SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 Supplementary Figure 1. Ras V12 expression in the entire eye-antennal disc does not cause invasive tumours. a, Eye-antennal discs expressing Ras V12 in all cells (marked with GFP, green) overgrow moderately but do not cause invasive tumours. Compare to Ras V12 clones (Fig. 1b) and Ras V12 //scrib - tumours (Fig. 1e). 1

2 Supplementary Figure 2. Interclonal cooperation between Ras V12 and lgl - causes tumours. Ras V12 clones confronted with lgl - clones cause tumours that overgrow and invade the VNC, similar to Ras V12 //scrib - tumours (Fig. 1e). 2

3 Supplementary Figure 3. Reduction of growth and invasion in Ras V12 scrib -, Ras V12 //scrib - and Ras V12 Upd tumours by mutation of stat92e. a, Growth and invasion of the VNC in Ras V12 scrib - tumors are partially suppressed by a loss-of-function mutation in stat92e, encoding the Drosophila STAT transcriptional activator. b, Growth of Ras V12 //scrib - is partially suppressed and VNC invasion completely abrogated when Ras V12 cells are mutant for stat92e. c, stat92e - partially suppresses the growth of Ras V12 Upd tumours and completely suppresses their invasion of the VNC. More efficient suppression by Dome DN may indicate a Stat92E-independent function of Domeless 1, a Domeless-independent function of Stat92E 2, or hypomorphy of the stat92e mutation. 1 Zeidler, M. P., Bach, E. A. & Perrimon, N. The roles of the Drosophila JAK/STAT pathway. Oncogene 19, (2000). 2 Li, W. X. Canonical and non-canonical JAK-STAT signaling. Trends Cell Biol 18, (2008). 3

4 Supplementary Figure 4. Cooperation between Upd overexpression and scrib - clones is not sufficient to cause tumours. a, scrib - clones overexpressing Upd marked by GFP (green) in eye-antennal discs. No tumour formation is observed. b, Wild-type clones overexpressing Upd (green) adjacent to scrib - clones. No tumour formation is observed either. 4

5 Supplementary Figure 5. Involvement of upd genes in growth and invasion of Ras V12 lgl - tumours. a, Ras V12 lgl - clones develop into tumours similar to Ras V12 scrib - tumours 1. b, Ras V12 lgl - clones expressing an interfering RNA against upd (upd IR ). Partial suppression of tumour is observed in 43% of examined animals. c, Ras V12 lgl - clones generated in a upd2 Δ3-62 mutant larva. upd2 Δ3-62 is a null mutation in the upd2 gene 2. No suppression is observed. d, Ras V12 lgl - clones expressing upd IR generated in a upd2 Δ3-62 mutant larva. The extent of upd IR suppression is increased: suppression of tumour is achieved in all animals, with 60% showing stronger suppression. These results suggest that upregulation of each of the upd genes contributes to tumour development in an additive and partially redundant way, consistent with their overlapping functions in normal development 2. 1 Pagliarini, R. A. & Xu, T. A genetic screen in Drosophila for metastatic behavior. Science 302, (2003). 2 Hombria, J. C., Brown, S., Hader, S. & Zeidler, M. P. Characterisation of Upd2, a Drosophila JAK/STAT pathway ligand. Dev Biol 288, (2005). 5

6 Supplementary Figure 6. Inhibition of cell death in Ras V12 - or Upd-expressing clones does not recapitulate Ras V12 Upd cooperation in tumour formation. a, Clones co-overexpressing Ras V12 and p35 marked by GFP (green) in eye-antennal discs. No tumour formation is observed. Compare to Fig. 2i. b, Clones co-overexpressing Upd and p35. No tumour formation is observed either. 6

7 Supplementary Figure 7. Feed-forward propagation of JNK activity in wounds. a, Propagation of JNK activity (puc-lacz reporter, green) in wing discs wounded in the posterior (P) compartment. A yellow asterisk marks the wounding site. The blue arrowhead points to puc-lacz expression in cells of the anterior (A) compartment. b, puclacz expression in discs expressing the JNK-phosphatase Puc under the control of ptc- GAL4 in A compartment cells next to the P compartment (red cells, expressing RFP), wounded as in a. Puc is both a downstream target and a negative regulator of JNK. Propagation of puc-lacz expression into the A compartment is prevented (blue hollow arrowhead). A magnified view of the central region of the disc (bracket) is shown in b. Discs were dissected 24 hours after wounding. 7

8 Supplementary Figure 8. Inhibition of cell death in wounded wing discs does not recapitulate the tumour overgrowth of wounded Ras V12 wing discs. a, b, Wing discs of a larva whose right disc was wounded by repeated pinching of the wing blade region expressing the apoptosis inhibitor p35 under the control of nub-gal4. Expression of RFP driven by nub-gal4 marks the wing blade region (red). Cell nuclei stained with DAPI (blue). Compare to Fig 4a-d. c, Quantification of the size difference between wounded and unwounded discs in wild-type (n=21 pairs of discs), p35- expressing discs (n=16) and Ras V12 -expressing discs (n=16). The wounded/unwounded size ratios (small circles), were calculated for each pair of discs by dividing the area of the region expressing nub-gal4 in the wounded left disc by the area of the same region in the unwounded control right disc of the same animal. Plots represent the 25 th -75 th percentile range as a box, the median as a horizontal line dividing the box, the mean as a black square and the range of the central 95% of the data as a vertical bar. 8

9 doi: /nature08702 stained with DAPI (blue). Compare to Fig 4a-d. c, Quantification of the size difference between wounded and unwounded discs in wild-type (n=21 pairs of discs), p35expressing discs (n=16) and RasV12-expressing discs (n=16). The wounded/unwounded size ratios (small circles), were calculated for each pair of discs by dividing the area of the region expressing nub-gal4 in the wounded left disc by the area of the same region in the unwounded control right disc of the same animal. Plots represent the 25th-75th percentile range as a box, the median as a horizontal line dividing the box, the mean as a black square and the range of the central 95% of the data as a vertical bar. Supplementary Figure 9. Requirement of JAK-STAT signaling for compensatory proliferation in the eye. a, b, stat92e- clones marked in white by absence of red pigment. c, d, Eyes containing scrib- clones (red) confronted with stat92e- cells (white). The size of the eye is reduced, same as Fig. 4h. e, Eyes where clones of wild-type cells (white) confront slower-growing M+/- mutant cells 1 (red). M+/- cells are completely absent. The size of the eye is normal. f-h, Eyes containing clones of stat92e- cells (white) confronted with M+/- cells (red). M+/cells are completely absent. The size of the eye is severely reduced. i, Eyes where cells confronting wild-type cells (light orange) have been eliminated through the GMR Hid/cell lethal system 2. GMR-Hid/cell lethal cells (red) are completely absent and the size of the eye is normal. j-l, Eyes where stat92e- cells (light orange) confront GMR- 9

10 confronting wild-type cells (light orange) have been eliminated through the GMR- Hid/cell lethal system 2. GMR-Hid/cell lethal cells (red) are completely absent and the size of the eye is normal. j-l, Eyes where stat92e - cells (light orange) confront GMR- Hid/cell lethal cells (red). GMR-Hid/cell lethal cells (red) are completely absent. The size of the eye is severely reduced. m, Graph representing the size of adult eyes containing wild-type or stat92e - clones confronted to wild-type, M +/- or GMR-Hid/cell lethal cells. n, Graph representing the portion of the eye that is white in eyes containing control wildtype and stat92e - clones marked by loss of red pigmentation (a, b and Fig. 4e, g). Error bars in m and n represent 95% confidence intervals. n 10 in all cases. 1 Morata, G. & Ripoll, P. Minutes: mutants of drosophila autonomously affecting cell division rate. Dev Biol 42, (1975). 2 Stowers, R. S. & Schwarz, T. L. A genetic method for generating Drosophila eyes composed exclusively of mitotic clones of a single genotype. Genetics 152, (1999). 10

11 Supplementary Figure 10. Requirement of upd for compensatory proliferation in the eye. a, Eye in which scrib - clones were induced. b, Eye in which scrib - clones expressing an interfering RNA against upd (upd IR ) were induced. c, Quantification of the size of eyes containing scrib - clones (n=13) and scrib - clones expressing upd IR (n=11). p-value obtained from a two-tailed t-test. Error bars represent 95% confidence intervals. 11

effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no

effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav

More information

Head of College Scholars List Scheme. Summer Studentship Report Form

Head of College Scholars List Scheme. Summer Studentship Report Form Head of College Scholars List Scheme Summer Studentship 2019 Report Form This report should be completed by the student with his/her project supervisor. It should summarise the work undertaken during the

More information

Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed

Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed in the testes. The testes were immunostained with GFP

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Transgenic Expression of the Helicobacter pylori Virulence Factor CagA Promotes Apoptosis or Tumorigenesis through JNK Activation in Drosophila

Transgenic Expression of the Helicobacter pylori Virulence Factor CagA Promotes Apoptosis or Tumorigenesis through JNK Activation in Drosophila Transgenic Expression of the Helicobacter pylori Virulence Factor CagA Promotes Apoptosis or Tumorigenesis through JNK Activation in Drosophila Anica M. Wandler, Karen Guillemin* Institute of Molecular

More information

Supplementary Figures

Supplementary Figures J. Cell Sci. 128: doi:10.1242/jcs.173807: Supplementary Material Supplementary Figures Fig. S1 Fig. S1. Description and/or validation of reagents used. All panels show Drosophila tissues oriented with

More information

Supporting Information

Supporting Information Supporting Information Fig. S1. Overexpression of Rpr causes progenitor cell death. (A) TUNEL assay of control intestines. No progenitor cell death could be observed, except that some ECs are undergoing

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1: Follicular melanocytes in the wound peripheral area migrate to the epidermis in response to wounding stimuli. Dorsal skin of Trp2-LacZ mice stained with X-gal and analyzed

More information

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus

Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*

More information

In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1 Rok Myosin-II and JNK signalling

In Drosophila, RhoGEF2 cooperates with activated Ras in tumorigenesis through a pathway involving Rho1 Rok Myosin-II and JNK signalling First posted online on 11 January 2013 as 10.1242/dmm.010066 Access the most recent version at http://dmm.biologists.org/lookup/doi/10.1242/dmm.010066 Disease Models & Mechanisms 6, 000-000 (2013) doi:10.1242/dmm.010066

More information

Supplementary Figure S1: TIPF reporter validation in the wing disc.

Supplementary Figure S1: TIPF reporter validation in the wing disc. Supplementary Figure S1: TIPF reporter validation in the wing disc. a,b, Test of put RNAi. a, In wildtype discs the Dpp target gene Sal (red) is expressed in a broad stripe in the centre of the ventral

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature07173 SUPPLEMENTARY INFORMATION Supplementary Figure Legends: Supplementary Figure 1: Model of SSC and CPC divisions a, Somatic stem cells (SSC) reside adjacent to the hub (red), self-renew

More information

RhoGEF2 Cooperates with Activated Ras in Tumourigenesis through a Pathway Involving Rho1-Rok-Myosin II and JNK Signalling

RhoGEF2 Cooperates with Activated Ras in Tumourigenesis through a Pathway Involving Rho1-Rok-Myosin II and JNK Signalling First posted online on 11 January 2013 as 10.1242/dmm.010066 2012. Published by The Company of Biologists Ltd. This Access is an Open the Access most article recent distributed version under at the http://dmm.biologists.org/lookup/doi/10.1242/dmm.010066

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Non-autonomous crosstalk between the Jak/Stat and Egfr pathways mediates Apc1-driven intestinal stem cell hyperplasia in the Drosophila adult midgut

Non-autonomous crosstalk between the Jak/Stat and Egfr pathways mediates Apc1-driven intestinal stem cell hyperplasia in the Drosophila adult midgut 4524 RESEARCH ARTICLE AND STEM CELLS Development 139, 4524-4535 (2012) doi:10.1242/dev.078261 2012. Published by The Company of Biologists Ltd Non-autonomous crosstalk between the Jak/Stat and Egfr pathways

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in

More information

C. elegans Embryonic Development

C. elegans Embryonic Development Autonomous Specification in Tunicate development Autonomous & Conditional Specification in C. elegans Embryonic Development Figure 8.36 Bilateral Symmetry in the Egg of the Tunicate Styela partita Fig.

More information

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.

Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. a. Schematic of the V-ATPase proton pump macro-complex structure. The V1 complex is composed of

More information

Autophagy suppresses Ras-driven epithelial tumourigenesis by limiting the accumulation of reactive oxygen species

Autophagy suppresses Ras-driven epithelial tumourigenesis by limiting the accumulation of reactive oxygen species Oncogene (2017) 36, 5576 5592 www.nature.com/onc OPEN ORIGINAL ARTICLE Autophagy suppresses Ras-driven epithelial tumourigenesis by limiting the accumulation of reactive oxygen species This article has

More information

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity. Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described

More information

Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.

Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from

(a-r) Whole mount X-gal staining on a developmental time-course of hearts from 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.

More information

Supplemental Figures

Supplemental Figures Supplemental Figures Supplemental Figure 1. Fasting-dependent regulation of the SREBP ortholog SBP-1 and lipid homeostasis mediated by the SIRT1 ortholog SIR-2.1 in C. elegans. (A) Wild-type or sir-2.1(lof)

More information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage

More information

Supplemental Information. Competition for Space Is Controlled. by Apoptosis-Induced Change. of Local Epithelial Topology

Supplemental Information. Competition for Space Is Controlled. by Apoptosis-Induced Change. of Local Epithelial Topology Current Biology, Volume 28 Supplemental Information Competition for Space Is Controlled by Apoptosis-Induced Change of Local Epithelial Topology Alice Tsuboi, Shizue Ohsawa, Daiki Umetsu, Yukari Sando,

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

100 mm Sucrose. +Berberine +Quinine

100 mm Sucrose. +Berberine +Quinine 8 mm Sucrose Probability (%) 7 6 5 4 3 Wild-type Gr32a / 2 +Caffeine +Berberine +Quinine +Denatonium Supplementary Figure 1: Detection of sucrose and bitter compounds is not affected in Gr32a / flies.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Wang and Page-McCaw, http://www.jcb.org/cgi/content/full/jcb.201403084/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Extracellular anti-wg staining is specific. Note

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR

More information

scientificreport Src controls tumorigenesis via JNK-dependent regulation of the Hippo pathway in Drosophila scientific report

scientificreport Src controls tumorigenesis via JNK-dependent regulation of the Hippo pathway in Drosophila scientific report scientificreport Src controls tumorigenesis via JNK-dependent regulation of the Hippo pathway in Drosophila Masato Enomoto 1 & Tatsushi Igaki 1,2+ 1 Division of Genetics, Kobe University Graduate School

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15. Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs. Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used

More information

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Brooks and Wallingford, http://www.jcb.org/cgi/content/full/jcb.201204072/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Quantification of ciliary compartments in control

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones. Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific

More information

G-TRACE: rapid Gal4-based cell lineage analysis in Drosophila

G-TRACE: rapid Gal4-based cell lineage analysis in Drosophila nature methods G-TRACE: rapid Gal4-based cell lineage analysis in Drosophila Cory J Evans, John M Olson, Kathy T Ngo, Eunha Kim, Noemi E Lee, Edward Kuoy, Alexander N Patananan, Daniel Sitz, PhuongThao

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/393/rs9/dc1 Supplementary Materials for Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Expression of escargot (esg) and genetic approach for achieving IPC-specific knockdown. (a) esg MH766 -Gal4 UAS-cd8GFP (green) and esg-lacz B7-2-22 (red) show similar expression

More information

glial cells missing and gcm2 Cell-autonomously Regulate Both Glial and Neuronal

glial cells missing and gcm2 Cell-autonomously Regulate Both Glial and Neuronal glial cells missing and gcm2 Cell-autonomously Regulate Both Glial and Neuronal Development in the Visual System of Drosophila Carole Chotard, Wendy Leung and Iris Salecker Supplemental Data Supplemental

More information

Differential regulation of protein tyrosine kinase signalling by Dock and the PTP61F variants

Differential regulation of protein tyrosine kinase signalling by Dock and the PTP61F variants Differential regulation of protein tyrosine kinase signalling by Dock and the PTP61F variants Lee F. Willoughby 1, Jan Manent 2, Kirsten Allan 2, Han Lee 3, Marta Portela 2, Florian Wiede 1,4, Coral Warr

More information

Supplemental Information. Ciliary Beating Compartmentalizes. Cerebrospinal Fluid Flow in the Brain. and Regulates Ventricular Development

Supplemental Information. Ciliary Beating Compartmentalizes. Cerebrospinal Fluid Flow in the Brain. and Regulates Ventricular Development Current Biology, Volume Supplemental Information Ciliary Beating Compartmentalizes Cerebrospinal Fluid Flow in the Brain and Regulates Ventricular Development Emilie W. Olstad, Christa Ringers, Jan N.

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC

Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 1 2 1 3 Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 4 5 6 7 (a) Reconstructions of LII/III GIN-cells with somato-dendritic compartments in orange and axonal arborizations

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a

More information

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

Supplementary information

Supplementary information Supplementary information 1 Supplementary Figure 1. CALM regulates autophagy. (a). Quantification of LC3 levels in the experiment described in Figure 1A. Data are mean +/- SD (n > 3 experiments for each

More information

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and

More information

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

More information

Chapter 5 A Dose Dependent Screen for Modifiers of Kek5

Chapter 5 A Dose Dependent Screen for Modifiers of Kek5 Chapter 5 A Dose Dependent Screen for Modifiers of Kek5 "#$ ABSTRACT Modifier screens in Drosophila have proven to be a powerful tool for uncovering gene interaction and elucidating molecular pathways.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .

Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) . Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 5 microns C7 B6 unclassified H19 C7 signal H19 guide signal H19 B6 signal C7 SNP spots H19 RNA spots B6 SNP spots colocalization H19 RNA classification Supplementary Figure 1. Allele-specific

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis

Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis Research article 1365 Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis Eihachiro Kawase 1, Marco D. Wong 1, Bee C. Ding 1

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Nature Structural & Molecular Biology: doi: /nsmb.3218

Nature Structural & Molecular Biology: doi: /nsmb.3218 Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted

More information

Identification of novel Ras-cooperating oncogenes in Drosophila melanogaster: A. RhoGEF/Rho-family/JNK pathway is a central driver of tumorigenesis

Identification of novel Ras-cooperating oncogenes in Drosophila melanogaster: A. RhoGEF/Rho-family/JNK pathway is a central driver of tumorigenesis Genetics: Published Articles Ahead of Print, published on March 2, 2011 as 10.1534/genetics.111.127910 Identification of novel Ras-cooperating oncogenes in Drosophila melanogaster: A RhoGEF/Rho-family/JNK

More information

Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration

Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Correspondence: mirna regulation of Sdf1 chemokine signaling provides genetic robustness to germ cell migration Alison A. Staton, Holger Knaut, and Antonio J. Giraldez Supplementary Note Materials and

More information

Supplementary Information

Supplementary Information Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Expanded View Figures

Expanded View Figures PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

mock! A3AC106S! A3BE255Q! 86.7! 90.1! 88.0! 89.8! 89.0!

mock! A3AC106S! A3BE255Q! 86.7! 90.1! 88.0! 89.8! 89.0! a A3A A3Bi7 A3Btok A3Bwh A3Blan mock V5 DAPI merge 5 µm b edited A3A A3Bi7 A3Btok A3Blan A3Bwh A3BF38L A3BW359L mock A3AC16S A3BE255Q 79.5 79.7 8.4 81.3 82.5 83.9 85.3 86.7 88. 89. 89.8 9.1 HBV 3DPCR Td/

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative

More information

scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila

scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila The EMBO Journal Vol. 22 No. 21 pp. 5769±5779, 2003 scribble mutants cooperate with oncogenic Ras or Notch to cause neoplastic overgrowth in Drosophila Anthony M.Brumby and Helena E.Richardson 1 Peter

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Divergent effects of intrinsically active MEK variants on developmental Ras signaling Yogesh Goyal,2,3,4, Granton A. Jindal,2,3,4, José L. Pelliccia 3, Kei Yamaya 2,3, Eyan Yeung

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila

JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila The EMBO Journal (2006) 25, 5294 5304 & 2006 European Molecular Biology Organization All Rights Reserved 0261-4189/06 www.embojournal.org JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce

More information

Developmental Biology

Developmental Biology Developmental Biology 327 (2009) 288 300 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology The HLH protein Extramacrochaetae is required

More information

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets. Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

More information

Supplementary Figure 1. Mother centrioles can reduplicate while in the close association

Supplementary Figure 1. Mother centrioles can reduplicate while in the close association C1-GFP distance (nm) C1-GFP distance (nm) a arrested HeLa cell expressing C1-GFP and Plk1TD-RFP -3 s 1 2 3 4 5 6 7 8 9 11 12 13 14 16 17 18 19 2 21 22 23 24 26 27 28 29 3 b 9 8 7 6 5 4 3 2 arrested HeLa

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on

More information

Dampening the Signals Transduced through Hedgehog via MicroRNA mir-7 Facilitates Notch-Induced Tumourigenesis

Dampening the Signals Transduced through Hedgehog via MicroRNA mir-7 Facilitates Notch-Induced Tumourigenesis Dampening the Signals Transduced through Hedgehog via MicroRNA mir-7 Facilitates Notch-Induced Tumourigenesis Vanina G. Da Ros, Irene Gutierrez-Perez, Dolors Ferres-Marco, Maria Dominguez* Instituto de

More information

Elimination of Oncogenic Neighbors by JNK-Mediated Engulfment in Drosophila

Elimination of Oncogenic Neighbors by JNK-Mediated Engulfment in Drosophila Article Elimination of Oncogenic Neighbors by JNK-Mediated Engulfment in Drosophila Shizue Ohsawa, 1 Kaoru Sugimura, 2 Kyoko Takino, 1 Tian Xu, 3 Atsushi Miyawaki, 2 and Tatsushi Igaki 1, * 1 Department

More information