesota, Minneapolis,
Skin and Body Membranes
Essentials of Human Anatomy & Physiology Elaine N. Marieb Seventh Edition Chapter 4 Skin and Body Membranes Slides 4.1 4.32 Lecture Slides in PowerPoint by Jerry L. Cook Skin and Body Membranes Function
Histopathology: skin pathology
Histopathology: skin pathology These presentations are to help you identify, and to test yourself on identifying, basic histopathological features. They do not contain the additional factual information
SIRT6 histone deacetylase functions as a potential oncogene in human melanoma -
SIRT6 histone deacetylase functions as a potential oncogene in human melanoma - Garcia-Peterson et al Supplementary Figure S:Tissue microarray (TMA) staining and organization. A) Diagram of the TMA indicating
Introduction. Skin and Body Membranes. Cutaneous Membranes Skin 9/14/2017. Classification of Body Membranes. Classification of Body Membranes
Introduction Skin and Body Membranes Body membranes Cover surfaces Line body cavities Form protective and lubricating sheets around organs Classified in 5 categories Epithelial membranes 3 types- cutaneous,
Lesson 3: The Human Integumentary and Fascial Systems
Basic Human Anatomy Lesson 3: The Human Integumentary and Fascial Systems Welcome to Lesson 3 of the Basic Human Anatomy Course. Today, we ll be studying the Human Integumentary and Fascial Systems. I
Chapter 6 Skin and the Integumentary System. Skin Cells. Layers of Skin. Epidermis Dermis Subcutaneous layer beneath dermis not part of skin
Chapter 6 Skin and the Integumentary System Composed of several tissues Maintains homeostasis Protective covering Retards water loss Regulates body temperature Houses sensory receptors Contains immune
Due next week in lab - Scientific America Article Select one article to read and complete article summary
Due in Lab 1. Skeletal System 33-34 2. Skeletal System 26 3. PreLab 6 Due next week in lab - Scientific America Article Select one article to read and complete article summary Cell Defenses and the Sunshine
Acknowledgments Figure Credits List of Clinical Blue Boxes Introduction to Clinically Oriented Anatomy Approaches to Studying Anatomy p.
Preface p. ix Acknowledgments p. xi Figure Credits p. xv List of Clinical Blue Boxes p. xix Introduction to Clinically Oriented Anatomy Approaches to Studying Anatomy p. 2 Regional Anatomy p. 2 Systemic
Department of Science Second Term: Revision Worksheet - 1 L-1.6, 1.7 & 1.8 Muscles and bones
Department of Science 2018-2019 Second Term: Revision Worksheet - 1 L-1.6, 1.7 & 1.8 Muscles and bones Grade 4... Name:... Date:.../.../2019 Q.1 Label each muscle group. neck muscles shoulder muscles thigh
Merkel Cell Carcinoma Case # 2
DISCHARGE SUMMARY Admitted: 10/11/2010 Discharged: 10/13/2010 Merkel Cell Carcinoma Case # 2 Chief Compliant: A 79 year old lady status post tumor on the scalp excision and left neck likely dissection
ab Skin tumor tissue array, 75 cases, 150 samples (1.1mm)
ab178285 Skin tumor tissue array, 75 cases, 150 samples (1.1mm) nstructions for Use Designed for HC or SH based protein or RNA tissue profiling in various skin tumors. This product is for research use
Mitosis Models 3-5. Chromosome. #1 Prophase. #2 Prophase. 2n = 4 4 Chromosomes 8 Chromatids. 2n = 4
MITOSIS Mitosis Models 3-5 Chromosome #1 Prophase 2n = 4 4 Chromosomes 8 Chromatids #2 Prophase 2n = 4 4 Chromosomes 8 Chromatids Mitosis Models 3-5 Astral Rays Chromosomes Chromosome Chromosome Spindle
21 Skin and it s Accessories
21 Skin and it s Accessories 21-001 Skin 1 2 Sweat glands Adipose tissue 3 Retinaculum cutis 21-01. Skin of the palm 1. General view. Human, H-E stain, x 3.3. Opening of sweat gland duct Stratum corneum
Title: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis
Author's response to reviews Title: MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis Authors: Kensuke Akaogi (kensuke.akaogi@gmail.com) Wakana Ono (wakana315@gmail.com)
Diploma Examination. Dermatopathology: First paper. Tuesday 20 March Candidates must answer FOUR questions. Time allowed: 3 hours
Dermatopathology: First paper Tuesday 20 March 2018 Candidates must answer FOUR questions Time allowed: 3 hours 1. Give an account of the genetic aberrations encountered in Spitzoid neoplasms and how these
3 Circulatory Pathways
40 Chapter 3 Circulatory Pathways Systemic Arteries -Arteries carry blood away from the heart to the various organs of the body. -The aorta is the longest artery in the body; it branches to give rise to
This section covers the basic knowledge of normal skin structure and function required to help understand how skin diseases occur.
Background Knowledge Functions of normal skin Background Knowledge This section covers the basic knowledge of normal skin structure and function required to help understand how skin diseases occur. Learning
Integumentary System. Packet #12
Integumentary System Packet #12 Introduction Skin/Integument Skin, considered an organ, is the major component of the integumentary system. The integumentary system is also composed of other accessory
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Skin and Body Membranes
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Skin and Body Membranes 4 Body Membranes Function of body membranes Cover body surfaces Line body cavities
Integumentary System
Chapter 5 Integumentary System 5-1 Skin: composed of dermis and epidermis Dermis. Gives structural strength. C.T. with many fibers, fibroblasts, macrophages. Some adipocytes and blood vessels. Contains
Overview of the Integumentary System. Lab #7. Layers of the epidermis are known as strata. Organization of the Epidermis: Layers of the Epidermis
Overview of the Integumentary System Lab #7 Integumentary System Organization of the Epidermis: Layers of the epidermis are known as strata Figure 5 2 Layers of the Epidermis Top: Free surface of skin
All Discovered Death Outcome Detail (Form 124/120)
This file includes all reported deaths regardless of consent. ID WHI Common ID Col#1 DEATHALL All Discovered Death Col#2 Any report of death, regardless of consent status. 0 No 106,931 66.1 1 Yes 54,877
Program Script. Nursing Assessment The Head-to-Toe Assessment
Program Script Nursing Assessment The Head-to-Toe Assessment This document comprises the complete script for this program including chapter titles. This is provided to instructors to enhance the educational
Hole s Essentials of Human Anatomy & Physiology
Hole s Essentials of Human Anatomy & Physiology David Shier Jackie Butler Ricki Lewis Created by Dr. Melissa Eisenhauer Head Athletic Trainer/Assistant Professor Trevecca Nazarene University Chapter 6
SKIN HISTOLOGY the microscopic anatomy of the Integument. Mikrogeo. com
SKIN HISTOLOGY the microscopic anatomy of the Integument Mikrogeo. com Hair follicles, sweat glands, sebaceous glands (even teeth) are products of the epidermis,embryologically speaking ectododerm, that
Anatomy The study of the body's structure.
Anatomy The study of the body's structure. * 1. Systemic- Study of each of the body's systems. 2. Regional- Study of a specific area of the body 3. Surface- Study of external features. Physiology The study
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Medical Terminology. Anatomical Position, Directional Terms and Movements
Medical Terminology Anatomical Position, Directional Terms and Movements What we will cover... Content Objectives Students will be able to gain a better understanding and application of medical terminology
Diploma examination. Dermatopathology: First paper. Tuesday 21 March Candidates must answer FOUR questions ONLY. Time allowed: Three hours
Dermatopathology: First paper Tuesday 21 March 2017 1. Discuss the role of fluorescent in-situ hybridization (FISH) and emerging molecular techniques in the diagnosis of cutaneous melanocytic lesions,
Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
Supplementary Information
Supplementary Information Figure S1: Follicular melanocytes in the wound peripheral area migrate to the epidermis in response to wounding stimuli. Dorsal skin of Trp2-LacZ mice stained with X-gal and analyzed
LANGUAGE OF ANATOMY PART 1
1 LANGUAGE OF ANATOMY PART 1 Courtesy of Dr. Susan Maskel Western Connecticut State University 2 ANATOMICAL POSITION In the anatomical position, the human body is erect, with the feet only slightly apart,
STREAM. Human Body Project Pages Website QR Code body project/
STREAM Human Body Project Pages 1 16 Website QR Code https://sites.google.com/a/wyckoffschools.org/human body project/ Project Checklist Did you include Head a brain that can open to show the inside as
****************************************************************************************************** INTEGUMENTARY SYSTEM
BIOLOGY 211: HUMAN ANATOMY & PHYSIOLOGY ****************************************************************************************************** INTEGUMENTARY SYSTEM ******************************************************************************************************
Head and Neck Examination
Head and Neck Examination Statement of Goals Understand and perform an examination of the head and neck. Learning Objectives Head Ears Nose Sinus A. Describe the anatomy of the head, including regions
The Integumentary System
The Integumentary System The Integumentary System Integument is skin Skin and its appendages make up the integumentary system A fatty layer (hypodermis) lies deep to it Two distinct regions Epidermis Dermis
The Integumentary System
The Integumentary System Integument is skin Skin and its appendages make up the integumentary system A fatty layer (hypodermis) lies deep to it Two distinct regions Epidermis Dermis PHL 212 1 Function
Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT
Supplemental Figure 1. MERTK gene expression in melanoma cell line panel from Cancer Cell Line Encyclopedia. A. Microarray analysis of melanoma cell lines from UNC collection grouped by oncogenic mutation.
ICD-10 and Radiation Oncology
ICD-10 and Radiation Oncology Steven M. Verno, CEMCS ICD-10 and Radiation Oncology Steven M. Verno, CEMCS September 23, 2008 Note: ICD-9-CM and ICD-10 are owned and copyrighted by the World Health Organization.
December 3, Name five bones in your body. Are bones living or dead? Explain. What is the function of bone marrow?
December 3, 2013 Name five bones in your body. Are bones living or dead? Explain. What is the function of bone marrow? Skeletal, Muscular, and Integumentary Systems Chapter 36: Biology II The Skeleton
locomotice system Plastinated specimensⅠ: Silicone specimens Regional specimens and organs
locomotice system Plastinated specimensⅠ: Silicone specimens Regional specimens and organs Art-No. Name Description The locomotor system SL001 Two hundred pieces of plastinated bones (without six The bones
All the Rest. What is All the Rest? Integumentary System. First are the FUNCTI0NS. THERMOREGULATION function. PROTECTION function 10/12/16
What is All the Rest? Integumentary System All the Rest Integumentary System Homeostatic Imbalances Skin Cancer Burns First are the FUNCTI0NS Chemical, Physical/Mechanical, Biological Thermoregulation
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Skin and Body Membranes
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Skin and Body Membranes 4 Body Membranes Function of body membranes Cover body surfaces Line body cavities
LAB 1: Terminology & Microscopy Ex. 1, 2, 3 (p )
97 LAB 1: Terminology & Microscopy Ex. 1, 2, 3 (p. 31-34) Exercise 1: Body Organization and Terminology Levels of Organization: Cells Tissues Organs Organ systems Organism Ex. Anatomical terms (based on
AP I f2014 E3 c_5 & 6
AP I f2014 E3 c_5 & 6 Student: Multiple choice questions choose the best answer. True/false answer A for true and B for false 1. The layer within the epidermis that acts as the foundation providing new