Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
|
|
|
- Gary Waters
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The sections were counterstained with nuclear FastRed (red). b, Higher magnification of the outlined area (mesonephros) in (a). Ov, ovary; Ms, mesonephros. Scale bar: 100 m.
2 Supplementary Figure 2: Expression of Gli1-lacZ in perinatal ovaries. a-c, Expression of Gli1-LacZ in the developing ovaries (from E18.5 to P2) was detected by whole mount betagalactosidase staining. N=3-5 for each specimen. Scale bar: 500 m.
3 Supplementary Figure 3: Cre-mediated tdtomato expression is not observed in the absence of Cre or tamoxifen. a-c, Tamoxifen or oil was administered at E12.5 and the ovaries were analyzed for tdtomato (red) at birth. tdtomato expression is only detected in Gli1-CreER T2 ; Rosa-LSL-tdTomato ovaries that were treated with tamoxifen (a), but not in the Cre-negative control (b), nor the oil-treated control (c). N=3-4 for each specimen. Scale bar: 500 m.
4 Supplementary Figure 4: Lineage-tracing experiments for the mesonephros-derived Gli1- positive cells in the perinatal ovary. a-c, The lineage-tracing of mesonephros-derived Gli1- positive cells in the Gli1-CreER T2 ; Rosa-LSL-tdTomato embryos was induced by tamoxifen administration from E12.5-E14.5, and the ovaries were analyzed at P5 for tdtomato (red) and granulosa cell marker FOXL2 (cyan). E, embryonic day; P, postnatal day. d-f, Higher magnification of the outlined areas. Scale bar: 25 m. (c & f) are merged images of (a & b) and (d & e), respectively. N=3 for the Gli1-CreER T2 ; Rosa-LSL-tdTomato specimens.
5 Supplementary Figure 5: The mesonephros-derived Gli1-positive cells are located immediately adjacent to the basal membrane in adult ovary. Lineage-tracing of the Gli1- positive cells in the Gli1-CreER T2 ; Rosa-LSL-tdTomato embryos were induced by tamoxifen (TM) administration at E12.5. The ovaries were examined at 2 months of age for tdtomato, 3 HSD, and DAPI. Yellow dotted line indicates the basal membrane that separates the theca cell layer from granulosa cells. N=6 for the Gli1-CreER T2 ; Rosa-LSL-tdTomato specimens. Scale bar. 25 m.
6 Supplementary Figure 6: Mesonephros-derived Gli1-positive cells are steroidogenically active in the adult ovary. a-c, The lineage-tracing of the mesonephros-derived Gli1-positive cells in Gli1-CreER T2 ; Rosa-LSL-tdTomato embryos was induced by tamoxifen administration from E and the ovaries were analyzed at 2 months of age for tdtomato (red) and steroidogenic cell marker 3 HSD (green). N=4 for the Gli1-CreER T2 ; Rosa-LSL-tdTomato specimens. Scale bar: 25 m.
7 Supplementary Figure 7: qpcr analysis of Shh, Ihh, and Dhh in the perinatal ovaries. Testis (P3) (n=4), adrenal (P3) (n=4) and limb bud (E17.5) (n=4) were included as negative (testis for Shh) and positive control (adrenal for Shh; limb bud for Shh and Ihh; testis for Dhh). n=5 for the E17.5 ovaries and n=5 for the P3 ovaries. Results were normalized to 18S, and the expression levels in the testis were set as 1.
8 Supplementary Figure 8: qpcr validation of Gli1 + theca progenitor cells and Foxl2 + granulosa cells. Tamoxifen was administered to pups from P1-2 through lactating dams to induce tdtomato expression in theca progenitor cells (Gli1-CreER T2 ; Rosa-LSL-tdTomato mice) (n=3) and granulosa cells (Foxl2-CreER T2 ; Rosa-LSL-tdTomato mice) (n=5). Cells isolated from a pair of ovaries were pooled as n of 1. The ovaries from P5 pups were subjected to fluorescence-activated cell sorting. tdtomato + cells and tdtomato - cells were obtained for qpcr analysis for the expression of Gli1 and Foxl2. Results were normalized to 18S, and the expression levels in tdtomato + cells were set as 1. *P < 0.05; ***P < 0.001; Two-tailed Student s t-test. Values in all graphs are presented as means±s.e.m.
9 Supplementary Figure 9: Ovarian folliculogenesis appears normal in the absence of Dhh or Ihh in the adult ovary. a-c, PAS/ Hematoxylin staining of ovarian sections from control (Sf1- Cre; Ihh +/- ; Dhh +/- ) (n=7), Ihh het/dhh KO (Sf1-Cre; Ihh f/+ ; Dhh -/- ) (n=3) and Ihh KO/Dhh het (Sf1-Cre; Ihh f/- ; Dhh +/- ) ovaries (n=3) at 2 months of age. Asterisks indicate the presence of corpora lutea. d-f, Higher magnification images of corpus luteum. Scale bar: 200 m.
10 Supplementary Figure 10: Effects of in utero busulfan treatment on oocytes and the expression of Gli1 in the ovary. a-b, E18.5 control (n=9) and busulfan-treated ovaries (n=15) were analyzed by immunofluorescence detection for granulosa cell marker FOXL2 (green), germ cell marker TRA98 (red), and nuclear counterstain DAPI (blue). Scale bar: 100 m. c-f, Gli1- LacZ expression (blue) in the control and busulfan-treated ovaries after 3 days of culture (c & d are whole mount) and (e & f are sections counterstained with FastRed). Scale bar: 500 m.
11 Supplementary Figure 11: qpcr analysis of Gdf9 expression in control and Dhh/Ihh DKO (Sf1-Cre; Ihh f/- ; Dhh -/- ) ovaries. n=4 for control ovaries and n=3 for Dhh/Ihh DKO ovaries. Results were normalized to 18S, and the expression levels in the control (Sf1-Cre; Ihh f/+ ; Dhh +/- ) ovaries were set as 1. Two-tailed Student s t-test was applied and P=0.67. Values are presented as means±s.e.m.
12 Supplementary Table 1: Fold changes of genes of interest from microarray analysis of ovaryderived Gli1-positive cells versus mesonephros-derived Gli1-positive cells from 2 months of age mice. n=3 for independent pools of ovary-derived Gli1-positive cells and mesonephros-derived Gli1-positive cells.
Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants
SUPPLEMENTAL FIGURE LEGENDS: Supplemental Figure 1: Leydig cells are reduced at multiple stages in both male sterile mutants (Sgpl1 -/- and Plekha1 -/- ). Using an antibody against CYP11a1 to label Leydig
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
Development Supplementary information. Supplementary Figures * * +/+ +/- -/- +/+ +/- -/-
Development 144: doi:1.1242/dev.1473: Supplementary information Supplementary Figures A (f) FRT LoxP 2 3 4 B All Males Females I Ovary 1 (+) 77 bps (f) 78 bps (-) >13 bps (-) 2 4 (-) 424 bps M +/f +/-
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.
Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular
CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions
CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Drd1a-Cre driven ChR2 expression in the SCN. (a) Low-magnification image of a representative Drd1a-ChR2 coronal brain section (n = 2) showing endogenous tdtomato fluorescence (magenta).
Supporting Information
Supporting Information Lu et al. 10.1073/pnas.1719109115 SI Materials and Methods Mice. For tamoxifen-induced recombination, mice were given tamoxifenpreparedincornoil(20mg/ml;sigma)at5mgper25gof body
Ahtiainen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the
SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis
SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
a b c periosteum parietal bone bone marrow dura periosteum suture mesenchyme osteogenic front suture mesenchyme 1
coronary suture sagittal suture DOI: 10.1038/ncb3139 a b c e parietal bone suture mesenchyme parietal bone bone marrow ura ura ura f parietal bone ura suture mesenchyme bone g ura osteogenic front suture
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in
Nature Neuroscience: doi: /nn Supplementary Figure 1. ACx plasticity is required for fear conditioning.
Supplementary Figure 1 ACx plasticity is required for fear conditioning. (a) Freezing time of conditioned and control mice before CS presentation and during CS presentation in a new context. Student s
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior
Supplementary Figure 1 Trial structure for go/no-go behavior a, Overall timeline of experiments. Day 1: A1 mapping, injection of AAV1-SYN-GCAMP6s, cranial window and headpost implantation. Water restriction
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
Prenatal exposure to di(2-ethylhexyl) phthalate disrupts ovarian function in a transgenerational manner in female mice
Biology of Reproduction, 217, (), 1 16 doi:1.193/biolre/iox154 Research Article Advance Access Publication Date: 2 November 217 Research Article Prenatal exposure to di(2-ethylhexyl) phthalate disrupts
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Hedgehog signaling plays a critical role in directing correct primordial follicle formation in the mouse ovary
Hedgehog signaling plays a critical role in directing correct primordial follicle formation in the mouse ovary Honors Thesis Presented to the College of Agriculture and Life Sciences, Department of Animal
The role of growth factors in regulating cellular events during ovarian follicular development Leon J. Spicer
The role of growth factors in regulating cellular events during ovarian follicular development Leon J. Spicer Department of Animal Science, Oklahoma State University, Stillwater, OK USA SESSION #54 EAAP
SUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
Supporting Information
Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Supplementary figure 1. Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology.
Supplementary figure 1 Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology. Supplementary figure 2 Supplementary Figure 2. Evidence for existence
SOM Husse et al. Supplementary online material. Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN
SOM Husse et al. Supplementary online material Synaptotagmin10-Cre, a driver to disrupt clock genes in the SCN Jana Husse, Xunlei Zhou, Anton Shostak, Henrik Oster and Gregor Eichele SOM Husse et al.,
UMR 7221CNRS/MNHN Evolution des régulations endocriniennes Muséum National d Histoire Naturelle Paris - France
Role of Foxl2 and Dlx5/6 on uterine development and function: implications for BPES UMR 7221CNRS/MNHN Evolution des régulations endocriniennes Muséum National d Histoire Naturelle Paris - France TAKE HOME
SISTEMA REPRODUCTOR (LA IDEA FIJA) Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings
SISTEMA REPRODUCTOR (LA IDEA FIJA) How male and female reproductive systems differentiate The reproductive organs and how they work How gametes are produced and fertilized Pregnancy, stages of development,
Supplementary Figure 1. Satellite cell contribution to myofibers in whole. gastrocnemius/plantaris/soleus, diaphragm, and EOM of 12 or 20 month
Keefe et al. p. 1 Supplementary Figure 1. Satellite cell contribution to myofibers in whole muscles. (a-l) Representative cross-sections through whole TA/EDL, gastrocnemius/plantaris/soleus, diaphragm,
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Page 1. A wide variety of ovarian abnormalities are encountered in clinical practice
A wide variety of ovarian abnormalities are encountered in clinical practice Common Problems Anovulatory follicles Persistent anovulatory follicles Hemorrhagic/Luteinized follicles Persistent corpus luteum
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
Supplemental Information. Fluorescence-based visualization of autophagic activity predicts mouse embryo
Supplemental Information Fluorescence-based visualization of autophagic activity predicts mouse embryo viability Satoshi Tsukamoto*, Taichi Hara, Atsushi Yamamoto, Seiji Kito, Naojiro Minami, Toshiro Kubota,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
label the basement membrane). Different fixation methods of EB-perfused P8 mice to optimize the combination
Supplementary Figure 1 Optimization of the tissue fixation protocol to combine EB perfusion and IB4 endothelial tip cell staining in the postnatal mouse brain. a-l Labeling of EB-perfused P8 mice with
Bone Marrow Pop. (% Total) Mature Pool (Absolute %) Immature Pool (Absolute %) A10 EC Control A10 EC Control A10 EC Control
Bone Marrow Pop. (% Total) Mature Pool (Asolute %) Immature Pool (Asolute %) A10 EC A10 EC A10 EC Myeloid 50.7 57.5 37.5 46.2 13.2 11.3 Erythroid 38.3 23.2 33.3 16.8 9.3 6.3 Lymphocytes 13.8 19.0 - - -
Results and Problems in Cell Differentiation
Results and Problems in Cell Differentiation Volume 58 Series editors Jacek Z. Kubiak, Rennes CX, France Malgorzata Kloc, Houston, TX, USA More information about this series at http://www.springer.com/series/400
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature07173 SUPPLEMENTARY INFORMATION Supplementary Figure Legends: Supplementary Figure 1: Model of SSC and CPC divisions a, Somatic stem cells (SSC) reside adjacent to the hub (red), self-renew
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
PepT1 Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential. Expression of mirnas along the Crypt-Villus Axis
PepT Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential Expression of mirnas along the Crypt-Villus Axis Yuchen Zhang,*, Emilie Viennois, Mingzhen Zhang, Bo Xiao, 3, Moon Kwon
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
Retinoid Signaling in Progenitors Controls Specification and Regeneration of the Urothelium
Article Retinoid Signaling in Progenitors Controls Specification and Regeneration of the Urothelium Devangini Gandhi, 1,8 Andrei Molotkov, 1,8 Ekatherina Batourina, 1,8 Kerry Schneider, 1,8 Hanbin Dan,
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Cell Lineage Mapping of Taste Bud Cells and Keratinocytes in the Mouse Tongue and Soft Palate TADASHI OKUBO, a,b CHERYL CLARK, a BRIGID L.M. HOGAN a a Department of Cell Biology,
ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed
Supplementary Figure 1 Madm is not required in GSCs and hub cells. (a,b) Act-Gal4-UAS-GFP (a), Act-Gal4-UAS- GFP.nls (b,c) is ubiquitously expressed in the testes. The testes were immunostained with GFP
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
Supplementary Information
Supplementary Information Figure S1: Follicular melanocytes in the wound peripheral area migrate to the epidermis in response to wounding stimuli. Dorsal skin of Trp2-LacZ mice stained with X-gal and analyzed
Nature Neuroscience: doi: /nn Supplementary Figure 1. Distribution of starter cells for RV-mediated retrograde tracing.
Supplementary Figure 1 Distribution of starter cells for RV-mediated retrograde tracing. Parcellation of cortical areas is based on Allen Mouse Brain Atlas and drawn to scale. Thick white curves, outlines
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Genome Integrity in Mammalian Oocytes
Genome Integrity in Mammalian Oocytes ESHRE Workshop on mammalian folliculogenesis and oogenesis April 19 21 Stresa Italy 2003 Workshop Lisbon Genome Integrity Structure is chromatin in open or closed
Nature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections.
Supplementary Figure 1 Characterization of viral injections. (a) Dorsal view of a mouse brain (dashed white outline) after receiving a large, unilateral thalamic injection (~100 nl); demonstrating that
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Supplementary Figures
Supplementary Figures Supplementary Figure 1. nrg1 bns101/bns101 embryos develop a functional heart and survive to adulthood (a-b) Cartoon of Talen-induced nrg1 mutation with a 14-base-pair deletion in
Supplemental Data Tamoxifen administration to Vil-Scap- mice.
Supplemental Data FIGURE S1. Tamoxifen administration to Vil-Scap - mice. In the experiments shown in Fig. 1 to Fig. 5, tamoxifen (2 mg per dose) was dissolved in corn oil and administered by orogastric
Supplementary Information
Supplementary Information 1 Supplementary information, Figure S1 Establishment of PG-haESCs. (A) Summary of derivation of PG-haESCs. (B) Upper, Flow analysis of DNA content of established PG-haES cell
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
REPRODUCCIÓN. La idea fija. Copyright 2004 Pearson Education, Inc., publishing as Benjamin Cummings
REPRODUCCIÓN La idea fija How male and female reproductive systems differentiate The reproductive organs and how they work How gametes are produced and fertilized Pregnancy, stages of development, birth
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Chapter 14 The Reproductive System
Biology 12 Name: Reproductive System Per: Date: Chapter 14 The Reproductive System Complete using BC Biology 12, page 436-467 14. 1 Male Reproductive System pages 440-443 1. Distinguish between gametes
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus)
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus) Ayelén Melisa Blanco 1,2, Juan Ignacio Bertucci 2,3, Naresh Ramesh 2, María Jesús Delgado
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
Transplantation directs oocyte maturation from embryonic stem cells and provides a therapeutic strategy for female infertility
Transplantation directs oocyte maturation from embryonic stem cells and provides a therapeutic strategy for female infertility Cory R. Nicholas 1, Kelly M. Haston 1, Amarjeet K. Grewall 2, Teri A. Longacre
IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
SUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
OVARY The surface of the ovary is covered with surface epithelium
OVARY Cow The ovary, or female gonad, is: 1. an exocrine gland, producing oocytes 2. an endocrine gland, secreting hormones, i.e., estrogen and progesterone OVARY OVARY The surface of the ovary is covered
The Human Menstrual Cycle
The Human Menstrual Cycle Name: The female human s menstrual cycle is broken into two phases: the Follicular Phase and the Luteal Phase. These two phases are separated by an event called ovulation. (1)
Supplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
Supplementary Note. Nature Genetics: doi: /ng.2928
Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped
Supplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/487/eaag2476/dc1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3