Supplementary Information
|
|
- Beverly Austin
- 5 years ago
- Views:
Transcription
1 Supplementary Information EGFRL858R mutant enhances lung adenocarcinoma cell invasive aility and promotes malignant pleural effusion formation through activation of the CXCL12CXCR4 pathway MengFeng Tsai 1*, TzuHua Chang 2*, ShangGin Wu 3, HsiaoYin Yang 2, Yi Chiung Hsu 5, PanChyr Yang 2,4 & JinYuan Shih 2,4 Affiliation of authors: 1Department of Molecular Biotechnology, College of Biotechnology and Bioresources, Dayeh University, Changhua 51591, Taiwan, 2Department of Internal Medicine, National Taiwan University Hospital, and College of Medicine, National Taiwan University, Taipei 12, Taiwan, 3Department of Internal Medicine, National Taiwan University Hospital, YunLin Branch, Yunlin 6441, Taiwan, 4 Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University, Taipei 12, Taiwan, 5Institute of Statistical Science, Academia Sinica, Taipei 11529, Taiwan. *These two authors contriuted equally to this work. MengFeng Tsai & TzuHua Chang Corresponding author: JinYuan Shih, MD, PhD, Department of Internal Medicine, National Taiwan University Hospital, College of Medicine, National Taiwan University, 7 ChungShan South Road, Taipei 12, Taiwan. Telephone: ext Fax: address: jyshih@ntu.edu.tw Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Tale S1
2 No. of cells No. of cells a 3 25 ANo. of cells H1299EGFRWT H1299EGFR_L85R B days H1299EGFRWTsiScramle H1299EGFRWTsiCXCR4 H1299EGFRL858RsiScramle H1299EGFRL858RsiCXCR days Figure S1. Cancer cell proliferation rates assessed y thiazolyl lue tetrazolium romide (MTT) assay. (a) The cell proliferation rates of H1299 EGFRWT and H1299 EGFRL858R lung cancer cells. The proliferation rates of these two cells have no difference. () CXCR4 in H1299EGFRWT and H1299EGFRL858R cells was knocked down using a CXCR4 specific sirna. Cells were harvested 24 hours after transfection, and than the cell proliferation rates of H1299EGFRWTsiScramle, H1299EGFRWTsiCXCR4, H1299 EGFRL858RsiScramle and H1299 EGFRL858RsiCXCR4 lung cancer cell were analyzed. siscramle, cells transfected with scramled control sirna; sicxcr4, cells transfected with CXCR4specific sirna. The proliferation rates of these four cells have no difference.
3 a H1299 EGFRWT H1299 EGFRL858R EGFR 18 kda EGFR 18 kda βactin 42 kda βactin 42 kda c EGFR 18kDa βactin 42kDa Figure S2 EGFRL858R expression in lung cancer cell. (a) Overexpression of EGFRWT and EGFRL858R in lung adenocarcinoma H1299 cells was evaluated y Western lotting. () Small interfering RNA (sirna) specifically targeting EGFRL858R knocked down EGFRL858R protein expression in H1299EGFRL858R cells. (c) Overexpression of EGFRWT and EGFR L858R in lung adenocarcinoma CL1 cells was evaluated y Western lotting. This is a full length image of the cropped lot presented in the Figure 1a, c and e.
4 a c d Figure S3 The effective inhiition concentration of pharmacological inhiitors (EGFR inhiitor AG1478, ERK inhiitor U126, PI3KAKT inhiitor LY2942 and JAKSTAT3 inhiitor AG49) were performed in H1299EGFRL858R cells and then stimulated with 4ng/ml EGF. The phosphorylation status of EGFR, AKT, ERK1/2 and STAT3 (the main downstream effectors of EGF signaling pathways) was determined y Western lotting. (a) EGFR and phosphoegfr levels were evaluated in H1299EGFRL858R cells pretreated with different concentrations of the EGFR inhiitor, AG1478. () ERK and phosphoerk levels were evaluated in H1299EGFR L858R cells pretreated with different concentrations of the ERK inhiitor, U126. (c) AKT and phosphoakt levels were evaluated in H1299EGFRL858R cells pretreated with different concentrations of the PI3KAKT inhiitor, LY2942. (d) STAT3 and phosphostat3 levels were evaluated in H1299EGFRL858R cells pretreated with different concentrations of the JAK STAT3 inhiitor, AG49.
5 a H1299 EGFRL858R + + AG1478 (1 μm) + + EGF (4ng/ml) H1299 EGFRL858R + + U126 (1 μm) + + EGF (4ng/ml) pegfr (18kDa) pegfr (18kDa) EGFR (18kDa) perk EGFR (18kDa) perk ERK ERK pakt (6kDa) pakt (6kDa) AKT (6kDa) AKT (6kDa) pstat3 (86kDa) pstat3 (86kDa) STAT3 (86kDa) STAT3 (86kDa) βactin βactin Figure S4. (a) The effective inhiition concentration of EGFR inhiitor AG1478 (1um) were used and the phosphorylated and total protein of EGFR, ERK, AKT, and STAT3 were detected y Western lotting in H1299EGFRL858R cells with or without EFG stimulation. () The effective inhiition concentration of ERK inhiitor U126 (1uM) were used and the phosphorylated and total protein of EGFR, ERK, AKT, and STAT3 were detected y Western lotting in H1299EGFRL858R cells with or without EFG stimulation.the results showed that EGFR inhiitor AG1478 were significantly inhiition the phosphorylatedegfr, phosphorylatederk, phosphorylatedakt, ut not phosphorylatedstat3. Using ERK inhiitor U126 treated the H1299EGFRL858R cells, indicated that only phosphorylatederk was aolished This is a full length image of the cropped lot presented in the Figure 4,c.
6 Tale S1: Clinical characteristics of the 12 lung adenocarcinoma patients with malignant pleural effusion (MPE) Variale L848R WT Pvalue Total No. 6 6 Sex Male Female 2 2 Age Median * (Range) ( ) ( ) Smoking Never Current/Former 3 3 T N *By MannWhitney U test To confirm the association etween CXCR4 and the EGFRL858R mutation, we performed an EGFR mutation analysis of cancer cells in MPEs from 12 lung adenocarcinomas and analyzed the surface expression of CXCR4. The clinical characteristics of the 12 patients, shown in supplementary Tale S1.
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationK-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF
shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)
More informationSupplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer
S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationSupplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationhuman epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)
GSK3β facilitates IFNγ signaling Supplementary Figure Legends Figure S1. The effects of inhibiting GSK3β on IFNγinduced TNFα expression. A, A549 human epithelial cells were pretreated with control sirna
More informationEFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL PROLIFERATION IN PANCREATIC CANCER CELLS
EFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL PROLIFERATION IN PANCREATIC CANCER CELLS VIDYA MEDEPALLI ADVISOR: Maria Eugenia Sabbatini, PhD PHI KAPPA PHI RESEARCH CONFERENCE MARCH 18 TH, 2016
More informationInterleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
More informationActivation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes
Nrf2 mediates induced CLEC5A and TNFα Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNFα production by mononuclear phagocytes YiLin Cheng 1,2, YeeShin Lin 1,2,3, ChiaLing
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationTitle:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells
Author's response to reviews Title:Role of LPAR3, PKC and EGFR in LPA-induced cell migration in oral squamous carcinoma cells Authors: Ingvild J Brusevold (i.j.brusevold@medisin.uio.no) Ingun H Tveteraas
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationTITLE: Effect of MUC1 Expression on EGFR Endocytosis and Degradation in Human Breast Cancer Cell Lines
AD AWARD NUMBER: W81XWH-06-1-0464 TITLE: Effect of MUC1 Expression on EGFR Endocytosis and Degradation in Human Breast Cancer Cell Lines PRINCIPAL INVESTIGATOR: Rachid M El Bejjani CONTRACTING ORGANIZATION:
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Divergent effects of intrinsically active MEK variants on developmental Ras signaling Yogesh Goyal,2,3,4, Granton A. Jindal,2,3,4, José L. Pelliccia 3, Kei Yamaya 2,3, Eyan Yeung
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More information* * A3027. A4623 e A3507 A3507 A3507
a c L A327 d e A37 A37 A37 Supplementary Figure 1. Clinical manifestations of individuals with mutations. (a) Renal ultrasound of right kidney in A327 reveals small renal cysts, loss of corticomedullary
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The authors have presented data demonstrating activation of AKT as a common resistance mechanism in EGFR mutation positive, EGFR TKI resistant
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationSupplementary material for the manuscript
Supplementary material for the manuscript Title: CD200-positive cancer associated fibroblasts augment the sensitivity of Epidermal Growth Factor Receptor mutation-positive lung adenocarcinomas to EGFR
More informationWT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05
IL1 (ng/ml) (1 x 1 3 cells) DMSO LFMA13 R46 IL1 (ng/ml) Control shrna TNFa (ng/ml) Alum Nigericin ATP IL1 (ng/ml) IL1 (ng/ml) IL1 (ng/ml) a c f 3 2 1 1 8 6 4 2 Sup 1 8 6 4 DMSO Alum/DMSO Alum/LFMA13 ***
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. 2 3 4 DOI: 10.1038/NMAT4893 EGFR and HER2 activate rigidity sensing only on rigid matrices Mayur Saxena 1,*, Shuaimin Liu 2,*, Bo Yang 3, Cynthia Hajal
More information5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
More information100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of
Ba/F3 del19 Ba/F3 L858R a afatini afatini EGF-816 EGF-816 ty (% of ontrol) relative ell vaiilit elative ell vaiility (% of ontrol) 5 1 1 5 ty (% of ontrol) relative ell vaiilit 5 1 1 Ba/F3 T79M/L858R Ba/F3
More informationSupplementary Material. Contents include:
Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Ras V12 expression in the entire eye-antennal disc does not cause invasive tumours. a, Eye-antennal discs expressing Ras V12 in all cells (marked with GFP, green) overgrow moderately
More informationNIH Public Access Author Manuscript Nat Commun. Author manuscript; available in PMC 2015 June 15.
NIH Public Access Author Manuscript Published in final edited form as: Nat Commun. ; 5: 5811. doi:10.1038/ncomms6811. Constitutive and ligand-induced EGFR signaling triggers distinct and mutually exclusive
More informationMutations in the EGFR kinase domain mediate STAT3 activation via IL-6 production in human lung adenocarcinomas
Research article Related Commentary, page 3660 Mutations in the EGFR kinase domain mediate STAT3 activation via IL-6 production in human lung adenocarcinomas Sizhi Paul Gao, 1 Kevin G. Mark, 1 Kenneth
More informationCombined γ- Tocotrienol and Met Inhibitor Treatment Suppresses Mammary Cancer Cell Prolifera;on, Epithelial- to- Mesenchymal Transi;on, and Migra;on
Combined γ Tocotrienol and Met Inhibitor Treatment Suppresses Mammary Cancer Cell Prolifera;on, Epithelial to Mesenchymal Transi;on, and Migra;on Paul W. Sylvester, Ph.D. Pfizer Endowed Professor of Pharmacy
More informationBalazs Halmos, M.D. Division of Hematology/Oncology Columbia University Medical Center
Balazs Halmos, M.D. Division of Hematology/Oncology Columbia University Medical Center Eli-Lilly Pfizer Astellas Daiichi-Sankyo Oncothyreon Astex Astra-Zeneca Bristol-Myers-Squibb Novartis Roche Boehringer-Ingelheim
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationAspirin blocks EGF-stimulated cell viability in a COX-1 dependent manner in ovarian cancer cells
Washington University School of Medicine Digital Commons@Becker Open Access Publications 1-1-2013 Aspirin blocks EGF-stimulated cell viability in a COX-1 dependent manner in ovarian cancer cells May Cho
More informationTargeted Therapeutics for the Treatment of Cancer
Targeted Therapeutics for the Treatment of Cancer Company overview Three promising targeted anti-cancer programs Irreversible pan-erbb inhibitor EGFR/HER2/HER4 inhibitor PARP inhibitor Strategy Focus on
More informationGuangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan
Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin
More informationPRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response
PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response Hsin-Wei Liao,, Scott Kopetz, Mien-Chie Hung J Clin Invest. 2015;125(12):4529-4543. https://doi.org/10.1172/jci82826.
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationCONTRACTING ORGANIZATION: Rush University Medical Center Chicago, IL 60612
AD Award Number: W81XWH-11-1-0302 TITLE: Yin and Yang of Heparanase in breast Tumor Initiation PRINCIPAL INVESTIGATOR: Xiulong Xu, Ph.D. CONTRACTING ORGANIZATION: Rush University Medical Center Chicago,
More informationA dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma
Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationTrastuzumab e carcinoma mammario HER2+: attività e possibili meccanismi di resistenza
Innovazioni terapeutiche in Oncologia Medica Cagliari, 23-24 24 giugno 2005 Trastuzumab e carcinoma mammario +: attività e possibili meccanismi di resistenza U.O.A.D.U. Oncologia Medica ed Ematologia I.R.C.C.
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationBCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid
Supplementary Results BCR-ABL uncouples canonical JAK2-STAT5 signaling in chronic myeloid leukemia Oliver Hantschel*, Wolfgang Warsch*, Eva Eckelhart*, Ines Kaupe, Florian Grebien, Kay-Uwe Wagner, Giulio
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationUNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL. PhD THESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA PhD SCHOOL PhD THESIS THE IMPORTANCE OF TUMOR ANGIOGENESIS IN CEREBRAL TUMOR DIAGNOSIS AND THERAPY ABSTRACT PhD COORDINATOR: Prof. univ. dr. DRICU Anica PhD
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationGankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells
Research article Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells Jiang-Hong Man, Bing Liang, Yue-Xi Gu, Tao Zhou, Ai-Ling Li,
More informationDysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File
Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationAutocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells
Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental
More informationProtein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma
Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP thus showing therapeutic potential in colorectal carcinoma Hao-Wei Teng, Man-Hsin Hung, Li-Ju Chen, Mao-Ju Chang, Feng-Shu Hsieh, Ming-Hsien Tsai,
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationProstaglandin E 2 reduces radiation-induced epithelial apoptosis through a mechanism involving AKT activation and bax translocation
Research article Prostaglandin E 2 reduces radiation-induced epithelial apoptosis through a mechanism involving AKT activation and bax translocation Teresa G. Tessner, Filipe Muhale, Terrence E. Riehl,
More informationEpidermal growth factor receptor (EGFR) tyrosine kinase
Original Article Effusion Immunocytochemistry as an Alternative Approach for the Selection of First-Line Targeted Therapy in Advanced Lung Adenocarcinoma Tzu-Hsiu Tsai, MD,* Shang-Gin Wu, MD, Yih-Leong
More informationc-src-dependent EGF receptor transactivation contributes to ET-1-induced COX-2 expression in brain microvascular endothelial cells
Hsieh et al. Journal of Neuroinflammation 2012, 9:152 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access c-src-dependent EGF receptor transactivation contributes to ET-1-induced COX-2 expression in brain
More informationSupplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationAfatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data
Afatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data Oscar Arrieta, 1 Pedro De Marchi, 2 Nobuyuki Yamamoto, 3 Chong-Jen Yu, 4 Sai-Hong I Ou, 5
More informationALK Fusion Oncogenes in Lung Adenocarcinoma
ALK Fusion Oncogenes in Lung Adenocarcinoma Vincent A Miller, MD Associate Attending Physician, Thoracic Oncology Service Memorial Sloan-Kettering Cancer Center New York, New York The identification of
More informationCURRICULUM VITAE Name : Gender : Birth Place : address : Contact Tel : Education: Training and Working Experiences: Awards:
Name : Szu-Hua Pan Gender : Female Birth Place : Taipei, Taiwan E-mail address : shpan@ntu.edu.tw Contact Tel : 02-23123456 ext. 88661 CURRICULUM VITAE Education: 1991~1994 B.S., Department of Nutrition
More informationNC bp. b 1481 bp
Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna
More informationThe VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells
The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells Jen-Liang Su, 1,8 Pan-Chyr Yang, 2 Jin-Yuan Shih, 2 Ching-Yao Yang, 1,3,4 Lin-Hung Wei, 5 Chang-Yao Hsieh, 5,6 Chia-Hung Chou, 1 Yung-Ming
More informationActivation of epidermal growth factor receptor is required for Chlamydia trachomatis development
University of Massachusetts Amherst ScholarWorks@UMass Amherst Veterinary & Animal Sciences Department Faculty Publication Series Veterinary & Animal Sciences 2014 Activation of epidermal growth factor
More informationPRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response
PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response Hsin-Wei Liao, 1,2 Jung-Mao Hsu, 1 Weiya Xia, 1 Hung-Ling Wang, 3 Ying-Nai Wang, 1,3,4 Wei-Chao Chang, 3 Stefan
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationRole of EGF/ERBB1 in the transcriptional regulation of the prolactin receptor independent of estrogen and prolactin in breast cancer cells
/, Vol. 7, No. 40 Role of EGF/ERBB1 in the transcriptional regulation of the prolactin receptor independent of estrogen and prolactin in breast cancer cells Raghuveer Kavarthapu 1, Maria L. Dufau 1 1 Section
More informationEFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS
EFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS VIDYA MEDEPALLI ADVISOR: Maria Eugenia Sabbatini, PhD PHI KAPPA PHI RESEARCH CONFERENCE MARCH 8 th, 2017 Pancreatic
More informationElectronic Supplementary Information. Chemical inhibitors and stable knock-down of efflux transport leads to reduced
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Chemical inhibitors and stable knock-down of efflux
More informationThe Tumor Suppressor DAP Kinase Is a Target of RSK-Mediated Survival Signaling
Current Biology, Vol. 15, 1762 1767, October 11, 2005, 2005 Elsevier Ltd All rights reserved. DOI 10.1016/j.cub.2005.08.050 The Tumor Suppressor DAP Kinase Is a Target of RSK-Mediated Survival Signaling
More informationtom tom 24hpf tom tom 48hpf tom 60hpf tom tom 72hpf tom
a 24hpf c 48hpf d e 60hpf f g 72hpf h i j k ISV ISV Figure 1. Vascular integrity defects and endothelial regression in mutant emryos. (a,c,e,g,i) Bright-field and (,d,f,h,j) corresponding fluorescent micrographs
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on
Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3
More informationEGFR: fundamenteel en klinisch
EGFR: fundamenteel en klinisch Guido Lammering MAASTRO Clinic Maastricht, NL What is EGFR?? The EGFR some facts 1186 amino acids 170 kda Expressed by all cells of epithelial origin Increased activation
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationSupplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
More information100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
More information