Assay Kits

Size: px
Start display at page:

Download "Assay Kits"

Transcription

1 Assay Kits Immuno Assays Human Mouse Rat Rabbit Bovine Swine Equine Goat Faline Canine Chicken

2 Your leading RUO Assay supplier offering more than 800 Assays & Kits from leading global manufacturers. Guaranteed Quality Standardized & well cited assays Quick response on technical queries. Competitive & cost effective Shipping Time 2-3 weeks Now search products online on: TM * Dear Researcher, Greetings from Biogenuix! Biogenuix brings to you one of the largest portfolios of RUO Assay kits and reagents for lifescience research in India. Our products are currently being used at all leading Pharmaceuticals & Drug development companies, Research Institutes and CRO s. Our Business Policy:» Offer only the best quality products» Put customer service before profits» Differentiate through service and response turnaround to any customer query.» Put ethics before business opportunity» Take initiative and apply innovation Assays & Kit Portfolio: Here, we are pleased to present a menu of more than 800 different RUO kits manufactured by leading global research products companies from US & European origin. Immunoassay Kits are classified under following catagories: Species Independent Assays Multi Species (Reactivity with more than one species) Human Murine (Mouse) Rat Rabbit Bovine Swine (Pig) Equine (Horse) Goat Faline (Cat) Canine (Dog) Chicken Listeria Monocytogenes Customer Support: All products offered by us are backed with our commitment of proven product quality, prompt supply and quick response time to any of your enquiries. Our supplier s are also committed to deliver quick resolutions to any technical queries and help you achieve the best possible results from your experiment. Please feel free to contact us or write to us. We look forward to receive your valued support and the opportunity to service your requirements Best regards For, Biogenuix Medsystems Pvt. Ltd * Subject to availability at the manufacturer.

3 IMMUNO ASSAYS SPECIES INDEPENDENT ADI ADI ADI Aldosterone EIA kit Angiotensin A EIA kit Angiotensin I EIA kit ADI Angiotensin II EIA kit ADI Arg8-Vasopressin EIA kit CS1060 BACE-1 activity assay ADI Bradykinin EIA kit ADI K019-C1 K019-C5 K019-H1 K019-H5 ADI ADI ADI ADI ADI K020-C1 K020-C5 K020-H1 K020-H5 ADI ADI QZBcol1-1 QZBtotcol1 K014-H1 K014-H5 ADI K003-H1 K003-H5 K003-H1W K003-H5W ADI KB02-H1 KB02-H2 ADI ADI ADI ADI-EKS-350 ADI ADI ADI ADI ADI ADI ADI ADI camp complete EIA kit camp Direct Chemiluminescent EIA kit camp Direct Chemiluminescent EIA kit camp Direct EIA Kit camp Direct EIA Kit camp EIA kit camp (Direct) EIA kit Caspase-3 colorimetric detection kit Caspase-3 fluorometric detection kit cgmp complete EIA kit cgmp Direct Chemiluminescent kit cgmp Direct Chemiluminescent kit cgmp Direct EIA kit cgmp Direct EIA kit cgmp EIA kit cgmp (Direct) EIA kit Collagen (soluble) assay Collagen (Total) assay Corticosterone EIA Corticosterone EIA Corticosterone EIA kit Cortisol EIA Cortisol EIA Cortisol EIA Cortisol EIA Cortisol EIA kit Creatinine Kit Creatinine Kit Cysteinyl leukotriene EIA kit DHEA EIA kit DHEA EIA kit DNA damage EIA kit Estradiol(17ß) EIA kit Estradiol(17ß) EIA kit Estriol EIA kit HETE 15(S) EIA kit HETE(12S) EIA kit HODE 13(S) EIA kit Hydrogen peroxide chemiluminescent detection kit Hydrogen peroxide colorimetric detection kit 5x 96 well 5x 5x 5x 5x 96 strip well 5x96 strip well 5x 2x 4x 5x Text Colour Chemi / Bio-luminescent Assay Kits ELISA/Colorimetric Assay Kits

4 SPECIES INDEPENDENT QZBhypro1 Hydroxyproline assay ADI LTB4 EIA kit 5x ADI LTB4 EIA kit ADI LVV Hemorphin 7 EIA kit K023-H1 Nitric Oxide Colorimteric Detection kit 2x STA-305 Nitrotyrosine ELISA Kit (1 plate) ADI Oxytocin EIA kit ADI-EKS-470 p70 S6K activity kit ADI PGE1 EIA kit ADI PGE1 EIA kit 5 x K018-C1 PGE2 Chemiluminescent EIA kit K018-C5 PGE2 Chemiluminescent EIA kit 5x ADI PGE2 CLIA kit K018-H1 PGE2 EIA K018-H5 PGE2 EIA 5x K018-HX1 PGE2 EIA high Sensitivity kit K018-HX5 PGE2 EIA high Sensitivity kit 5x ADI PGE2 EIA kit ADI PGE2 high sensitivity EIA kit ADI PGF1a( 6-keto)EIA kit ADI PGF2a EIA kit ADI PGF2a EIA kit 5 x ADI PGF2a high sensitivity EIA kit ADI PGF2a high sensitivity EIA kit 5x ADI PGF2a(8-iso) EIA kit ADI PGF2a(Direct 8-iso) EIA kit ADI PGF2a(Direct 8-iso) EIA kit 5x K022-H1 PGFM EIA K022-H5 PGFM EIA 5x ADI PGJ2 EIA kit ADI-EKS-390A PKA kinase activity kit ADI-EKS-420A PKA kinase activity kit ADI Progesterone EIA kit ADI Progesterone EIA kit 5x ADI Prostacyclin (Urinary)EIA kit 5x ADI Prostacyclin(Urinary) EIA kit ADI Protein A EIA kit ADI Serotonin EIA kit ADI SOD activity kit 5x ADI spla2 activity kit ADI Substance P EIA kit ADI Substance P EIA kit 5x ADI Testosterone EIA kit ADI Testosterone EIA kit 5x ADI TXB2 EIA kit ADI TXB2(11-dehydro) EIA kit K024-H1 Urea Nitrogen (BUN) detection Kit 2x Text Colour Chemi / Bio-luminescent Assay Kits ELISA/Colorimetric Assay Kits

5 HUMAN Cat. No. AG-45A-0022EK-KI01 ACE2 ELISA Kit Product Name Pack Size AG-45A-0022PP-KI01 ACE2 ELISA Kit (Penta Plex) 5x E ADAMTS13 ELISA Kit AG-45A-0002EK-KI01 Adiponectin Competitive ELISA Kit AG-45A-0002PP-KI01 Adiponectin Competitive ELISA Kit 5x AG-45A-0001EK-KI01 Adiponectin ELISA Kit ELH-Adiponectin-001 Adiponectin ELISA Kit AG-45A-0001PP-KI01 Adiponectin ELISA Kit (Penta Plex) 5x E9510SY Adiponectin Rapid ELISA Kit ELH-Adipsin-001 Adipsin / Factor D ELISA kit E Albumin ELISA Kit E Albumin ELISA Quantitation Set A1AT-EIA Alpha1 Antitrypsin Antibody Pair set E Alpha-1-Antitrypsin ELISA Kit ELH-SAA-001 Amyloid A ( AA) ELISA kit Androstenedione EIA Kit ELH-ANG-001 Angiogenin ELISA Kit ELH-Angiopoietin1-001 Angiopoietin-1 ELISA Kit ELH-Angiopoietin2-001 Angiopoietin-2 ELISA Kit ELH-Angiostatin-001 Angiostatin ELISA Kit AG-45A-0014EK-KI01 ANGPTL3 ELISA Kit AG-45A-0015PP-KI01 ANGPTL3 Dual ELISA Kit (Penta Plex) 5x ELH-ANGPTL4-001 ANGPTL4 ELISA Kit AG-45A-0016EK-KI01 ANGPTL6 ELISA Kit ATIII-EIA Antithrombin Antibody Pair set APCAT-EIA APC-Alpha1 Antitrypsin Complex Antibody Pair set 5x APCPCI-EIA APC-Protein C Inhibitor Complex Antibody Pair set 5x APOH-EIA ELH-AR-001 Apolipoprotein-H (B2-Glycoprotein-I) Antibody Pair set AR (Amphiregulin) ELISA Kit 5x ELH-AXL-001 ELH-B2M-001 Axl ELISA Kit B2M (beta-2 Microglobulin) ELISA Kit AG-46B-0001-KI01 BAFF, Soluble Matched Pair Detection Set ADI Bax EIA kit ADI Bcl-2 EIA kit 900-K202 BD-1 ELISA Development Kit 900-M202 BD-1 ELISA Development Kit 900-K172 BD-2 ELISA Development Kit 900-K210 BD-3 ELISA Development Kit ELH-BDNF-001 BDNF ELISA Kit ELH-BTC-001 Betacellulin (BTC) ELISA kit 900-K372 Betacellulin ELISA Development Kit ELH-BLC-001 BLC ELISA Kit Blood Contamination EIA Kit 900-K255 BMP-2 ELISA Development Kit ELH-BMP4-001 BMP-4 ELISA Kit ELH-BMP4-001C BMP-4 ELISA Kit ELH-BMP6-001 BMP-6 ELISA Kit ELH-BMP7-001 BMP-7 ELISA Kit STA-501 camp ELISA Kit (Chemiluminescent) STA-500 camp ELISA Kit (Colorimetric) ELH-CT1-001 Cardiotrophin-1 (CT-1) ELISA kit Text Colour Chemi / Bio-luminescent Assay Kits ELISA/Colorimetric Assay Kits

6 HUMAN ELH-CCL CCL28 / VIC ELISA Kit ELH-CD ELH-CD ELH-CD40L-001 ELH-CEA-001 ELH-CEACAM1-001 STA-506 STA-505 APO-54N-040-KI01 AG-45A-0013EK-KI01 AG-45A-0013PP-KI K158 ELH-CNTF-001 ADI ADI ADI ELH-CRP-001 ECRPSY SKT K317 AG-45A-0031EK-KI01 AG-45A-0031PP-KI M K230 ADI CD14 ELISA kit CD40 ELISA Kit CD40L ELISA Kit CEA ELISA Kit CEACAM-1 ELISA kit cgmp ELISA Kit (Chemiluminescent) cgmp ELISA Kit (Colorimetric) Chemerin Detection Set Clusterin Competitive ELISA Kit Clusterin Competitive ELISA Kit (Penta Plex) CNTF ELISA Development Kit CNTF ELISA Kit Complement C3a des Arg EIA kit Complement C4a des Arg EIA kit Cortisol (Expanded Range) EIA Kit Cortisol (Expanded Range) EIA Kit Cotinine EIA Kit (metabolite for nicotine) Cotinine EIA Kit (metabolite for nicotine) Cotinine EIA Kit (metabolite for nicotine) COX-2 EIA kit C-Reactive Protein ELISA Kit C-Rective Protein ELISA Kit CRP Rapid ELISA Kit Crystallin(Alpha B) ELISA Kit CTGF ELISA Development Kit CTRP5 Competitive ELISA Kit CTRP5 Competitive ELISA Kit (Penta Plex) CXCL16 ELISA Development Kit CXCL-16 ELISA Development Kit Cytochrome c EIA kit 5x 5x 5x 5x 5x ELH-DAN-001 ELH-Decorin DAN ELISA kit Decorin ELISA kit DHEA EIA Kit DHEA EIA Kit 5x ADI ELH-DKK1-001 ELH-DKK3-001 ELH-DKK4-001 AG-45A-0032PP-KI01 AG-45A-0032EK-KI01 AG-45A-0027PP-KI01 AG-45A-0027EK-KI01 SKT SKT K05 ELH-EGF-001 PEL-EGFR-S DHEA EIA Kit DHEA-S EIA Kit Dkk-1 EIA kit Dkk-1 ELISA Kit Dkk-3 ELISA Kit Dkk-4 ELISA Kit DLK1, Soluble ELISA Kit DLK1, Soluble ELISA Kit DLL1, Soluble ELISA Kit DLL1, Soluble ELISA Kit DNA Damage, 8-OH-dG EIA kit DNA Damage, 8-OH-dG EIA kit EGF ELISA Development Kit EGF ELISA Kit EGFR (Ser1070) and pan EGFR(phospho) 5x 5x Text Colour Chemi / Bio-luminescent Assay Kits ELISA/Colorimetric Assay Kits

7 HUMAN PEL-EGFR-Y EGFR (Tyr1045) (phospho) PEL-EGFR-Y EGFR (Tyr1045) and pan EGFR (phospho) PEL-EGFR-Y EGFR (Tyr1068) and pan EGFR(phospho) PEL-EGFR-Y EGFR (Tyr1068)(phospho) PEL-EGFR-Y EGFR (Tyr1086) and pan EGFR(phospho) PEL-EGFR-Y EGFR (Tyr1086)(phospho) PEL-EGFR-Y EGFR (Tyr992) and pan EGFR(phospho) PEL-EGFR-Y EGFR (Tyr992)(phospho) ELH-EGFR-001 EGFR ELISA Kit 900-K244 EG-VEGF ELISA Development Kit ELH-ENA ENA78 ELISA Kit ELH-Endoglin-001 Endoglin ELISA Kit ELH-Endostatin-001 Endostatin ELISA Kit 900-K69 Eotaxin ELISA Development Kit ELH-Eotaxin2-001 Eotaxin2 ELISA Kit 900-K167 Eotaxin-3 ELISA Development Kit E3005A EPO AccuKine ELISA Kit ELH-ErbB2-001 ErbB2 / HER2 ELISA kit ELH-ErbB3-001 ErbB2 / HER2 ELISA kit ELH-Eselectin-001 E-Selectin ELISA Kit Estradiol (E2) High Sensitivity EIA Kit Estradiol (E2) High Sensitivity EIA Kit Estriol (E3) EIA Kit 5x Estriol (E3) EIA Kit 5x Estriol (E3) EIA Kit Estriol (E3) EIA Kit Estrone (E1) EIA Kit 5x Estrone (E1) EIA Kit FIX-EIA Factor IX Antibody Pair set FIX-AG Factor IX Antigen Kit 1 plate FV-EIA Factor V Antibody Pair set FVII-EIA Factor VII Antibody Pair set FVIII-AG Factor VIII Antigen kit 1 plate F8C-EIA Factor VIII:C Antibody Pair set 4 plates FX-EIA Factor X Antibody Pair set FXI-EIA Factor XI Antibody Pair set FXII-EIA Factor XII Antibody Pair set FXIII-EIA Factor XIII Antibody Pair set ELH-Fas-001 Fas ELISA Kit ELH-Fas-001C Fas ELISA Kit ELH-FASL-001 Fas Ligand ELISA Kit 900-M08 FGF ELISA Development Kit ELH-bFGF-001 FGF (Basic) ELISA Kit ELH-bFGF-001C FGF (Basic) ELISA Kit ELH-FGF4-001 FGF-4 ELISA Kit ELH-FGF4-001C FGF-4 ELISA Kit ELH-FGF6-001 FGF-6 ELISA Kit ELH-FGF7-001 FGF-7 ELISA Kit ELH-FGF9-001 FGF-9 ELISA Kit 900-K08 FGF-basic ELISA Development Kit FG-EIA Fibrinogen Antibody Pair set ELH-FLT3L K299 Flt-3L ELISA Kit Follistatin ELISA Development Kit

8 HUMAN ELH-Fractalkine-001 ELH-Galectin7-001 ADI ADI ELH-GCSF-001 E1001F 900-K ELH-GDF ELH-GDNF-001 ELH-GH-001 ELH-GITR-001 ELH-GITR-001C E ELH-GMCSF-001 E1002F 900-K AG-45A-0034EK-KI01 AG-45A-0020EK-KI01 AG-45A-0020PP-KI01 QZBGrB5 900-K38 ELH-GROalpha K120 E ELH-HBEGF-001 VPK-150 ELH-HCC4-001 ELH-hCG-001 VPK-151 E E HCII-EIA ELH-HGF-001 ELH-HGF-001C VPK-108-HIV-P24 STA-334 ADI-EKS-800 ADI SKT-106 ADI ADI-EKS-500 Fractalkine ELISA Kit Galectin 7 ELISA Kit Gastrin I EIA kit Gastrin I EIA kit G-CSF / CSF3 ELISA Kit G-CSF AccuKine ELISA Kit G-CSF ELISA Development Kit G-CSF ELISA Set GDF-15 / MIC-1 ELISA Kit GDNF ELISA kit GH ELISA Kit GITR ELISA Kit GITR ELISA Kit Glycoprotein(Beta-2 ) ELISA Kit GM-CSF / CSF2 ELISA Kit GM-CSF AccuKine ELISA Kit GM-CSF ELISA Development Kit GM-CSF Set GPX1 ELISA Kit GPX3 ELISA Kit GPX3 ELISA Kit (Penta Plex) Granzyme B activity assay Reagent Set GRO/MGSA ELISA Development Kit GRO-alpha / CXCL1 ELISA Kit Gro-beta ELISA Development Kit Haemoglobin ELISA Kit HB-EGF ELISA kit HBV Core Antigen ELISA Kit HCC-4 / CCL16 ELISA Kit hcg (intact) ELISA Kit HCV Core Antigen ELISA Kit Hemoglobin ELISA Quantitation Set Hemoglobin F ELISA Quantitation Set Heparin Cofactor II Antibody Pair set HGF ELISA Kit HGF ELISA Kit HIV Lentivirus Quantitation Kit HNE-His Adduct ELISA Kit HO-1 EIA kit HO-1 ELISA development set Hsc70 ELISA kit HSP27 [pser15]eia kit HSP27 EIA kit 5x 15x96wells 15x96wells 5x 5X 4 plates 5x SKT-109 Hsp27 ELISA Kit ADI ADI ADI-EKS-600 HSP27 high sensitivity ELISA development set HSP27[pSer78] EIA kit HSP60 EIA kit 5x ADI-EKS-650 HSP60 IgG/A/M ELISA kit ADI-EKS-750 HSP70 IgG/A/M (anti) ELISA kit ADI-EKS-725A SKT-107 ADI-EKS-895 HSP70B' EIA kit Hsp90 a ELISA kit HSP90a ELISA kit

9 HUMAN ELH-I K208 ELH-IFNgamma-001 ELH-IFNgamma-001C 900-K M27 ADI E E E E E ADI ELH-IGFBP1-001 ELH-IGFBP2-001 ELH-IGFBP3-001 ELH-IGFBP4-001 ELH-IGFBP5-001 ELH-IGFBP6-001 ELH-IGFI-001 ELH-IGF-IR-001 E ELH-IGG-001 E ELH-IGG1-001 E E ELH-IL1alpha-001 ELH-IL1alpha-001C ELH-IL1beta-001 E4101F ADI ADI ADI K21 ELH-IL ELH-IL10Rbeta-001 ELH-IL K96 ELH-IL12P ADI ADI ELH-IL ADI K M K M K277 I-309 / CCL1 ELISA Kit IBB-R ELISA Development Kit IFN gamma ELISA Kit IFN gamma ELISA Kit IFN-gamma ELISA Development Kit IFN-gamma ELISA Development Kit IFN-? EIA kit IgA ELISA Kit IgA ELISA Quantitation Set IgA(secretory) EIA Kit IgA(Sectretory) EIA Kit IgD ELISA Quantitation Set IgE ELISA Kit IgE ELISA Quantitation Set IGF-1 EIA kit IGFBP-1 ELISA Kit IGFBP-2 ELISA Kit IGFBP-3 ELISA Kit IGFBP-4 ELISA Kit IGFBP-5 ELISA Kit IGFBP-6 ELISA Kit IGF-I ELISA Kit IGF-I R ELISA Kit IgG ELISA Kit IgG ELISA Kit IgG ELISA Quantitation Set IgG1 ELISA Kit IgM ELISA Kit IgM ELISA Quantitation Set IL-1 alpha ELISA Kit IL-1 alpha ELISA Kit IL-1 beta ELISA Kit IL-10 AccuKine ELISA Kit IL-10 EIA kit IL-10 EIA kit IL-10 EIA kit IL-10 ELISA Development Kit IL-10 ELISA Kit IL-10 R beta ELISA kit IL-11 ELISA Kit IL-12 ELISA Development Kit IL-12 p70 ELISA Kit IL-12p70 EIA kit IL-13 EIA kit IL-17 ELISA Kit IL-17A EIA kit IL-17A ELISA Development Kit IL-17A ELISA Development Kit IL-17E ELISA Development Kit IL-17E ELISA Development Kit IL-17F ELISA Development Kit 5x 96wells 96wells 96wells 15x96wells 10x 5x ELH-IL17F-001 IL-17F ELISA Kit ELH-IL17R-001 IL1-7R ELISA Kit

10 HUMAN ELH-IL18BPA K11 ELH-IL1R4-001 ELH-IL1ra-001 ELH-IL1ra-001C ADI E4002F ADI A ADI ADI K M12 ELH-IL K K K246 ELH-IL28A-001 ELH-IL K13 E4003F ELH-IL K M ADI K M398 APO-54N-025-KI K14 E4004F ADI ELH-IL K15 ELH-IL5-001 E4006F ADI ADI ADI K M16 ELH-IL6-001 ELH-IL6-001C 900-K17 ELH-IL7-001 ELH-IL8-001 ELH-IL8-001C ADI ADI ADI K M K20 IL-18 BPa ELISA Kit IL-1alpha ELISA Development Kit IL-1R4 / ST2 ELISA kit IL-1ra ELISA Kit IL-1ra ELISA Kit IL-1ß EIA kit IL-2 AccuKine ELISA Kit IL-2 EIA kit IL-2 EIA kit IL-2 EIA kit IL-2 ELISA Development Kit IL-2 ELISA Development Kit IL-2 ELISA Kit IL-20 ELISA Development Kit IL-21 ELISA Development Kit IL-22 ELISA Development Kit IL-28A / IFN-lambda ELISA kit IL-29 / IFN-lambda 1 ELISA Kit IL-3 ELISA Development Kit IL-3 AccuKine ELISA Kit IL-3 ELISA kit IL-31 ELISA Development Kit IL-31 ELISA Development Kit IL-31 ELISA Set IL-33 EIA kit IL-33 ELISA Development Kit IL-33 ELISA Development Kit IL-33, Soluble Detection Set IL-4 ELISA Development Kit IL-4 AccuKine ELISA Kit IL-4 EIA kit IL-4 ELISA Kit IL-5 ELISA Development Kit IL-5 ELISA kit IL-6 AccuKine ELISA Kit IL-6 EIA kit IL-6 EIA kit IL-6 EIA kit IL-6 ELISA Development Kit IL-6 ELISA Development Kit IL-6 ELISA kit IL-6 ELISA kit IL-7 ELISA Development Kit IL-7 ELISA kit IL-8 / CXCL8 ELISA kit IL-8 / CXCL8 ELISA kit IL-8 EIA kit IL-8 EIA kit IL-8 EIA kit IL-8 ELISA Development Kit IL-8 ELISA Development Kit IL-9 ELISA Development Kit 15x96wells 10x 5x 15x96wells 15x96wells 96wells 15x96wells 10x 5x 10x 5x ELH-IL9-001 IL-9 ELISA kit

11 HUMAN ADI ImmunoSet buffer pack 5x ELH-Insulin-001 Insulin ELISA kit Interleukin-10 Set Interleukin-3 (IL-3) Set Interleukin-5 Set Interleukin-6 Set Interleukin-7 Set ELH-IP IP-10 / CXCL10 ELISA kit 900-K39 IP-10 ELISA Development Kit ELH-ITAC-001 I-TAC / CXCL11 ELISA kit 900-K151 I-TAC ELISA Development Kit E Kappa ELISA Kit E Kappa ELISA Quantitation Set KN-EIA E Kininogen Antibody Pair set Lactoferrin ELISA Kit 4 plates E Lambda ELISA Kit E Lambda ELISA Quantitation Set VPK-107 Lentivirus Titer Kit (Lentivirus-Associated HIV p24) ADI A Leptin EIA kit ELH-Leptin-001 Leptin ELISA kit ELH-LIF-001 LIF ELISA kit ELH-Light-001 LIGHT ELISA kit APO-54N-029-KI01 LIGHT, Soluble Detection Set ELH-Lymphotactin-001 Lymphotactin / XCL1 ELISA kit E8003F Lymphotoxin-a /TNF-ß AccuKine ELISA Kit 15x96wells ELH-LYVE1-001 LYVE-1 ELISA kit ELH-MCP1-001 MCP-1 / CCL2 ELISA kit 900-K31 MCP-1 ELISA Development Kit 900-K59 MCP-1 ELISA Development Kit ELH-MCP2-001 MCP-2 / CCL8 ELISA kit ELH-MCP3-001 MCP-2 / CCL8 ELISA kit ELH-MCP4-001 MCP-2 / CCL8 ELISA kit ELH-MCSF-001 M-CSF / CSF1 ELISA kit STA-332 MDA Adduct ELISA Kit ELH-MDC-001 MDC / CCL22 ELISA kit 900-K357 MIA-2 ELISA Development Kit ELH-MICB-001 MICB ELISA kit 900-K190 Midkine ELISA Development Kit ELH-MIF-001 MIF ELISA Kit ELH-MIG-001 MIG / CXCL9 ELISA kit ELH-MIP1alpha-001 MIP-1 alpha / CCL3 ELISA kit ELH-MIP1beta-001 MIP-1 beta / CCL4 ELISA kit ELH-MIP1delta-001 MIP-1 delta / CCL15 ELISA kit 900-K35 MIP-1alpha ELISA Development Kit 900-K152 MIP-2 ELISA Development Kit ELH-MIP3alpha-001 MIP-3 alpha / CCL20 ELISA kit ELH-MIP3alpha-001C MIP-3 alpha / CCL20 ELISA kit ELH-MIP3beta-001 MIP-3 beta / CCL19 ELISA kit ELH-MMP1-001 MMP-1 ELISA kit ELH-MMP1-001C MMP-1 ELISA kit ELH-MMP MMP-10 ELISA kit ELH-MMP QZBmmp2H MMP-13 ELISA kit MMP-2 activity assay

12 HUMAN ELH-MMP2-001 MMP-2 ELISA kit ELH-MMP3-001 MMP-3 ELISA kit ELH-MMP7-001 MMP-7 ELISA Kit ELH-MMP8-001 MMP-8 ELISA Kit QZBMMP9H MMP-9 activity assay ELH-MMP9-001 MMP-9 ELISA kit ELH-MPIF1-001 MPIF-1 ELISA kit ELH-MSP-001 MSP ELISA kit ADI Myeloperoxidase EIA kit AG-45A-0008EK-KI01 Nampt (Visfatin/PBEF) (IntraCellular) ELISA Kit AG-45A-0006EK-KI01 Nampt (Visfatin/PBEF) ELISA Kit AG-45A-0006PP-KI01 Nampt (Visfatin/PBEF) ELISA Kit (Penta Plex) 5x 900-K40 NAP-2 ELISA Development Kit ELH-NAP2-001 NAP-2/CXCL7 ELISA kit APO-54N-036-KI01 Nesfatin-1 Detection Set APO-54N-033-KI01 Netrin-4 Detection Set 900-K60 NGF(beta) ELISA Development Kit ELH-BNGF-001 NGF(beta) ELISA Kit 900-K338 NOV ELISA Development Kit ELH-NRG1beta1-001 NRG1-beta 1 ELISA kit ELH-NT3-001 NT-3 ELISA kit ELH-NT4-001 NT-4 ELISA kit APO-54N-026-KI01 Omentin 1 Detection Set ELH-OSM-001 Oncostatin M (OSM) ELISA kit ELH-OPN-001 Osteopontin (OPN) ELISA kit ADI Osteopontin EIA kit ADI Osteopontin ELISA development set 10x ELH-OPG-001 APO-54N-028-KI01 Osteoprotegerin (OPG) / TNFRSF11b ELISA kit Osteoprotegerin(free) Detection Set STA-320 Oxidative DNA Damage ELISA Kit (8-OHdG) STA-325 Oxidative RNA Damage ELISA Kit (8-OHG) ADI p21 EIA kit ADI p27/kip1 EIA kit 900-K383 PAI-1 ELISA Development Kit EPAISY PAI-1 ELISA Kit ELH-PARC-001 PARC ELISA kit ELH-Pcadherin-001 P-Cadherin ELISA Kit ELH-PDGFRbeta-001 PDGF R beta ELISA kit ELH-PDGFAA-001 PDGF-AA ELISA kit ELH-PDGFAB-001 PDGF-AB ELISA kit ELH-PDGFBB-001 PDGF-BB ELISA kit ELH-PDGFBB-001C PDGF-BB ELISA kit ELH-PECAM1-001 PECAM-1 ELISA kit ELH-PlGF-001 Placental Growth Factor (PlGF) ELISA kit PG-EIA Plasminogen Antibody Pair set ADI Plate (clear) (donkey anti-sheep) ELH-PF4-001 Platelet Factor-4 (PF4) / CXCL4 ELISA kit 900-K307 PLGF ELISA Development Kit PK-EIA Prekallikrein Antibody Pair set 4 plates ELH-PROCALC-001 Procalcitonin ELISA kit Progesterone EIA Kit 5x Progesterone EIA Kit 5x

13 HUMAN AG-45A-0018EK-KI01 AG-45A-0018PP-KI01 AG-45A-0019PP-KI01 BML-PW PC-EIA PCI-EIA STA-310 PS-EIA FII-EIA ELH-P-Selectin-001 ELH-RAGE-001 ELH-RANTES K M33 AG-45A-0010EK-KI01 AG-45A-0010PP-KI01 AG-45A-0012PP-KI01 ERBPSY 900-K235 AG-45A-0023EK-KI01 ELH-Resistin-001 AG-45A-0023PP-KI01 K004-H1 APO-54N-038-KI01 STA M K K34 ELH-SCF-001 ELH-SDF1alpha-001 ELH-sgp ELH-ShhN-001 ELH-sICAM1-001 ELH-Siglec5-001 AG-45A-0029EK-KI01 AG-45A-0030EK-KI K142 ADI K216 TAFI-EIA TAFI-AG ELH-TARC-001 ELH-TECK ADI ADI ELH-TGFalpha-001 Progesterone EIA Kit Progesterone EIA Kit Progesterone(17-OH) EIA Kit Progranulin ELISA Kit Gastrin I EIA kit Progranulin ELISA Kit (Penta Plex) Proteasome ELISA Kit Protein C Antibody Pair set Protein C Inhibitor Antibody Pair set Protein Carbonyl ELISA Kit (1 plate) Protein S Antibody Pair set Prothrombin Antibody Pair set P-Selectin ELISA kit RAGE / AGER ELISA kit RANTES / CCL5 ELISA kit RANTES ELISA Development Kit Rantes ELISA Development Kit RBP4 Competitive ELISA Kit RBP4 Competitive ELISA Kit (Penta Plex) RBP4 Dual ELISA Kit (Penta Plex) RBP4 Rapid ELISA Kit Resistin ELISA Development Kit Resistin ELISA Kit Resistin ELISA kit Resistin ELISA Kit (Penta Plex) Retinol Binding Protein EIA RIG-I Detection Set (IntraCellular) ROCK Activity Assay Kit scd40 ELISA Development Kit scd40 Ligand ELISA Development Kit SCF ELISA Development Kit SCF ELISA kit SDF 1 alpha ELISA kit sgp130 ELISA kit ShhN ELISA kit sicam1 ELISA kit Siglec-5 ELISA kit Sirtuin 1 (IntaCellular) ELISA Kit Sirtuin 2 (IntraCellular) ELISA Kit srank Ligand ELISA Development Kit Survivin EIA kit TACI ELISA Development Kit TAFI Antibody Pair set TAFI Antigen Kit TARC / CCL17 ELISA kit TECK / CCL25 ELISA Kit Testosterone (Expanded Range) EIA Kit Testosterone (Expanded Range) EIA Kit Testosterone (Expanded Range) EIA Kit Testosterone (Expanded Range) EIA Kit Testosterone EIA kit Testosterone EIA kit TGF-alpha ELISA kit 5x 5x 96wells 5x 5x 5x 5x 4 plates 1 plate 5x 5x 5x

14 HUMAN ELH-TGFbeta1-001 TGF-beta 1 ELISA kit ELH-TGFbeta2-001 TGF-beta 2 ELISA kit TAT-EIA Thrombin-Antithrombin Complex Antibody Pair set THCII-EIA Thrombin-Heparin Cofactor II Complex Antibody Pair set ELH-TPO-001 Thrombopoietin (TPO) ELISA kit ELH-TIE1-001 Tie-1 ELISA Kit ELH-Tie2-001 Tie-2 ELISA kit ELH-TIMP1-001 TIMP-1 ELISA kit ELH-TIMP1-001C TIMP-1 ELISA kit ELH-TIMP2-001 TIMP2 ELISA kit TPA-EIA Tissue Plasminogen Activator Antibody Pair set APO-54N-027-KI01 TL1A, Soluble ELISA Kit 900-K290 TL-1A ELISA Development Kit APO-54N-024-KI01 TL1A, Soluble Detection Set ELH-STNFRI-001 TNF Receptor 1 (soluble TNFRI) ELISA Kit ELH-STNFRII-001 TNF Receptor 2 (soluble TNFRII) ELISA Kit E8005F TNF-a AccuKine ELISA Kit 15x96wells 900-K25 TNF-alpha ELISA Development Kit 900-M25 TNF-alpha ELISA Development Kit ADI TNF-a EIA kit ADI TNF-a EIA kit 10x ADI TNF-a EIA kit 5x 900-K44 TPO ELISA Development Kit 900-K141 TRAIL ApoII Ligand ELISA Development Kit TRAIL ELISA Set ELH-TRAILR4-001 TRAIL R4 ELISA kit E Transferrin ELISA Kit E Transferrin ELISA Quantitation Set ELH-TRAPPIN2-001 Trappin-2 / Elafin ELISA Kit ELH-TREM1-001 TREM-1 ELISA kit ELH-TSH-001 TSH ELISA kit 900-K334 TSLP ELISA Development Kit ELH-TNFalpha-001 Tumor Necrosis Factor alpha ELISA kit ELH-TNFbeta-001 Tumor Necrosis Factor beta ELISA kit 900-K149 TWEAK ELISA Development Kit AG-45A-0017EK-KI01 Vaspin ELISA Kit AG-45A-0017PP-KI01 Vaspin ELISA Kit (Penta Plex) 5x ELH-VCAM1-001 VCAM-1 ELISA kit 900-K10 VEGF ELISA Development Kit ELH-VEGF-001 VEGF (VEGF-A) ELISA kit ELH-VEGF-001C VEGF (VEGF-A) ELISA kit ADI VEGF EIA kit 900-M10 VEGF ELISA Development Kit ELH-VEGFR2-001 VEGF R2 ELISA kit ELH-VEGFR3-001 VEGF R3 ELISA kit ELH-VEGFC-001 VEGF-C ELISA kit VWF-EIA von Willebrand Factor Antibody Pair set ADI XIAP EIA kit

15 MURINE (MOUSE) AG-45A-0004EK-KI01 AG-45A-0004PP-KI01 E E ELM-AR-001 MATIII-EIA ELM-AXL-001 APO-54N-013-KI01 ELM-BLC-001 ELM-CD30L-001 ELM-CD ELM-CD ELM-6Ckine-001 ELM-CRG2-001 ELM-CTACK-001 ELM-CXCL ADI ELM-Ecadherin K179 ELM-EGF K68 ELM-Eotaxin-001 ELM-Eotaxin2-001 ELM-Epiregulin-001 MFX-EIA ELM-bFGF-001 MFG-EIA ELM-Fractalkine-001 AG-45A-0025EK-KI01 AG-45A-0028EK-KI K103 ELM-GCSF-001 ELM-GMCSF K AG-45A-0021EK-KI01 AG-45A-0021PP-KI01 ELM-HGF-001 ELM-HGF-001C ADI ELM-ICAM M K98 ELM-IFNgamma-001 ELM-IFNgamma-001C ADI E E E ELM-IGFBP2-001 ELM-IGFBP5-001 ELM-IGFBP6-001 Adiponectin ELISA Kit Adiponectin ELISA Kit (Penta Plex) Albumin ELISA Kit Albumin ELISA Quantitation Set Amphiregulin ELISA kit Antithrombin Antibody Pair set Axl ELISA kit BAFF, Soluble Detection Set BLC / CCL13 ELISA kit CD30Ligand ELISA kit CD36 ELISA kit CD40 ELISA kit Ckine / CCL21 ELISA kit CRG-2 / CXCL10 ELISA kit CTACK / CCL27 ELISA kit CXCL16 ELISA kit Dkk-1EIA kit E-Cadherin ELISA kit EGF ELISA Development Kit EGF ELISA kit Eotaxin ELISA Development Kit Eotaxin ELISA kit Eotaxin-2 ELISA Kit Epiregulin ELISA kit Factor X, Antibody Pair set FGF(beta) ELISA kit Firbrinogen,Antibody Pair set Fractalkine / CX3CL1 ELISA kit FTO (IntraCellular) ELISA Kit FTO (IntraCellular) ELISA Kit G-CSF ELISA Development Kit G-CSF / CSF3 ELISA kit GM-CSF / CSF2 ELISA Kit GM-CSF ELISA Development Kit GM-CSF ELISA Set GPX3 ELISA Kit GPX3 ELISA Kit (Penta Plex) HGF ELISA kit HGF ELISA kit HO-1 ELISA development set ICAM-1 ELISA kit IFN-gamm ELISA Development Kit IFN-gamma ELISA Development Kit IFN-gamma ELISA kit IFN-gamma ELISA kit IFN-? EIA kit IgA ELISA Kit IgA ELISA Quantitation Set IgE ELISA Quantitation Set IGFBP-2 ELISA kit IGFBP-5 ELISA kit IGFBP6 ELISA kit 5x 4 plates 4 plates 4 plates 96 well strip plate 1000 well RGTs 5x 5x ELM-IGFBP3-001 IGFBP-3 ELISA kit

16 MURINE (MOUSE) 900-K170 IGF-I ELISA Development Kit ELM-IGFI-001 IGF-I ELISA kit ELM-IGFII-001 IGF-II ELISA Kit E IgG ELISA Kit E IgG ELISA Quantitation Set ADI IgG1 EIA kit E IgG1 ELISA Kit E IgG1 ELISA Quantitation Set ADI IgG2a EIA kit E IgG2a ELISA Kit E ADI IgG2a ELISA Quantitation Set IgG2b EIA kit E IgG2b ELISA Kit E IgG2b ELISA Quantitation Set E IgG2c ELISA Quantitation Set E IgG3 ELISA Quantitation Set ADI IgM EIA kit E IgM ELISA Kit E IgM ELISA Quantitation Set ELM-IL1beta-001 IL-1 beta ELISA kit ELM-IL1beta-001C IL-1 beta ELISA kit ADI IL-10 EIA kit 900-K53 IL-10 ELISA Development Kit 900-M53 IL-10 ELISA Development Kit ELM-IL IL-10 ELISA kit IL-10 ELISA Set ELM-IL IL-11 ELISA kit 900-K97 IL-12 ELISA Development Kit 900-M97 IL-12 ELISA Development Kit ELM-IL12P40/ IL-12 P40/70 ELISA kit 900-K207 IL-13 ELISA Development Kit 900-M207 IL-13 ELISA Development Kit ELM-IL IL13 ELISA kit ELM-IL IL-15 ELISA kit ELM-IL IL-17 (IL-17A) ELISA kit IL-17 Elisa Set ELM-IL17B-001 IL-17B ELISA kit 900-K82 IL-1alpha ELISA Development Kit 900-K47 IL-1beta ELISA Development Kit 900-M47 IL-1beta ELISA Development Kit ADI IL-1ß EIA kit 900-K108 IL-2 ELISA Development Kit ADI IL-2 EIA kit ELM-IL IL-2 ELISA kit IL-2 ELISA Set ELM-IL IL-21 ELISA kit ELM-IL IL-28 ELISA kit 900-K48 IL-3 ELISA Development Kit 1000 well RGTs IL-3 ELISA Set ADI IL-4 EIA kit 900-K49 IL-4 ELISA Development Kit ELM-IL4-001 IL-4 ELISA kit ELM-IL4-001C IL-4 ELISA kit

17 MURINE (MOUSE) IL-4 ELISA Set ELM-IL5-001 IL-5 ELISA kit IL-5 ELISA Set ADI IL-6 EIA kit 900-K50 IL-6 ELISA Development Kit ELM-IL6-001 IL-6 ELISA kit ELM-IL6-001C IL-6 ELISA kit IL-6 ELISA Set ELM-IL7-001 IL-7 ELISA kit ELM-IL9-001 IL-9 ELISA kit 900-K153 IP-10 ELISA Development Kit 900-M153 IP-10 ELISA Development Kit ELM-ITAC-001 I-TAC / CXCL11 ELISA kit 900-M126 JE ELISA Development Kit 900-K126 JE/MCP-1 ELISA Development Kit ELM-KC-001 KC / CXCL1 ELISA kit 900-K127 KC ELISA Development Kit 900-M127 KC ELISA Development Kit ELM-Leptin-001 Leptin (OB) ELISA kit ADI A Leptin EIA kit 900-K76 Leptin ELISA Development Kit ELM-LIX-001 LIX / CXCL5 ELISA kit ELM-Lymphotactin-001 Lymphotactin / XCL1 ELISA kit ELM-MCP1-001 MCP-1 / CCL2 ELISA kit ELM-MCP1-001C 900-K123 MCP-1 / CCL2 ELISA kit MCP-3 ELISA Development Kit ELM-MCP K245 MCP-5 / CCL12 ELISA kit M-CSF ELISA Development Kit 900-K197 MDC ELISA Development Kit ELM-MFGE8-001 MFG-E8 ELISA kit ELM-MIG-001 MIG / CXCL9 ELISA kit ELM-MIP1alpha-001 MIP-1 alpha / CCL3 ELISA kit 900-K125 MIP-1alpha ELISA Development Kit 900-K278 MIP-1beta ELISA Development Kit 900-M278 MIP-1beta ELISA Development Kit ELM-MIP2-001 MIP-2 / CXCL2 ELISA kit ELM-MIP3alpha-001 MIP-3 alpha / CCL20 ELISA kit ELM-MIP3beta-001 MIP-3 beta / CCL19 ELISA kit QZBmmp2M MMP-2 activity assay ELM-MMP2-001 MMP-2 ELISA kit ELM-MMP3-001 MMP-3 ELISA kit QZBmmp9M MMP-9 activity assay ELM-MMP9-001 MMP-9 ELISA kit ELM-OPN-001 Osteopontin (OPN) ELISA kit ELM-OPG-001 Osteoprotegerin (OPG) ELISA kit MPG-EIA Plasminogen,Antibody Pair set 4 plates ELM-PF4-001 Platelet Factor-4 (PF4) / CXCL4 ELISA kit AG-45A-0019EK-KI01 Progranulin ELISA Kit ELM-Prolactin-001 Prolactin ELISA kit ELM-Pselectin-001 P-Selectin ELISA kit ELM-RAGE-001 RAGE / AGER ELISA kit ELM-RANTES-001 RANTES / CCL5 ELISA kit 900-K124 Rantes ELISA Development Kit

18 MURINE (MOUSE) AG-45A-0024EK-KI K78 ELM-SCF-001 ELM-SDF1alpha K233 ELM-TECK-001 ELM-TPO-001 ELM-TCK1-001 ELM-TIMP1-001 ELM-TIMP1-001C ELM-TIMP K M54 Resistin ELISA Kit SCF ELISA Development Kit SCF ELISA kit SDF-1 alpha / CXCL12 alpha ELISA kit srank-ligand ELISA Development Kit TECK / CCL25 ELISA kit Thrombopoietin (TPO) ELISA kit Thymus Chemokine-1 / CXCL7 ELISA kit TIMP-1 ELISA kit TIMP-1 ELISA kit TIMP-2 ELISA kit TNF-alpha ELISA Development Kit TNF-alpha ELISA Development Kit ADI TNF-a EIA kit ELM-TRANCE-001 E ELM-TNFalpha-001 ELM-VCAM1-001 ELM-VEGF-001 ELM-VEGF-001C 900-K99 ELM-VEGFR1-001 TRANCE ELISA kit Transferrin ELISA Kit Tumor Necrosis Factor alpha ELISA kit VCAM-1 ELISA kit VEGF (VEGF-A) ELISA kit VEGF (VEGF-A) ELISA kit VEGF ELISA Development Kit VEGFR1 ELISA kits RAT AG-45A-0005EK-KI01 AG-45A-0005PP-KI01 E ADI ELR-CNTF-001 ADI ELR-FasL-001 ELR-Fractalkine-001 ELR-Fractalkine-001C ADI ELR-GMCSF-001 ADI K57 ADI-EKS-810A ADI ELR-ICAM K109 E E E E E E E E K91 ELR-IL1beta-001 ELR-IL1beta-001C ELR-IL Adiponectin ELISA Kit Adiponectin ELISA Kit (Penta Plex) Albumin ELISA Quantitation Set Big Endothelin-1 EIA kit CNTF ELISA kit Dkk-1 EIA kit Fas Ligand ELISA kit Fractalkine ELISA kit Fractalkine ELISA kit Gastrin I EIA kit GM-CSF / CSF2ELISA kit GRO/CINC-1 EIA kit Gro/KC ELISA Development Kit HO-1 EIA kit HO-1 ELISA development set ICAM-1 ELISA kit IFN-gamma ELISA Development Kit IgA ELISA Quantitation Set IgE ELISA Quantitation Set IgG ELISA Quantitation Set IgG1 ELISA Quantitation Set IgG2a ELISA Quantitation Set IgG2b ELISA Quantitation Set IgG2c ELISA Quantitation Set IgM ELISA Quantitation Set IL-1 beta ELISA Development Kit IL-1 beta ELISA kit IL-1 beta ELISA kit IL-10 ELISA kit 5x 5x 1000 Wells

19 RAT ELR-IL10-001C ELR-IL13-001C 900-K204 ADI ELR-IL2-001 ELR-IL4-001 ELR-IL4-001C 900-K M86 ELR-IL6-001 ADI ADI A ELR-Leptin-001 ELR-LIX-001 ELR-LIX-001C ELR-LSelectin-001 ELR-MCP1-001 ELR-MCP1-001C ADI K75 ELR-MMP8-001 ELR-bNGF-001 ELR-RAGE K72 IL-10 ELISA kit IL-13 ELISA kit IL-1alpha ELISA Development Kit IL-1ß EIA kit IL-2 ELISA kit IL-4 ELISA kit IL-4 ELISA kit IL-6 ELISA Development Kit IL-6 ELISA Development Kit IL-6 ELISA kits ImmunoSet plate pack Leptin EIA kit Leptin ELISA kit LIX / CXCL5 ELISA kit LIX / CXCL5 ELISA kit L-Selectin ELISA kit MCP-1 / CCL2 ELISA kit MCP-1 / CCL2 ELISA kit MCP-1 EIA kit MIP-1alpha ELISA Development Kit MMP-8 ELISA kit NGF(Beta) ELISA kit RAGE / AGER ELISA kit Rantes ELISA Development Kit 5x 900-K258 SCF ELISA Development Kit ELR-TCK1-001 Thymus Chemokine-1 / CXCL7 ELISA kit ELR-TIMP1-001 TIMP-1 ELISA kit ELR-TIMP1-001C TIMP-1 ELISA kit 900-K73 TNF-alpha ELISA Development Kit ADI A ELR-TNFalpha-001 ELR-TNFalpha-001C ELR-VEGF-001 ELR-VEGF-001C TNF-a EIA kit Tumor Necrosis Factor alpha ELISA kit Tumor Necrosis Factor alpha ELISA kit VEGF (VEGF-A) ELISA kit VEGF (VEGF-A) ELISA kit RABBIT RBFG-EIA E E Fibrinogen,Antibody Pair set IgG ELISA Kit IgG ELISA Quantitation Set 4 plates E IgM ELISA Quantitation Set BOVINE E E VS0083B-002 VS0253B-002 E VS0257B-002 E E E Albumin ELISA Quantitation Set CCL2 ELISA Kit CCL2 VetSet CXCL9 (MIG) VetSet CXCL9 ELISA Kit IFN gamma VetSet IFN-gamma ELISA Kit IgA ELISA Kit IgA ELISA Quantitation Set

20 BOVINE E E E E E E E E E VS0148B-002 VS0284B-002 E E E E VS0285B-002 E VS0286B-002 IgG ELISA Kit IgG ELISA Quantitation Set IgG1 ELISA Kit IgG1 ELISA Quantitation Set IgG2 ELISA Kit IgG2 ELISA Quantitation Set IgM ELISA Kit IgM ELISA Quantitation Set IL-13 ELISA Kit IL-13 VetSet IL-17A VetSet Lactalbumin(alpha) ELISA Quantitation Set Lactoferrin ELISA Kit Lactoferrin ELISA Quantitation Set Lactoglobulin(beta) ELISA Quantitation Set TNF alpha VetSet Transferrin ELISA Quantitation Set VEGF-A VetSet SWINE (PIG) E Albumin ELISA Kit E E VS0081S-002 VS0259S-002 E E E E E E E ELP-IL1beta-001 E VS0084S-002 E VS0260S-002 ELP-IL6-001 E VS0254S-002 ELP-TNFalpha-001 Albumin ELISA Quantitation Set CCL2 ELISA Kit CCL2 VetSet IFN gamma VetSet IFN-gamma ELISA Kit IgA ELISA Kit IgA ELISA Quantitation Set IgG ELISA Kit IgG ELISA Quantitation Set IgM ELISA Kit IgM ELISA Quantitation Set IL-1 beta / IL-1F2 ELISA kit IL-13 ELISA Kit IL-13 VetSet IL-17A ELISA Kit IL-17A VetSet IL-6 ELISA kit IL-8 ELISA Kit IL-8 VetSet Tumor Necrosis Factor alpha ELISA kit GOAT E103 E E E ADI ADI ADI ELISA Starter Accessory Kit II IgA ELISA Quantitation Set IgG ELISA Quantitation Set IgM ELISA Quantitation Set Plate (clear) (goat anti-mouse) Plate (clear) (goat anti-rabbit) Plate (clear) (goat anti-rabbit) 10x

21 EQUINE (HORSE) VS0287E-002 E E E E E E VS0131E-002 E VS0067E-002 TIMP-1 ELISA kit TIMP-1 ELISA kit TNF-alpha ELISA Development Kit TNF-a EIA kit Tumor Necrosis Factor alpha ELISA kit Tumor Necrosis Factor alpha ELISA kit VEGF (VEGF-A) ELISA kit VEGF (VEGF-A) ELISA kit IL-2 ELISA Kit IL-2 VetSet FELINE (CAT) VPK-108-FIV-P24 VS0288F-002 E E E E VS0105F-002 FIV Lentivirus Quantitation Kit IFN gamma VetSet IgA ELISA Quantitation Set IgG ELISA Quantitation Set IgM ELISA Quantitation Set IL-2 ELISA Kit IL-2 VetSet CANINE (DOG) CFIX-EIA Factor IX, Antibody Pair set 4x CFVIII-EIA E Factor VIII:C, Antibody Pair set IgA ELISA Quantitation Set 4x E E E E IgE ELISA Quantitation Set IgG ELISA Kit IgG ELISA Quantitation Set IgG1 ELISA Quantitation Set E IgG2 ELISA Quantitation Set E IgM ELISA Quantitation Set E IL-1 beta ELISA Kit VS0130D-002 IL-1 beta VetSet E IL-2 ELISA Kit VS0258D-002 IL-2 VetSet CHICKEN E E E E VS0082C-002 IgA ELISA Quantitation Set IgG ELISA Quantitation Set IgM ELISA Quantitation Set IL-16 ELISA Kit IL-16 VetSet LISTERIA MONOCYTOGENES AG-45A-0026EK-KI01 Listeria monocytogenes SURE mono ELISA Kit MULTI SPECIES AG-45A-0003EK-KI01 Adiponectin Competitive ELISA Kit (Rhesus mk, Maquaque) EIA-ACRP-1 Adiponectin EIA Kit (Hu, Ms, Rt) ALX KI01 ADMA Direct ELISA Kit (Rt, Ms) Hu Ms Human Mouse Rt Bo Rat Bovine Cw Dg Cow Dog Rb Mu Rabbit Murine D Rhs Mnky Donkey Rhesus Monkey

22 MULTI SPECIES EIA-ADPN-1 PEL-Akt-S PEL-Akt-S MKA 009 MKA 002 ADI EIA-ANGII-1 AG-45A-0015EK-KI01 EIA-ANP-1 EIA-APC-1 ADI EIA-CART-1 MKA 004 ADI MKA 006 ADI APO-54N-023-KI PEL-EGFR-S ADI A MKA 005 ADI ADI PEL-Erk-T PEL-Erk-T EIA-GHR-1 ADI ADI MKA 003 MKA 008 ADI A ADI ADI ADI ADI ADI-EKS-700B ADI-EKS-715 ADI PEL-Mek-S PEL-Mek-S ADI A ADI PEL-Met-Y ADPN EIA Kit (Hu, Ms, Rt) Akt (Ser473) and pan Akt(phospho) (Hu, Ms, Rt) Akt (Ser473)(phospho) (Hu, Ms, Rt) Akt, Akt2, GSK3alpha & GSK3beta ELISA (Hu, Ms, Rt) AKT1 (ps473) AKT2 (ps474) ELISA (Hu, Ms, Rt) Akt1/2[pSer473] EIA kit (Hu, Ms, Rt) Angiotensin II EIA Kit (Hu, Ms, Rt) ANGPTL3 Dual ELISA Kit (Rt, Ms) ANP EIA Kit (Hu, Ms, Rt) Apelin EIA Kit (Hu, Ms, Rt) Big Endothelin-1 EIA kit (Hu, Rb) Blood Contamination EIA Kit (Hu, Ms, Rt) CART EIA Kit (Hu, Ms, Rt) Catenin(beta) Dephospho (DP S33/S37/T41) ELISA (Hu, Ms, Rt) Catenin(ß) EIA kit (Hu, Ms, Rt) Cortisol (Expanded Range) EIA Kit (Hu, Ms, Rt) Cortisol (Expanded Range) EIA Kit (Hu, Ms, Rt) Cotinine EIA Kit (metabolite for nicotine) (Hu, Ms, Rt) C-Reactive Protein ELISA Kit (Hu, Ms, Rt) CREB (ps133) ELISA (Hu, Ms, Rt) Crystallin(aB) ELISA development set (Hu, Ms, Rt, Cw) CTRP7, Soluble Detection Set ( Hu, Mu) DHEA EIA Kit (Hu, Ms, Rt) DHEA-S EIA Kit (Hu, Ms, Rt) EGFR (Ser1070)(phospho) (Hu, Ms, Rt) Endothelin-1 EIA kit (Hu, Ms, Rt, Dg, Pig, Rb) ERK1/2 (pt202/y204; pt185/y187) ELISA (Hu, Ms, Rt) Erk1/2 [pthr202/tyr204]eia kit (Hu, Ms, Rt) Erk1/2 EIA kit (Hu, Ms, Rt) Erk1/Erk2 and pan Erk1/2(phospho) (Hu, Ms, Rt) Erk1/Erk2(phospho) (Hu, Ms, Rt) Estradiol (E2) High Sensitivity EIA Kit (Hu, Ms, Rt) Estradiol (E2) High Sensitivity EIA Kit (Hu, Ms, Rt) Ghrelin EIA Kit (Hu, Ms, Rt) Grp75 ELISA development set (Hu, Ms, Rt) Grp94 ELISA development set (Hu, Ms, Rt, Dg) GSK3alpha (ps21) & GSK3beta (ps9) ELISA (Hu, Ms, Rt) GSK3alpha, GSK3beta & Beta-Catenin ELISA (Hu, Ms, Rt) GSK-3ß [pser9]eia kit (Hu, Ms, Rt) GSK-3ß EIA kit (Hu, Rt) HSF1 [pser326]eia kit (Hu, Ms) HSF1 EIA kit (Hu, Ms) HSP25 ELISA development set (Rt, Ms) HSP70 EIA kit (Hu, Ms, Rt) HSP70 high sensitivity EIA kit (Hu, Ms, Rt) Jnk1/2[pThr183/Tyr185] EIA kit (Hu, Ms, Rt) Mek1 (Ser217/221) and pan Mek(phospho) (Hu, Ms, Rt) Mek1 (Ser217/221)(phospho) (Hu, Ms, Rt) MEK1 EIA kit (Hu, Rt) MEK1[pSer218/Ser222] EIA kit (Hu, Ms, Rt) Met (Tyr1234) and pan Mek(phospho) (Hu, Ms) 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x Hu Ms Human Mouse Rt Bo Rat Bovine Cw Dg Cow Dog Rb Mu Rabbit Murine D Rhs Mnky Donkey Rhesus Monkey

23 MULTI SPECIES PEL-Met-Y MKA 001 AG-45A-0009EK-KI01 AG-45A-0007EK-KI01 AG-45A-0007PP-KI01 EIA-NES-1 EIA-NPY-1 ADI A Met (Tyr1234) (phospho) (Hu, Ms) Multi-Kinase ELISA (Six Kinases of choice) (Hu, Ms, Rt) Nampt (Visfatin/PBEF) (IntraCellular) Dual ELISA Kit (Rt, Ms) Nampt (Visfatin/PBEF) Dual ELISA Kit (Rt, Ms) Nampt (Visfatin/PBEF) Dual ELISA Kit (Penta Plex) (Rt, Ms) Nesfatin EIA Kit (Hu, Ms, Rt) NPY EIA Kit (Hu, Ms, Rt) Osteopontin EIA kit (Ms, Rt) 5x ADI p38 [pthr180/tyr182]eia kit (Hu, Ms) MKA 007 p38 alpha (pt180/y182) ELISA (Hu, Ms, Rt) PEL-P38-T P38 alpha (Thr180/Tyr182) and pan P38 (phospho) (Hu, Ms) PEL-P38-T P38 alpha (Thr180/Tyr182) (phospho) (Hu, Ms) ADI p53/mdm2 complex ELISA development set (Hu, Ms, Rt) 5x 900-K04 ADI ADI EIA-pGLU-1 ALX KI01 EIA-PYY-1 AG-45A-0012EK-KI01 EIA-RELA-1 KU04-H1 ADI PEL-Stat1-S PEL-Stat1-S PEL-Stat1-Y PEL-Stat1-Y PEL-Stat3-Y PEL-Stat3-Y ADI EIA-VAP-1 EIA-VIS-1 PDGF-BB ELISA Development Kit (Hu, Ms) PDI ELISA development set (Hu, Ms, Rt) Pin1 EIA kit (Hu, Ms) ProGlucagon EIA Kit (Hu, Ms, Rt) PTX3 Detection Set (Hu, Bo) PYY EIA Kit (Hu, Ms, Rt) RBP4 Dual ELISA Kit (Hu, Rb) RELA EIA Kit (Hu, Ms, Rt) Retinol Binding Protein (Urinary) Kit (Hu, Rt, D & Rhs Mnky) SMN EIA kit (Hu, Ms) Stat1 (Ser727) and pan Stat1(phospho) (Hu, Ms) Stat1 (Ser727) (phospho) (Hu, Ms) Stat1 (Tyr701) and pan Stat1(phospho) (Hu, Ms) Stat1 (Tyr701) (phospho) (Hu, Ms) Stat3 (Tyr705) and pan Stat3 (phospho) (Hu, Ms, Rt) Stat3 (Tyr705) (phospho) (Hu, Ms, Rt) TGF-ß1 EIA kit (Hu, Ms, Rt, Cw) Vaspin EIA Kit (Hu, Ms, Rt) Visfatin EIA Kit (Hu, Ms, Rt) 5x Disclaimer : We have tried our best to avoid errors while preparing this brochure. However, it is strongly advised to ask for detailed product insert of the manufacturer for confirmation. The company does not take any responsibility for any damages as a result of any errors or oversight. Hu Ms Human Mouse Rt Bo Rat Bovine Cw Dg Cow Dog Rb Mu Rabbit Murine D Rhs Mnky Donkey Rhesus Monkey

24 Now search products online on TM Imported & Marketed in India by: Biogenuix Medsystems Pvt. Ltd. Head Office: 412-B, Jyoti Shikhar Building, District Center, Janakpuri, New Delhi Phone: Fax: Web.: BMS/ASSAY KITS/SEP-2011 V-1

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

细胞因子绝对定量检测 RayBio 平面型抗体芯片

细胞因子绝对定量检测 RayBio 平面型抗体芯片 细胞因子绝对定量检测 RayBio 平面型抗体芯片 RayBio 细胞因子定量检测抗体芯片技术服务 ()I Catalog duct Species QAH-ADI- y Obesity IGF-I, IL- alpha, IL-6, IL-8, Insulin, Leptin, MCP-, PAI-, Adipokines Resistin, TNF alpha QAH-ADI-2 y Obesity

More information

Dilution Factor Serum Plasma Urine CSF (Other)

Dilution Factor Serum Plasma Urine CSF (Other) R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations

More information

Human Cytokine Antibody Array

Human Cytokine Antibody Array Li StarFish S.r.l. Via Cavour, 35-20063 Cernusco S/N (MI), Italy Tel. +39-02-92150794 - Fax. +39-02-92157285 info@listarfish.it -www.listarfish.it Human Cytokine Antibody Array Patent Pending Technology

More information

Multiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex

Multiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex Multiplex Suspension Arrays NF-kβ p65 TGF-β1 c-jun Smad2 EGF IL-17A/F Akt IGF-IR Stat1 MEK1 IL-12p70 Bio-Plex Multiplex Immunoassays Analyte Guide Summer 2014 2014 Bio-Rad Laboratories, Inc. The Power

More information

ProcartaPlex multiplex immunoassays for the Luminex platform

ProcartaPlex multiplex immunoassays for the Luminex platform ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate

More information

LEGENDplex Multi-Analyte Flow Assay Kits

LEGENDplex Multi-Analyte Flow Assay Kits LEGENDplex Multi-Analyte Flow Assay Kits BioLegend is ISO 9001:2008 and ISO 13485:2003 Certified 02-0009-03 World-Class Quality Superior Customer Support Outstanding Value LEGENDplex Multi-Analyte Flow

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

RayBiotech, Inc. RayBio Mouse Cytokine Antibody Array. Please read manual carefully before starting experiment. Patent Pending Technology

RayBiotech, Inc. RayBio Mouse Cytokine Antibody Array. Please read manual carefully before starting experiment. Patent Pending Technology RayBio Mouse Cytokine Antibody Array Patent Pending Technology User Manual (Revised June 14, 2009) RayBio Mouse Cytokine Antibody Array 1 (Cat# AAM-CYT-1) RayBio Mouse Cytokine Antibody Array 2 (Cat# AAM-CYT-2)

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

WideScreen BeadPlex Multiplex Assays. Spring 2010

WideScreen BeadPlex Multiplex Assays. Spring 2010 WideScreen BeadPlex Multiplex Assays Spring 2010 Cancer Panels Cancer Biomarkers Cancer Panel 1 (Biomarkers) Cancer Panel 2 (Growth Factors) MMP Panel Cat No: BPHCP001-6 CA 125 CEA (Carcinoembryonic Antigen)

More information

RayBio Human Thyroglobulin ELISA Kit

RayBio Human Thyroglobulin ELISA Kit RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman D15001 C-60014 Angiopoietin 1 (HeLa cell-derived), (Ang-1), rhuman 20 µg 32,000 D15002 C-60016 Apolipoprotein A1, (APO-A1), rhuman 100 µg 32,000 D15003 C-60017 Apolipoprotein E2, (APO-E2), rhuman 500 µg

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

ProcartaPlex Multiplex Immunoassays

ProcartaPlex Multiplex Immunoassays ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a

More information

Immunoassays LEGENDplex & ELISA Kits

Immunoassays LEGENDplex & ELISA Kits Immunoassays LEGENDplex & ELISA Kits BioLegend is ISO 13485:2003 Certified Toll-Free Tel: (US & Canada): 1.877.BIOLEGEND (246.5343) Tel: 858.768.5800 biolegend.com 02-0017-00 World-Class Quality Superior

More information

Activated mast cells promote differentiation of B cells into effector cells

Activated mast cells promote differentiation of B cells into effector cells Supplementary,information, Activated mast cells promote differentiation of B cells into effector cells Anna-Karin E. Palm 1, Gianni Garcia Faroldi 2, Marcus Lundberg 1, Gunnar Pejler 3, 2 and Sandra Kleinau

More information

2018/2019 Catalog ReliaTech GmbH 2018/2019. Catalog

2018/2019 Catalog ReliaTech GmbH 2018/2019. Catalog 2018/2019 Catalog ReliaTech GmbH 2018/2019 Catalog +49-5331-8586 987 +49-5331-8586 989 www.reliatech.de orders@reliatech.de A B mouse anti-human CD31 rabbit anti-human EGFR C D CD31/EGFR control Double

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

LIST OF AVAILABLE ASSAYS. Methods/Platforms. Biomarkers Core Laboratory 622 West 168th Street PH New York, NY

LIST OF AVAILABLE ASSAYS. Methods/Platforms. Biomarkers Core Laboratory 622 West 168th Street PH New York, NY Biomarkers Core Laboratory 622 West 168th Street PH10-105 New York, NY 10032 212.305.9306 Tel LIST OF AVAILABLE ASSAYS Assay Methods/Platforms 25 hydroxy Vitamin D2, D3 3-Aminopropanol Acetoacetate ACY-1215

More information

Biomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia

Biomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia Biomarkers in drug discovery and development Margit Wissenbach, PhD Dir Business Development Scandinavia Aptuit: A Truly Integrated R&D Offering Integrated Discovery Integrated Development IND Candidate

More information

TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC. CONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA

TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC. CONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA AD Award Number: W81XWH-10-1-0433 TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC PRINCIPAL INVESTIGATOR: Elahna Paul, M.D., Ph.D. CONTRACTING ORGANIZATION: Massachusetts General Hospital

More information

FY18 Biomarkers Core Lab Price List

FY18 Biomarkers Core Lab Price List ** *** Sample Processing - Lvl. 1 (< 15 min.) $16.75 $16.75 Sample Processing - Lvl. 2 (15-30 min.) $27.75 $27.75 Sample Processing - Lvl. 3 (30-60 min.) $50.00 $50.00 Sample Processing - Lvl. 4 (60 min.

More information

Instant ELISA Kits. Accelerate Time to Result

Instant ELISA Kits. Accelerate Time to Result Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

Data Package. Multiplex Oncology I 96 96

Data Package. Multiplex Oncology I 96 96 Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection

More information

2017 Price List. Published by: PeproTech, INC. Rocky Hill, New Jersey USA

2017 Price List. Published by: PeproTech, INC. Rocky Hill, New Jersey USA 2014 Price List 2017 Price List Published by: PeproTech, INC. Rocky Hill, New Jersey USA Toll Free Number (in the United States) (800) 436-9910 (609) 497-0253 Fax Orders (609) 497-0321 1 PEPROTECH Ordering

More information

25 years of research excelence

25 years of research excelence Crystal Chem full product catalog 25 years of research excelence We're poud to be one of the top providers of research assays for the last 25 years product catalog See our full line of high quality assays

More information

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,

More information

OUR QUALITY YOUR DEDICATION PRICE LIST

OUR QUALITY YOUR DEDICATION PRICE LIST PRICE LIST 2018 Price List 2018 Price List Published by: PeproTech, INC. Rocky Hill, New Jersey USA PEPROTECH Ordering Information Hours of Operation: Extended hours from 8:00 AM to 8:00 PM (Eastern Standard

More information

Polyclonal Secondary Antibodies

Polyclonal Secondary Antibodies Polyclonal Secondary Antibodies Quality Antibodies for Quality Research Mouse Ig Goat Human Ig 1010 Ig Goat F(ab ) 2 Human Ig 1012 IgA Goat 1040 IgE Goat 1110 IgG Goat Human Ig 1030 IgG Fab Goat 1015 IgG

More information

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:

More information

Antibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg

Antibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg JAK/STAT Signaling The JAK/STAT signaling pathway transmits a signal from outside the cell eventually resulting in DNA transcription and activity in the cell. Leptin (a product of the obese gene) can induce

More information

RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit

RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit Patent Pending Technology User Manual (Revised August 8, 2017) For the simultaneous detection of the relative expression of 308 (L-308)

More information

Types of target values, acceptable ranges

Types of target values, acceptable ranges Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10

More information

Assured Quality Technically Supported Competitive Costs Customization

Assured Quality Technically Supported Competitive Costs Customization Multi-Analyte Flow Assay Kits IL-6 Protein Structure Assured Quality Technically Supported Competitive Costs Customization KRISHGEN BIOSYSTEMS Unit Nos#318/319, Shah & Nahar, Off Dr E Moses Road, Worli,

More information

PRODUCT LIST 2018 Immunoassays RIA, IRMA, REA

PRODUCT LIST 2018 Immunoassays RIA, IRMA, REA PRODUCT LIST 2018 Immunoassays RIA, IRMA, REA REPRODUCTIVE - FERTILITY REPRODUCTIVE ANDROGENS Androstanediol glucuronide DSL9200 RIA CT 100 185 Androstenedione IM0674 RIA CT 100 185 Androstenedione DSL3800

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

PEPROTECH. Manufacturer of Quality Cytokine Products. Published by PeproTech Inc. Rocky Hill, New Jersey USA

PEPROTECH. Manufacturer of Quality Cytokine Products.   Published by PeproTech Inc. Rocky Hill, New Jersey USA PEPROTECH Manufacturer of Quality Cytokine Products Published by PeproTech Inc. Rocky Hill, New Jersey USA Copyright 2011 by PeproTech Inc. 1 2011-2012 2 PEPROTECH 用 力力 立立 大 虫 白 用 高 長 大 高 力力 大 士 力力 3 2011-2012

More information

Cytokine Profiling in Human Colostrum and Milk by Protein Array

Cytokine Profiling in Human Colostrum and Milk by Protein Array Papers in Press. Published March 15, 2007 as doi:10.1373/clinchem.2006.077107 The latest version is at http://www.clinchem.org/cgi/doi/10.1373/clinchem.2006.077107 Clinical Chemistry 53:5 000 000 (2007)

More information

Immunology Research Related Cytokine Products

Immunology Research Related Cytokine Products Immunology Research Related Cytokine Products Copyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ 08553-0275 Tel: (800) 436-9910 (609) 497-0253 Fax: (609) 497-0321 email:

More information

PRODUCT LIST 2011 Immunoassays RIA, IRMA, REA

PRODUCT LIST 2011 Immunoassays RIA, IRMA, REA PRODUCT LIST 2011 Immunoassays RIA, IRMA, REA REPRODUCTIVE ANDROGENS Androstanediol glucuronide DSL9200 RIA CT 100 185 Androstenedione IM0674 RIA CT 100 185 Androstenedione DSL3800 RIA CT 100 185 DHEA

More information

Bead Chemiluminescense IMMULITE 2000, 2000 XPI & 2500

Bead Chemiluminescense IMMULITE 2000, 2000 XPI & 2500 Bead Chemiluminescense IMMULITE 2000, 2000 XPI & 2500 For internal use only / Copyright Siemens AG 2006. All rights reserved. المانھای مھم در روشھای کميلومينسانس: کميلومينسانسر مرحله جداسازی.1.2 Page 2

More information

Circulating Levels of Inflammatory Proteins and Survival in Patients with

Circulating Levels of Inflammatory Proteins and Survival in Patients with Circulating Levels of Inflammatory Proteins and Survival in Patients with Gallbladder Cancer Zhiwei Liu 1 *, Troy J. Kemp 2, Yu-Tang Gao 3, Amanda Corbel 1, Emma E. McGee 1, Juan Carlos Roa 4,5, Bingsheng

More information

ab Thyroglobulin Human ELISA Kit

ab Thyroglobulin Human ELISA Kit ab155441 Thyroglobulin Human ELISA Kit Instructions for Use For the quantitative measurement of Human Thyrogobulin in serum, plasma and cell culture supernatants. This product is for research use only

More information

BioLegend 12 月新製品. Cross-Reactivity: Rabbit (Lapine), Guinea. Monkey, Chimpanzee, Cynomolgus, Pigtailed FC 100 tests 52,000

BioLegend 12 月新製品. Cross-Reactivity: Rabbit (Lapine), Guinea. Monkey, Chimpanzee, Cynomolgus, Pigtailed FC 100 tests 52,000 BioLegend 12 月新製品 カタログ番号 製品名 クローン 反応種 アプリケーション サイズ 定価 105845 Alexa Fluor 700 anti-mouse CD117 (c-kit) 2B8 Mouse FC 25 μg 17,000 105846 Alexa Fluor 700 anti-mouse CD117 (c-kit) 2B8 Mouse FC 100 μg 39,000

More information

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma P909 Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma Tedeschi R, Bidoli E 2, Bortolin MT, Pratesi C, Basaglia G, Zanussi

More information

LANCE and LANCE Ultra TR-FRET Technology Product List

LANCE and LANCE Ultra TR-FRET Technology Product List LANCE and LANCE Ultra TR-FRET Technology Product List ORDERING INFORMATION Please refer to the following for ordering LANCE TR-FRET and LANCE Ultra TR-FRET products. LANCE TR-FRET and LANCE Ultra TR-FRET

More information

Speciality and Research Controls

Speciality and Research Controls Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter

More information

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension.

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully

More information

MAGLUMI 1000 MAGLUMI 1000

MAGLUMI 1000 MAGLUMI 1000 MAGLUMI 1000 Outstanding Technology Power of MAGLUMI Chemiluminescence Immunoassay (CLIA) System CLIA uses two important technologies, one is labeling technology which determines reaction mode; and the

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Nori Rabbit IL-2 ELISA Kit DataSheet

Nori Rabbit IL-2 ELISA Kit DataSheet Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the

More information

Immunoassay. Product Portfolio. Part of the IDS group

Immunoassay. Product Portfolio.   Part of the IDS group Immunoassay Portfolio www.diametra.com info_diametra@idsplc.com Part of the IDS group Our Portfolio Cost-Effective Solutions for your Laboratory. All DiaMetra immunoassay kits in breakable well format.

More information

DATA PACKAGE. Multiplex CVD I 96 96

DATA PACKAGE. Multiplex CVD I 96 96 DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Introduction to coagulation and laboratory tests

Introduction to coagulation and laboratory tests Introduction to coagulation and laboratory tests Marc Jacquemin Special Haemostasis Laboratory Center for Molecular and Vascular Biology University of Leuven Coagulation in a blood vessel: fibrin stabilises

More information

Multiplex assays for biomarkers research & clinical application

Multiplex assays for biomarkers research & clinical application Multiplex assays for biomarkers research & clinical application The Multiplex Technology The study of a unique biomarker does not generate sufficient contributions to advance in the clinical research of

More information

PROCESSING INSTRUCTIONS FOR BRAC TESTS. PROCESSING SPECIFICATIONS Storage 5. Centrifuge Temp ( C) 10 mins. Alternate Draw Tube.

PROCESSING INSTRUCTIONS FOR BRAC TESTS. PROCESSING SPECIFICATIONS Storage 5. Centrifuge Temp ( C) 10 mins. Alternate Draw Tube. Preferred Amount of Blood (ml) Amount of Blood (ml) PROCESSING INSTRUCTIONS FOR BRAC TESTS Preferred Draw PROCESSING SPECIFICATIONS Storage 5 Alternate Draw Centrifuge 10 mins Preferred Aliquot (ml) Aliquot

More information

T cell-mediated immunity

T cell-mediated immunity T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating

More information

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it. Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2

More information

qpcr-array Analysis Service

qpcr-array Analysis Service qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

More information

Minimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections

Minimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections The following table outlines the minimum whole blood volume that must be drawn into a microcollection tube (unless otherwise stated) for an individual test on a neonate, pediatric, patient weighing less

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

STI and BV prevalence in young women in Cape Town and Soweto

STI and BV prevalence in young women in Cape Town and Soweto STI and BV prevalence in young women in Cape Town and Soweto Shaun Barnabas Genital Mucosal and STI lab Desmond Tutu HIV Foundation University of Cape Town FAMCRU University of Stellenbosch WISH: Women

More information

U N I V E R S I T Ä T S M E D I Z I N B E R L I N

U N I V E R S I T Ä T S M E D I Z I N B E R L I N U N I V E R S I T Ä T S M E D I Z I N B E R L I N Chronic Urticaria: the role of mast cells and basophils Marcus Maurer Allergie-Centrum-Charité Department of Dermatology and Allergy Charité - Universitätsmedizin

More information

U-PLEX Custom Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES.

U-PLEX Custom Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES. U-PLEX Custom Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES. 17379-v1-2007Mar MSD U-PLEX Platform U-PLEX Custom Metabolic Group 1

More information

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with:

WSLH. Calibration Verification/ Linearity Products. roficiency. esting. Products provided in partnership with: WSLH PT roficiency esting Calibration Verification/ Linearity Products Products provided in partnership with: www.wslhpt.org 800-462-5261 PTService@slh.wisc.edu General Chemistry Ammonia/Ethanol - 5 x

More information

Reproductive Endocrinology

Reproductive Endocrinology Reproductive Endocrinology Reproductive Endocrinology Hypothalamic hormones Gonadotropin releasing hormone (GnRH) - stimulate release of FSH = follicle stimulating hormone LH = luteinizing hormone from

More information

L iter diagnostico di laboratorio nelle coagulopatie congenite emorragiche

L iter diagnostico di laboratorio nelle coagulopatie congenite emorragiche L iter diagnostico di laboratorio nelle coagulopatie congenite emorragiche Armando Tripodi Angelo Bianchi Bonomi Hemophilia and Thrombosis Center Dept. of Clinical Sciences and Community Health University

More information

Cytokine (Human) Antibody Array

Cytokine (Human) Antibody Array Cytokine (Human) Antibody Array Catalog Number AA0077 4 Samples/Slide Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Cytokine 56 (2011) Contents lists available at SciVerse ScienceDirect. Cytokine

Cytokine 56 (2011) Contents lists available at SciVerse ScienceDirect. Cytokine Cytokine 56 (211) 641 647 Contents lists available at SciVerse ScienceDirect Cytokine journal homepage: www. elsevier. com/ locate/ is sn/ 1434666 Macrophage Colony Stimulating Factor and Monocyte Chemoattractant

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Diagnosis of hypercoagulability is by. Molecular markers

Diagnosis of hypercoagulability is by. Molecular markers Agenda limitations of clinical laboratories to evaluate hypercoagulability and the underlying cause for thrombosis what is the INR the lupus anticoagulant and the antiphospholipid antibody syndrome hassouna

More information

Immunohistochemistry Research Products

Immunohistochemistry Research Products Immunohistochemistry Research Products Multiple Tissue Arrays (MTA) Primary and Secondary Antibodies Detection Systems Antigen Retrieval Solutions Tissue Processing Fixatives BD Biosciences Clontech Discovery

More information

Predicting Response to Intravesical Immunotherapy (BCG) in NMIBC

Predicting Response to Intravesical Immunotherapy (BCG) in NMIBC Predicting Response to Intravesical Immunotherapy (BCG) in NMIBC Ashish M. Kamat, MD, MBBS, FACS Professor of Urologic Oncology Wayne B. Duddlesten Professor of Cancer Research President, International

More information

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Supplemental Material

Supplemental Material Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin

More information

antibody and ELISA experts Cancer Research Products

antibody and ELISA experts Cancer Research Products Cancer Research Products WWW.BOSTERBIO.COM Cancer Research Cancer is a leading cause of death in developed nations, affecting millions of people around the world. Research into the molecular basis of these

More information

Life Sciences METABOLISM. Transform Your Metabolic Research

Life Sciences METABOLISM. Transform Your Metabolic Research METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,

More information

Supplementary Material Correlation matrices on FP and FN profiles

Supplementary Material Correlation matrices on FP and FN profiles Supplementary Material Correlation matrices on FP and FN profiles The following two tables give the correlation coefficients for the FP profiles and the FN profiles of a single tagging solutions against

More information

G-Protein-Coupled Receptors

G-Protein-Coupled Receptors Cellular Signalling Cells must be ready to respond to essential signals in their environment. These are often chemicals in the extracellular fluid (ECF) from distant locations in a multicellular organism

More information

REPRODUCTIVE CYCLE OF FEMALE MAMMAL

REPRODUCTIVE CYCLE OF FEMALE MAMMAL REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

The g c Family of Cytokines Prof. Warren J. Leonard M.D.

The g c Family of Cytokines Prof. Warren J. Leonard M.D. The Family of Cytokines Chief, Laboratory of Molecular Immunology Director, Immunology Center National Heart, Lung, and Blood Institute National Institutes of Health Department of Health and Human Services

More information

LQ SCIENTIFIC & CLINICAL MONOGRAPH

LQ SCIENTIFIC & CLINICAL MONOGRAPH LQ143.001 SCIENTIFIC & CLINICAL MONOGRAPH OrthoFlo Lyophilized Product Description OrthoFlo is a purified human amniotic fluid allograft that is intended for homologous use to protect and cushion, provide

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma

Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma Chapt. 45 Ch. 45 Blood Plasma proteins, Coagulation and Fibrinolysis Student Learning Outcomes: Describe basic components of plasma Inheritance of X-linked gene for Factor VIII hemophilia A Explain the

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents 2016 SomaLogic, Inc. Florence Pinet, Inserm UMR1167, Univ Lille, Ins?tut Pasteur de Lille, Lille - FRANCE florence.pinet@pasteur-

More information

INFLAMMATION ASSAY KITS

INFLAMMATION ASSAY KITS Interactive Assay Solutions INFLAMMATION ASSAY KITS Table of Contents Assay Kits Page # Allopregnanolone EIA and CLIA Kits 3 Atrial Natriuretic Peptide (ANP) EIA Kits 4 DNA Damage EIA Kits 5 Endothelin-1

More information

Bio-Plex Pro Cell Signaling Assays

Bio-Plex Pro Cell Signaling Assays Acute Phase Response Cancer Cardiovascular Disease Diabetes Cytokines, Chemokines, Growth Factors Immunology/Inflammation Immunoglobulin Isotyping Cell Signaling Toxicology Bio-Plex Pro Cell Signaling

More information

Part IV Antithrombotics, Anticoagulants and Fibrinolytics

Part IV Antithrombotics, Anticoagulants and Fibrinolytics Part IV Antithrombotics, Anticoagulants and Fibrinolytics "The meaning of good and bad, of better and worse, is simply helping or hurting" Emerson Chapter 16: Blood Coagulation and Fibrinolytic System

More information

Herlyn Lab - Monoclonal Antibodies

Herlyn Lab - Monoclonal Antibodies Herlyn Lab - Monoclonal Antibodies GI Tract tumors I. Lewis and related antigens 1. 1116-NS-19-9 (CO 19-9), IgG1, Sialylated Le a Koprowski et al. 1979 2. 129-2-C3-9-11 (CO 29.11), IgG1, Sialylated Le

More information