Nature Genetics: doi: /ng Supplementary Figure 1. Susceptibility of MTase-deficient E. coli K12 to sublethal ampicillin treatment.
|
|
- Gilbert Buck Gibson
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Susceptibility of MTase-deficient E. coli K12 to sublethal ampicillin treatment. (a,b) Wild-type (wt) or MTase-deficient E. coli BW25113 (a) or MG1655 (b) were grown in LB to an OD of 0.3 and then treated with ampicillin (2.5 μg/ml) or left untreated. CFUs and/or OD were monitored hourly. (c) Determination of ampicillin MIC (left) and MBC 90 (right) for E. coli BW25113 by broth microdilution in LB. Wild-type and dam MIC values were 6 g/ml and 4 g/ml, respectively; wildtype and dam MBC 90 values were 2.7 g/ml and 1.5 g/ml, respectively. Dotted lines indicate cutoff values for MIC (OD < 0.1) or MBC 90 (10% survival). MBC 90 values were interpolated using a sigmoidal curve fit model as shown. In a c, data are shown as means ± s.e.m. of n = 2 3 independent experiments.
2 Supplementary Figure 2 Complementation of dam E. coli ampicillin sensitivity with wild-type or catalytically inactive mutant Dam. Wild-type or dam E. coli BW25113 were transformed with the indicated Cm r plasmid expressing gfp, dam or mutant dam in which the catalytic DPPY motif is disrupted by a single amino acid change (D181S, D181N or P183R). Plasmid-bearing strains were grown in LB supplemented with chloramphenicol (15 g/ml). (a) Genomic DNA extracted from the indicated strains at stationary phase was either digested with DpnII, which cleaves at GATC sites only in the absence of methylation, or left undigested. Digests were run on a 0.8% agarose gel containing ethidium bromide. (b) OD kinetics of wild-type or dam E. coli BW25113 harboring the indicated Cm r plasmids cultured in LB supplemented with chloramphenicol (15 g/ml) with or without ampicillin (2.5 g/ml) at log phase. (c) The indicated E. coli BW25113 strains were grown in LB to an OD of 0.2 and then treated with 2 g/ml ampicillin or left untreated. In b and c, CFUs and/or OD were monitored hourly to assess survival. Data are shown as means ± s.e.m. of n = 3 independent experiments.
3 Supplementary Figure 3 Stability of GATC methylome kinetics during growth in the presence or absence of ampicillin. Genome-wide GATC methylation kinetics displayed as in Figure 2d during growth in LB (top) or in LB supplemented with 2.5 g/ml ampicillin (bottom). The top panel is the same as the plot displayed in Figure 2d. The empty green arrowhead highlights the only GATC site displaying statistically significant differential methylation between untreated and ampicillin-treated samples (Supplementary Table 2 and Supplementary Data Set 1).
4 Supplementary Figure 4 dinb, muts and muth dependence of dam E. coli sensitivity to ampicillin. The indicated E. coli BW25113 strains were grown in LB to an OD of 0.3 and then treated with 2.5 g/ml of ampicillin or left untreated. OD was monitored hourly to assess survival. Data are shown as means ± s.e.m. of n = 2 independent experiments.
5 Supplementary Figure 5 dinb, muts and muth dependence of dam sensitivity to ofloxacin. The indicated E. coli BW25113 strains were grown in LB to an OD of 0.3 and then treated with ofloxacin (50 ng/ml) or left untreated. CFUs in bacterial cultures were monitored hourly to assess survival. Data are shown as mean percent survival ± s.e.m. of n = 2 independent experiments.
6 Supplementary information Supplementary table 1: GATC sites partially or fully non-methylated during log-tostationary phase transition in LB or over the course of ampicillin treatment. Methylation pattern over time Methylation increases Methylation decreases Non-methylated Hemimethylated Other Genetic arrangement Site Position Coverage b Inter- Upstream Downstream /intragenic gene gene (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) 104 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 21 Overlapping protein binding site intergenic sert (-) hyaa (+) - - intergenic ycgg (+) ymgf (+) - - intergenic ydcd (+) ynci (+) - - intergenic yiaj (-) yiak(+) R- Pol* - intergenic dgor (+) yidx (+) - - intergenic ycdy (+) ycdz (+) CRP intergenic comr (-) bhsa (+) CRP - intergenic yohk (+) cdd (+) CRP intergenic ppia (-) tgsa (+) CRP - intergenic yibl (-) mlta (+) CRP - intergenic comr (-) bhsa (+) ComR* intergenic rpsa (+) ynfa (+) Yhdf* intergenic mltb (+) guta (+) CRP; GutR* intergenic soda (+) kdgt (+) - - intergenic -- (+) -nr (+) Fis intergenic insg (+) yjhb (+) -nr* - intergenic -nc (-) fimb (+) -nr* - intergenic fepd (-) ents (+) Fur - intragenic gdha (+) gdha(+) - - a Base pairs and strand; b average sequencing coverage ± SD, n = 2 3 replicates; *protein binding sites is within 10 bp of methylation site. Sites are grouped based on methylation pattern over time in untreated E. coli. Ref ,2,4 1,2,4 -
7 Supplementary table 2: Statistical analysis of differential methylation in LB versus ampicillin treatment at selected GATC sites from Fig. 2d. P-values (undjusted) b P-values (multiplicity adjusted) c Site Position a 1h 2h 3h 4h 1h 2h 3h 4h (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) (+) (-) a Base pairs and strand; b p-value determined using a two-tailed heteroskedastic (unequal variances) t-test; c p-value adjusted for multiple hypothesis testing on the whole dataset using Benjamini-Hochberg false discovery rate correction; for sites with no change in frac between LB and ampicillin treatment the t-test cannot be performed and the adjusted p-value is 1 (non-significant); cells in red, p<0.05.
8 Supplementary table 3: Quinolone-resistance conferring mutations in Cipro R UPEC clinical isolate Gene Function Mutation Ref. gyra D- gyrase subunit A S83L 5 D87N parc D- topoisomerase IV, subunit A S80I pare D- topoisomerase IV, subunit B S458A marr Activator of multidrug efflux system 6 G103S Y137H Supplementary references 1. Tavazoie, S. & Church, G.M. Quantitative whole-genome analysis of Dam protein interactions by in vivo methylase protection in E. coli. Nat Biotechnol 16, (1998). 2. Wang, M.X. & Church, G.M. A whole genome approach to in vivo Dam protein interactions in E. coli. Nature 360, (1992). 3. Holst, B., Sogaard-Andersen, L., Pedersen, H. & Valentin-Hansen, P. The camp- CRP/CytR nucleoprotein complex in Escherichia coli: two pairs of closely linked binding sites for the camp-crp activator complex are involved in combinatorial regulation of the cdd promoter. EMBO J 11, (1992). 4. Hale, W.B., van der Woude, M.W. & Low, D.A. Analysis of nonmethylated GATC sites in the Escherichia coli chromosome and identification of sites that are differentially methylated in response to environmental stimuli. J Bacteriol 176, (1994). 5. Mavroidi, A. et al. Ciprofloxacin-resistant Escherichia coli in Central Greece: mechanisms of resistance and molecular identification. BMC Infect Dis 12, 371 (2012). 6. Zayed, A.A., Essam, T.M., Hashem, A.G. & El-Tayeb, O.M. 'Supermutators' found amongst highly levofloxacin-resistant E. coli isolates: a rapid protocol for the detection of mutation sites. Emerg. Microbes Infect. Dis. 4(2015).
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSupplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationMolecular epidemiology and drug resistance mechanism of Salmonella species especially in S. Typhi strains isolated in Bangladesh
Molecular epidemiology and drug resistance mechanism of Salmonella species especially in S. Typhi strains isolated in Bangladesh Dr. Kaisar Ali Talukder Senior Scientist Icddr,b This presentation will
More informationThe unconstrained evolution of fast and efficient antibiotic-resistant bacterial genomes
In the format provided by the authors and unedited. VOLUME: ARTICLE NUMBER: 5 The unconstrained evolution of fast and efficient antibiotic-resistant bacterial genomes Carlos Reding-Roman, Mark Hewlett,
More informationEffect of efflux pump inhibitors on antimicrobial resistance and in vivo colonization of Campylobacter jejuni
Effect of efflux pump inhibitors on antimicrobial resistance and in vivo colonization of Campylobacter jejuni J. Lin & M. Ensminger Department of Animal Science, The University of Tennessee, Knoxville,
More informationSupplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
More informationAMR prediction based on WGS data
AMR prediction based on WGS data Valeria Bortolaia, DVM, PhD Research Group for Genomic Epidemiology National Food Institute Technical University of Denmark This lecture How to use WGS for AMR surveillance?
More informationA Yersinia-Secreted Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System
Cell Host & Microbe, Volume 7 Supplemental Information A Yersinia-Secreted Effector Protein Promotes Virulence by Preventing Inflammasome Recognition of the Type III Secretion System Igor E. Brodsky, Noah
More informationIdentification of a Serratia marcescens clinical isolate with multiple. Serratia marcescens, a Gram-negative bacillus that belongs to the family
AAC Accepts, published online ahead of print on 13 August 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.00070-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6
More informationSupplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
More informationSynergists from Portulaca oleracea with macrolides against methicillin-resistant Staphylococcus aureus and related mechanism
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Synergists from Portulaca oleracea with macrolides against methicillin-resistant Staphylococcus aureus and related mechanism KP Fung *, QB Han, M Ip,
More informationSupplemental Material for. Figure S1. Identification of TetR responsive promoters in F. novicida and E. coli.
Supplemental Material for Synthetic promoters functional in Francisella novicida and Escherichia coli Ralph L. McWhinnie and Francis E. Nano Department of Biochemistry and Microbiology, University of Victoria,
More informationINTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST
INTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST Kirk A. Staschke 1, Souvik Dey 1, John M. Zaborske 2, Lakshmi Reddy Palam 1, Jeanette N. McClintick
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationthrl leuo/leul degp lacz ybao [MarA]
a thrl leuo/leul degp lacz yao [MarA] complex free DNA phep mode/acrz yiv yjc/grxa ycgf/ycgz [MarA] complex free DNA fnr yneo marc/marr yeef ompc/micf [MarA] complex free DNA ypec yfes>
More informationAdenium Biotech. Management: - Peter Nordkild, MD, CEO, ex Novo Nordisk, Ferring, Egalet - Søren Neve, PhD, project director, ex Lundbeck, Novozymes
Adenium Biotech Management: - Peter Nordkild, MD, CEO, ex Novo Nordisk, Ferring, Egalet - Søren Neve, PhD, project director, ex Lundbeck, Novozymes Board of Directors: - Stephan Christgau, PhD, chairman,
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationN α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis
JOURNAL OF PROTEOMICS 74 (2011) 431 441 available at www.sciencedirect.com www.elsevier.com/locate/jprot N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis Masahiro Kamita
More informationFirst detection of the mcr-1 gene in Escherichia coli isolated from livestock between 2013
AAC Accepted Manuscript Posted Online 29 August 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.01472-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 First detection of
More informationReport on susceptibility of Salmonella serotypes in Belgium Vicky Jasson
CODA-CERVA Report on susceptibility of Salmonella serotypes in Belgium 2014. Vicky Jasson Veterinary and Agrochemical Research Centre 1 Introduction Salmonella is one of the most important bacterial zoonotic
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationANALYSIS OF MYCOPLASMA GENITALIUM STRAINS ISOLATED FROM PREGNANT WOMEN AT AN ACADEMIC HOSPITAL IN PRETORIA, SOUTH AFRICA
ANALYSIS OF MYCOPLASMA GENITALIUM STRAINS ISOLATED FROM PREGNANT WOMEN AT AN ACADEMIC HOSPITAL IN PRETORIA, SOUTH AFRICA Mafunise M 1, Le Roux MC 1, de Villiers BE 1, Ditsele RMM 1,2 1 Department of Microbiological
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationNature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.
Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationFigure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.
Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationNEW ANTI-INFECTIVE AGENTS IN 2003 : SPECTRUM AND INDICATIONS. 20th Symposium (spring 2003) Thursday May 22nd 2003
NEW ANTI-INFECTIVE AGENTS IN 2003 : SPECTRUM AND INDICATIONS 20th Symposium (spring 2003) Thursday May 22nd 2003 The slides presented at this meeting are available on this site as "Web slide shows" and
More informationSupplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationSupplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1,
Supplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1, gasr-8 and k10g6.4 based on WormBase (http://wormbase.org),
More informationreads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationRapid Diagnosis and Detection of Drug Resistance in Tuberculosis
Rapid Diagnosis and Detection of Drug Resistance in Tuberculosis YAM Wing-Cheong 任永昌 Department of Microbiology The University of Hong Kong Tuberculosis Re-emerging problem in industrialized countries
More informationMonitoring for Drug Resistance by Genotyping. Urvi M Parikh, PhD MTN Virology Core Lab
Monitoring for Drug Resistance by Genotyping Urvi M Parikh, PhD MTN Virology Core Lab Outline What is Drug Resistance? Genotyping Algorithm Standard vs Sensitive Resistance Testing Sequencing Protocols
More informationFor the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:
Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC
More informationRésistance bactérienne au cours des Infections Sexuellement Transmissibles Cécile Bébéar
Résistance bactérienne au cours des Infections Sexuellement Transmissibles Cécile Bébéar French Na*onal Center for bacterial STIs Bordeaux University hospital, Bordeaux, France University of Bordeaux,
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 2 ARTICLE NUMBER: 17084 Metabolic anticipation in Mycobacterium tuberculosis Hyungjin Eoh, Zhe Wang, Emilie Layre,
More informationLABORATORY BASED DST FOR BEDAQUILINE AND INTRODUCTION IN COUNTRIES
LABORATORY BASED DST FOR BEDAQUILINE AND INTRODUCTION IN COUNTRIES NDWG Annual meeting 2015, Cape Town, South Africa Rigouts Leen, Institute of Tropical Medicine, Antwerp, Belgium 1 Bedaquiline (BDQ) Sirturo
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationIn vitro assessment of dual drug combinations to inhibit growth of Neisseria gonorrhoeae
AAC Accepted Manuscript Posted Online 26 January 2015 Antimicrob. Agents Chemother. doi:10.1128/aac.04127-14 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 In vitro assessment
More informationAP Biology Summer Assignment Chapter 3 Quiz
AP Biology Summer Assignment Chapter 3 Quiz 2016-17 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. All of the following are found in a DNA nucleotide
More informationEscherichia coli Nissle 1917
Immunoregulation in Inflammatory Bowel Diseases New therapeutic approaches Probiotics Escherichia coli Nissle 1917 Andreas Sturm Medizinische Klinik m.s. Hepatologie, Gastroenterologie, Endokrinologie
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationPublished Quarterly Mangalore, South India ISSN Volume 3, Issue 4; October-December 2004
Published Quarterly Mangalore, South India ISSN 0972-5997 Volume 3, Issue 4; October-December 2004 Original Article Plasmid-Encoded Multidrug Resistance of Salmonella typhi and some Enteric Bacteria in
More informationIncreasing Genetic Relatedness of Ciprofloxacin-Resistant Streptococcus pneumoniae Isolated in Canada from 1997 to 2005
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2008, p. 1190 1194 Vol. 52, No. 3 0066-4804/08/$08.00 0 doi:10.1128/aac.01260-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Increasing
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationddm1a (PFG_3A-51065) ATG ddm1b (PFG_2B-60109) ATG osdrm2 (PFG_3A-04110) osdrm2 osdrm2 osdrm2
Relative expression.6.5.4.3.2.1 OsDDM1a OsDDM1b OsDRM2 TG TG TG ddm1a (PFG_3-5165) P1 P3 ddm1b (PFG_2-619) P2 531bp 5233bp P1 P4 P3 P2 F1 R1 F1 TG TG TG F1 R1 C ddm1a -/- -/- ddm1b -/- +/- +/- -/- D (PFG_3-411)
More informationEvaluation of Antibacterial Effect of Odor Eliminating Compounds
Evaluation of Antibacterial Effect of Odor Eliminating Compounds Yuan Zeng, Bingyu Li, Anwar Kalalah, Sang-Jin Suh, and S.S. Ditchkoff Summary Antibiotic activity of ten commercially available odor eliminating
More informationDRUG RESISTANCE IN TUBERCULOSIS
DRUG RESISTANCE IN TUBERCULOSIS INTRODUCTION Up to 50 million people may be infected with drug-resistant resistant TB.* Hot zones of MDR-TB such as Russia, Latvia, Estonia, Argentina and the Dominican
More informationLate assembly of the Vibrio cholerae cell division machinery postpones
2 Late assembly of the Vibrio cholerae cell division machinery postpones septation to the last % of the cell cycle 3 4 Elisa Galli, Evelyne Paly and François-Xavier Barre,# 5 6 7 Institute for Integrative
More informationGenome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationLife Sciences 1A Midterm Exam 2. November 13, 2006
Name: TF: Section Time Life Sciences 1A Midterm Exam 2 November 13, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use
More informationRate and molecular spectrum of spontaneous mutations in the bacterium Escherichia coli as determined by whole-genome sequencing
Rate and molecular spectrum of spontaneous mutations in the bacterium Escherichia coli as determined by whole-genome sequencing Heewook Lee a, Ellen Popodi b, Haixu Tang a, and Patricia L. Foster b,1 a
More informationCharacterization of the DNA-mediated Oxidation of Dps, a Bacterial Ferritin
SUPPORTING INFORMATION Characterization of the DNA-mediated Oxidation of Dps, a Bacterial Ferritin Anna R. Arnold, Andy Zhou, and Jacqueline K. Barton Division of Chemistry and Chemical Engineering, California
More informationSLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4
GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase
More informationTable S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
More informationMolecular mechanisms of antibiotic resistance in Neisseria gonorrhoeae
medicaldaily.com http://en.vircell.com/diseases ppcorn.com Molecular mechanisms of antibiotic resistance in Neisseria gonorrhoeae Robert Nicholas University of North Carolina at Chapel Hill cdc.gov Timeline
More informationGene expression scaled by distance to the genome replication site. Ying et al. Supporting Information. Contents. Supplementary note I p.
Gene expression scaled by distance to the genome replication site Ying et al Supporting Information Contents Supplementary note I p. 2 Supplementary note II p. 3-5 Supplementary note III p. 5-7 Supplementary
More informationCh 8 Practice Questions
Ch 8 Practice Questions Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What fraction of offspring of the cross Aa Aa is homozygous for the dominant allele?
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationPredicted Resistance at CDC
National Center for Emerging and Zoonotic Infectious Diseases Predicted Resistance at CDC Ian Plumb, MBBS MSc Medical Epidemiologist, NARMS Team, EDEB, DFWED PulseNet & OutbreakNet Regional Meeting, East
More informationSupplementary Materials
Supplementary Materials Supplementary figure 1. Taxonomic representation summarized at genus level. Fecal microbiota from a separate set of Jackson and Harlan mice prior to irradiation. A taxon was included
More informationSupplementary information: Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
Supplementary information: Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors Jan Jakubík, Alena Randáková, Pavel Zimčík, Esam E. El-Fakahany, and Vladimír
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationIncorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
More informationmicrorna PCR System (Exiqon), following the manufacturer s instructions. In brief, 10ng of
SUPPLEMENTAL MATERIALS AND METHODS Quantitative RT-PCR Quantitative RT-PCR analysis was performed using the Universal mircury LNA TM microrna PCR System (Exiqon), following the manufacturer s instructions.
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationHHS Public Access Author manuscript Int J Tuberc Lung Dis. Author manuscript; available in PMC 2016 April 01.
Determination of MICs of Levofloxacin for Mycobacterium tuberculosis with gyra Mutations Priti Kambli a, Kanchan Ajbani a, Chaitali Nikam a, Archana Khillari a, Anjali Shetty a, Zarir Udwadia b, Sophia
More informationResistance to linezolid in enterococci and staphylococci referred to the national reference laboratory
Resistance to linezolid in enterococci and staphylococci referred to the national reference laboratory Dr Danièle Meunier, AMRHAI BSAC - Antimicrobial Susceptibility Testing User Days Oxazolidinone Linezolid
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationA synthetic lethal approach for compound and target identification in Staphylococcus
SUPPLEMENTARY INFORMATION A synthetic lethal approach for compound and target identification in Staphylococcus aureus Lincoln Pasquina 1,2, John P. Santa Maria Jr. 1,3, B. McKay Wood 1, Samir H. Moussa
More informationIdentification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist
Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationOverview: Chapter 19 Viruses: A Borrowed Life
Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between
More informationKidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationDOSAGE FORMS AND STRENGTHS Cream: Each gram contains 10 mg of ozenoxacin (1%) (3).
HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include all the information needed to use XEPI TM safely and effectively. See full prescribing information for XEPI TM. XEPI TM (ozenoxacin)
More informationPrevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women
Prevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women K E Y WORDS HPV-16, cervical cancer, E6-T350G variant A BSTRACT High-risk HPV, particularly
More informationCrl and RpoS May Not Be Involved in Cross Protection against Tetracycline in Escherichia coli in Response to Heat Stress
rl and RpoS May Not Be Involved in ross Protection against Tetracycline in Escherichia coli in Response to Heat Stress Irina han, hi Wing heng, Jasmine hin, and Veronica how Department of Microbiology
More informationJ. A. Mayfield et al. FIGURE S1. Methionine Salvage. Methylthioadenosine. Methionine. AdoMet. Folate Biosynthesis. Methylation SAH.
FIGURE S1 Methionine Salvage Methionine Methylthioadenosine AdoMet Folate Biosynthesis Methylation SAH Homocysteine Homocystine CBS Cystathionine Cysteine Glutathione Figure S1 Biochemical pathway of relevant
More informationSOS Induction by Stabilized Topoisomerase IA Cleavage Complex Occurs via the RecBCD Pathway
JOURNAL OF BACTERIOLOGY, May 2008, p. 3399 3403 Vol. 190, No. 9 0021-9193/08/$08.00 0 doi:10.1128/jb.01674-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. SOS Induction by Stabilized
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
More informationThe Journal of Experimental Microbiology & Immunology+ Yasaman Jalalkamali, Niknaz Malekafzali, Raisa Shabbir, Tianna Sihota
Vol 4:1-10 The Journal of Experimental Microbiology & Immunology+ The RcsB-dependent Upregulation of rpra Contributes to the Intrinsic Antibiotic Resistance of Escherichia coli Exposed to Antibiotics Targeting
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationThe pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells.
Supplementary Figure 1 The pi-value distribution of single-pass membrane proteins at the plasma membrane in immune cells and in total cells. The PI values were measured for the first 10 amino acids in
More informationRESISTANCE RELATIONSHIPS BETWEEN PLATINUM AND PARP-INHIBITORS IN OVARIAN CANCER.
RESISTANCE RELATIONSHIPS BETWEEN PLATINUM AND PARP-INHIBITORS IN OVARIAN CANCER. Britta Stordal 1, Yidong Chen 2, Angela Farrelly 3, Danielle Gallagher 3, Steven Busschots 1, Mattia Cremona 3, Mark Carey
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationA programmable NOR-based device for transcription profile analyses
A programmable NOR-based device for transcription profile analyses Tom Ran 1,2, Yehonatan Douek 1, Lilach Milo 1 & Ehud Shapiro 1,2 1 Department of Computer Science and Applied Mathematics 2 Department
More information