细胞因子绝对定量检测 RayBio 平面型抗体芯片

Size: px
Start display at page:

Download "细胞因子绝对定量检测 RayBio 平面型抗体芯片"

Transcription

1 细胞因子绝对定量检测 RayBio 平面型抗体芯片 RayBio 细胞因子定量检测抗体芯片技术服务 ()I Catalog duct Species QAH-ADI- y Obesity IGF-I, IL- alpha, IL-6, IL-8, Insulin, Leptin, MCP-, PAI-, Adipokines Resistin, TNF alpha QAH-ADI-2 y Obesity Array 2 4 Adipsin, Adiponectin, CRP, SAA Adipokines QAH-ANG- y Angiogenesi s ANG, ANG-2, EGF, bfgf, HB-EGF, HGF, Leptin, PDGF- Angiogenic BB, PIGF, VEGF Factors QAH-ANG- 2 y Angiogenesi s Array 2 Activin A, AgRP, Angiogenin, ANG-2, ANGPTL4, bfgf, 30 ENA-78, GRO, HB-EGF, HGF, IFN gamma, IGF-I, IL- Angiogenic alpha, IL-2, IL-6, IL-8, IL-7, IP-, Leptin, LIF, MCP-, Factors PDGF-BB, PIGF, RANTES, TGF beta, TIMP-, TIMP-2, TNF alpha, TNF beta, TPO

2 QAH-ANG- 3 y Angiogenesi s Array 3 ANG-, Angiostatin, CXCL6, EGF, FGF-4, Follistatin, G- 30 CSF, GM-CSF, I-309, IL-beta, IL-4, IL-, IL-2p, IL- Angiogenic 2p70, I-TAC, MCP-2, MCP-3, MCP-4, MMP-, MMP-9, Factors PECAM-, TGF alpha, TGF beta3, Tie-, Tie-2, upar, VEGF, VEGF R2, VEGF R3, VEGF-D QAH-ANG- 00 y Angiogenesi s Array Angiogenic QAH-ANG-2 & QAH-ANG-3 Factors

3 QAH-CHE- y Chemokine Chemokine s 6Ckine, Axl, BTC, CCL28, CTACK, CXCL6, ENA-78, Eotaxin-3, GCP-2, GRO, HCC-, HCC-4, IL-9, IL-7F, IL- 8 BPa, IL-28A, IL-29, IL-3, IP-, I-TAC, LIF, LIGHT, Lymphotactin, MCP-2, MCP-3, MCP-4, MDC, MIF, MIP- 3alpha, MIP-3beta, MPIF-, MSPalpha, NAP-2, OPN, PARC, PF4, SDF-alpha, TARC, TECK, TSLP QAH-CYT- y IL- alpha, IL- beta, IL-2, IL-4, IL-5, IL-6, IL-8, IL-, IL- 2, IL-3, GM-CSF, GRO, IFN gamma, MCP-, MIP-a, MIP-b, MMP-9, RANTES, TNF alpha, VEGF

4 QAH-CYT- 2 y Array 2 Acrp30, BDNF, BLC, beta-ngf, Eotaxin, Eotaxin-2, E- Selectin, GDNF, ICAM-, IGFBP-, IGFBP-2, IL-7, IL-7, L-Selectin, M-CSF, MIP-delta, MIP-3alpha, MIP-3beta, PECAM-, VCAM-2 RayBio 细胞因子定量检测抗体芯片技术服务 ()II Catalog duct Species QAH-CYT- 4 y Array 4 Activin A, AgRP, Angiogenin, ANG-, Angiostatin, Catheprin S, CD, Cripto-, DAN, DKK-, E-Cadherin, EpCAM, Fas L, Fcg RIIB/C, Follistatin, Galectin-7, ICAM-2, IL-3 R, IL-3R2, IL-7B, IL-2 Ra, IL-2 Rb, IL-23, LAP, NrCAM, PAI-, PDGF-AB, Resistin, SDF-b, sgp30, Shh N, Siglec-5, ST2, TGF-b2, Tie-2, TPO, TRAIL R4, TREM-, VEGF-C, VEGF R

5 QAH-GF- y Growth Factor Array Growth Factors AR, BDNF, bfgf, BMP-4, BMP-5, BMP-7, beta-ngf, EGF, EGF R, EG-VEGF, FGF-4, FGF-7, GDF-5, GDNF, GH, HB-EGF, HGF, IGFBP-, IGFBP-2, IGFBP-3, IGFBP- 4, IGFBP-6, IGF-I, Insulin, MCSF R, NGF R, NT-3, NT-4, OPG, PDGF-AA, PIGF, SCF, SCF R, TGF alpha, TGF beta, TGF beta3, VEGF, VEGF R2, VEGF R3, VEGF-D QAH-INF- y Inflammatio n IL- alpha, IL- beta, IL-4, IL-6, IL-8, IL-, IL-3, MCP-, IFN gamma, TNF alpha QAH-INF-2 y Inflammatio n Array 2 IL-ra, IL-6 sr, IL-2p, IL-2p70, IL-6, OSM, RANTES, SAA, stnf RI, stnf RI

6 QAH-INF-3 y Inflammatio n Array 3 BLC, Eotaxin, Eotaxin-2, G-CSF, GM-CSF, I-309, ICAM-, IFN gsmma, IL- alpha, IL- beta, IL-ra, IL-2, IL-4, IL-5, IL-6, IL-6 sr, IL-7, IL-8, IL-, IL-, IL-2p, IL-2p70, IL-3, IL-5, IL-6, IL-7, MCP-, M-CSF, MIG, MIP- alpha, MIP- beta, MIP- delta, PDGF-BB, RANTES, TIMP-, TIMP-2, TNF alpha, TNF beta, TNF sri, TNF srii QAH-ISO- y Ig Isotype Array IgA, IgE, IgD, IgM, IgG, IgG2, IgG3, IgG4 8 Ig subtypes QAH-MMP- y MMP Array MMPs MMP-, MMP-2, MMP-3, MMP-8, MMP-9, MMP-, MMP- 3, TIMP-, TIMP-2, TIMP-4 QAH-REC- y Receptor 4-BB, ALCAM, B7-, BCMA, CD4, CD30, CDL, CEACAM-, DR6, Dtk, Endoglin, ErbB3, E-Selectin, Fas, Flt-3L, GITR, HVEM, ICAM-3, IL- R4, IL- RI, IL- R beta, IL-7R, IL-2R gamma, IL-2R, LIMPII, Lipocalin-2, L- Selectin, LYVE-, MICA, MICB, NRG-beta, PDGF R beta, PECAM-, RAGE, TIM-, TRAIL R3, Trappin-2, upar, VCAM-, XEDAR RayBio 细胞因子定量检测抗体芯片技术服务 ()III Catalog duct Species

7 QAH-TH- y TH/TH2 IL-2, IL-4, IL-5, IL-6, IL-8, IL-, IL-3, GM-CSF, IFN gamma, TNF alpha QAH-CAA- 00 y Antibody QAH-INF-3 & QAH-GF- QAH-CAA- 00 y Antibody Array 00 QAH-INF-3 & QAH-GF- & QAH-CHE- QAH-CAA y Antibody Array QAH-INF-3 & QAH-GF- & QAH-CHE- & QAH-REC- QAH-CAA- 00 y Antibody Array 00 0 QAH-INF-3 & QAH-GF- & QAH-CHE- & QAH-REC- & QAH-CYT-4 QAH-CAA y Array Q7000 BLC, Eotaxin, Eotaxin-2, G-CSF, GM-CSF, I-309, ICAM-, IFN gsmma, IL- alpha, IL- beta, IL-ra, IL-2, IL-4, IL-5, IL-6, IL-6 sr, IL-7, IL-8, IL-, IL-, IL-2p, IL-2p70, IL- 3, IL-5, IL-6, IL-7, MCP-, M-CSF, MIG, MIP- alpha, MIP- beta, MIP- delta, PDGF-BB, RANTES, TIMP-, TIMP-2, TNF alpha, TNF beta, TNF sri, TNF srii, AR, BDNF, bfgf, BMP-4, BMP-5, BMP-7, beta-ngf, EGF, EGF R, EG-VEGF, FGF-4, FGF- 7, GDF-5, GDNF, GH, HB-EGF, HGF, IGFBP-, IGFBP-2, IGFBP-3, IGFBP-4, IGFBP- 6, IGF-I, Insulin, MCSF R, NGF R, NT-3, NT-4, OPG, PDGF-AA, PIGF, SCF, SCF R, TGF alpha, TGF beta, TGF beta3, VEGF, VEGF R2, VEGF R3, VEGF-D, 6Ckine, Axl, BTC, CCL28, CTACK, CXCL6, ENA-78, Eotaxin-3, GCP-2, GRO, HCC-, HCC-4, IL-9, IL-7F, IL-8 BPa, IL-28A, IL-29, IL-3, IP-, I-TAC, LIF, LIGHT, Lymphotactin, MCP-2, MCP-3, MCP-4, MDC, MIF, MIP-3alpha, MIP-3beta, MPIF-, MSPalpha, NAP-2, OPN, PARC, PF4, SDF-alpha, TARC, TECK, TSLP, 4-BB, ALCAM, B7-, BCMA, CD4, CD30, CDL, CEACAM-, DR6, Dtk, Endoglin, ErbB3, E-Selectin, Fas, Flt-3L, GITR, HVEM, ICAM-3, IL- R4, IL- RI, IL- R beta, IL-7R, IL-2R gamma, IL-2R, LIMPII, Lipocalin-2, L-Selectin, LYVE-, MICA, MICB, NRG-beta, PDGF R beta, PECAM-, RAGE, TIM-, TRAIL R3, Trappin-2, upar, VCAM-, XEDAR, Activin A, AgRP, Angiogenin, ANG-, Angiostatin, Catheprin S, CD, Cripto-, DAN, DKK-, E- Cadherin, EpCAM, Fas L, Fcg RIIB/C, Follistatin, Galectin-7, ICAM-2, IL-3 R, IL-3R2, IL-7B, IL-2 Ra, IL-2 Rb, IL-23, LAP, NrCAM, PAI-, PDGF-AB, Resistin, SDF-b, sgp30, Shh N, Siglec-5, ST2, TGF-b2, Tie-2, TPO, TRAIL R4, TREM-, VEGF-C, VEGF R,Adiponectin, Adipsin, AFP, ANGPTL4, B2M, BCAM, CA25, CA5-3, CEA, CRP, ErbB2, Ferritin, FSH, GRO, HCG, IGF- SR, IL- srii, IL-3, IL-8 R, IL-2, Leptin, MMP-, MMP-2, MMP-3, MMP-8, MMP-9, MMP-, MMP-3, NCAM-, Nidogen-, NSE, OSM, calcitonin, lactin, PSA, Siglec-9, TACE, Thyroglobulin, TIMP-4, TSH,2B4, ADAM-9, ANG-2, APRIL, BMP-2, BMP-9, C5a, Cathepsin L, CD0, CD97, Chemerin, DcR3, FABP2, FAP, FGF-9, Galectin-3, HGF R, IFN R2, IGF-II, IGF-II R, IL-R6, IL-24, IL-33, Kallikrein 4, Legumain, LOX-, MBL, Neprilysin, Notch-, NOV, Osteoactivin, PD-, PGRP-5, Serpin A4, sfrp-3, Thrombomodulin, TLR2, TRAIL R, Transferrin, WIF-,ACE-2, Albumin, AMICA, ANG-4, BAFF, CA9-9, CD63, Clusterin, CRTAM, CXCL4, Cystatin C, Decorin, Dkk-3, DLL, Fetuin A, afgf, FOLR, Furin, GASP-, GASP-2, GCSF R, HAI-2, IL-7B R, IL-27, LAG-3, LDL R, Pepsinogen I, RANK, RBP4, SOST, Syndecan-, TACI, TFPI, TSP-, TRAIL

8 RayBio 细胞因子定量检测抗体芯片技术服务 ()I Catalog duct Species CAA-00 CAA-00 y antibody 000 y antibody Array CYT-4 & CYT-5 CYT-4 & CYT-5 & CYT-6 CAA-3000 y antibody Array CYT-4 & CYT-5 & CYT-6 & CYT-7 CHE- y Chemokine 25 6Ckine, BLC, CTACK, CXCL6, Eotaxin, Eotaxin-2, Fractalkine, I-TAC, KC, LIX, MCP-, MCP-5, MDC, MIG, Chemokin MIP- alpha, MIP- gamma, MIP-2, MIP-3 alpha, MIP-3 es beta, PF-4, RANTES, SDF- alpha, TARC, TCA-3, TECK CYT- y GM-CSF, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL- 4, IL-5, IL-6, IL-9, IL-, IL-2, IL-3, IL-7, KC, MCP-, M- CSF, RANTES, TNF alpha, VEGF CYT-2 y Array 2 Axl, BLC, CD30, CD, CXCL6, Eotaxin-2, Fas Ligand, IGFBP-3, IGFBP-5, LIX, L-Selectin, MIG, MIP- alpha, MIP- beta, PF-4, P-Selectin, SDF- alpha, TCA-3, stnf RII, VCAM- CYT-3 y Array 3 Eotaxin, E-Selectin, G-CSF, GITR, ICAM-, IGFBP-2, IGFBP-6, IGF-I, IL-2pp70, Leptin, MCP-5, MDC, MIP-2, MIP-3 alpha, Osteopontin, OPG, Resistin, SCF, TPO, VEGF-D CYT-4 y Array 4 Axl, CD27L, CD30T, CD, CXCL6, EGF, E-selectin, Fractalkine, GITR, HGF, IGFBP-2, IGFBP-3, IGFBP-5, IGFBP-6, IGF-I, IL-2p70, IL-7E, IL-7F, IL-ra, IL-2 R alpha, IL-, IL-23, IL-28, I-TAC, MDC, MIP-2, MIP-3 alpha, OPN, OPG, lactin, -MMP-9, P-selectin, Resistin, SCF, SDF- alpha, TPO, VCAM-, VEGF, VEGF- D

9 CYT-5 y Array 5 bfgf, BLC, CD30L, Eotaxin, Eotaxin-2, Fas L, G-CSF, GM-CSF, ICAM-, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-, IL-2p, IL-3, IL-5, IL- 7, IL-2, KC, Leptin, LIX, MCP-, MCP-5, M-CSF, MIG, MIP- alpha, MIP- gamma, PF-4, RANTES, TARC, TCA- 3, TNF alpha, stnfri, stnfrii CYT-6 CYT-7 y Array 6 y Array 7 4-BB, ACE, ALK-, CT-, CD27, CDL, CTLA-4, Decorin, Dkk-, Dtk, Endoglin, Fc gamma RIIB, Flt-3 L, Galectin-, Galectin-3, Gas, Gas 6, GITR L, HAI-, HGF R, IL- R4, IL-3 R beta, IL-9, JAM-A, Leptin R, L-Selectin, Lymphotactin, MadCAM-, MFG-E8, MIP-3 alpha, Neprilysin, Pentraxin 3, RAGE, TACI, TREM-, TROY, TSLP, TWEAK R, VEGF R, VEGF R3 B7-, BAFF R, BTC, C5a, CCL6, CD48, CD6, Chemerin, Clusterin, CXCL5, Cystat in C, DAN, DLL4, EDAR, Endocan, Fetuin A, H60, IL-33, IL-7 Ralpha, Kremen-, Limitin, Lipocalin-2, LOX-, Marapsin, MBL-2, Meteorin, Nope, NOV, Osteoactivin, OX, Ligand, P-Cadherin, Periostin, PlGF-2, granulin, stasin, Renin, Testican 3, TIM-, TRAIL, Tryptase epsilon RayBio 细胞因子定量检测抗体芯片技术服务 ()II Catalog duct Species CYT- Q00 y Array Q00 60 Axl, BLC, CD30, CD, CXCL6, Eotaxin, Eotaxin-2, E- Selectin, Fas Ligand, G-CSF, GITR, GM-CSF, ICAM-, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL- 6, IL-9, IL-, IL-2, IL-2pp70, IL-3, IL-7, IGFBP-2, IGFBP-3, IGFBP-5, IGFBP-6, IGF-I, KC, Leptin, LIX, L- Selectin, MCP-, MCP-5, M-CSF, MDC, MIG, MIP- alpha, MIP- gamma, MIP-2, MIP-3 alpha, Osteopontin, OPG, PF-4, P-Selectin, RANTES, Resistin, SCF, SDF- alpha, TCA-3, TNF alpha, stnf RII, TPO, VCAM-, VEGF, VEGF-D INF- y Inflammati on BLC, CD30L, Eotaxin, Eotaxin-2, Fas L, G-CSF, GM-CSF, ICAM-, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-, IL-2p70, IL-3, IL-5, IL-7, IL-2, KC, Leptin, LIX, MCP-, MCP-5, M-CSF, MIG, MIP- alpha, MIP- gamma, PF-4, RANTES, TARC, TCA-3, TIMP-, TNF alpha, stnfri, stnfrii INT- y Interleukin G-CSF, GM-CSF, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-, IL-2p70, IL-3, IL- 5, IL-7, IL-2, IL-23, TNF alpha INT-00 y Interleukin G-CSF, GM-CSF, IFN gamma, IL- alpha, IL- beta, IL- ra, IL-2, IL-2R alpha, IL-3, IL-4, IL-5, IL-6, IL-6R, IL-7, IL- 9, IL-, IL-, IL-2p, IL-2p70, IL-3, IL-5, IL-7, IL- 7B, IL-7E, IL-7F, IL-, IL-2, IL-23, IL-28, TNF alpha

10 INT-2 y Interleukin Array 2 IL-ra, IL-2R alpha, IL-6R, IL-, IL-2p, IL-7B, IL-7E, IL-7F, IL-, IL-28 TH7- y TH7 8 TH7 IL-ß, IL-2, IL-4, IL-5, IL-6, IL-, IL-2p70, IL-3, IL-7(A), IL-7F, IL-2, IL-22, IL-23, IL-28, IFN?, MIP-3a, TGFß, TNFa RayBio 细胞因子定量检测抗体芯片技术服务 ()II Catalog duct Species CYT- Q00 y Array Q00 60 Axl, BLC, CD30, CD, CXCL6, Eotaxin, Eotaxin-2, E- Selectin, Fas Ligand, G-CSF, GITR, GM-CSF, ICAM-, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL- 6, IL-9, IL-, IL-2, IL-2pp70, IL-3, IL-7, IGFBP-2, IGFBP-3, IGFBP-5, IGFBP-6, IGF-I, KC, Leptin, LIX, L- Selectin, MCP-, MCP-5, M-CSF, MDC, MIG, MIP- alpha, MIP- gamma, MIP-2, MIP-3 alpha, Osteopontin, OPG, PF-4, P-Selectin, RANTES, Resistin, SCF, SDF- alpha, TCA-3, TNF alpha, stnf RII, TPO, VCAM-, VEGF, VEGF-D INF- y Inflammati on BLC, CD30L, Eotaxin, Eotaxin-2, Fas L, G-CSF, GM-CSF, ICAM-, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-, IL-2p70, IL-3, IL-5, IL-7, IL-2, KC, Leptin, LIX, MCP-, MCP-5, M-CSF, MIG, MIP- alpha, MIP- gamma, PF-4, RANTES, TARC, TCA-3, TIMP-, TNF alpha, stnfri, stnfrii INT- y Interleukin G-CSF, GM-CSF, IFN gamma, IL- alpha, IL- beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-, IL-2p70, IL-3, IL- 5, IL-7, IL-2, IL-23, TNF alpha INT-00 y Interleukin G-CSF, GM-CSF, IFN gamma, IL- alpha, IL- beta, IL- ra, IL-2, IL-2R alpha, IL-3, IL-4, IL-5, IL-6, IL-6R, IL-7, IL- 9, IL-, IL-, IL-2p, IL-2p70, IL-3, IL-5, IL-7, IL- 7B, IL-7E, IL-7F, IL-, IL-2, IL-23, IL-28, TNF alpha INT-2 y Interleukin Array 2 IL-ra, IL-2R alpha, IL-6R, IL-, IL-2p, IL-7B, IL-7E, IL-7F, IL-, IL-28 TH7- y TH7 8 TH7 IL-ß, IL-2, IL-4, IL-5, IL-6, IL-, IL-2p70, IL-3, IL-7(A), IL-7F, IL-2, IL-22, IL-23, IL-28, IFN?, MIP-3a, TGFß, TNFa

11 RayBio 细胞因子定量检测抗体芯片技术服务 (Rat & Porcine) Catalog duct Species QAR- CYT- y Rat Rat CINC-2, CINC-3, CNTF, Fractalkine, GM-CSF, IL- alpha, IL-4, LIX, beta-ngf, VEGF QAR- CYT-2 y Rat Array 2 Rat ICAM-, IFN gamma, IL- beta, IL-6, IL-, Leptin, L- selectin, MCP-, TIMP-, TNF alpha QAR- CYT-3 y Rat Array 3 Rat 27 B7-2, beta-ngf, CINC-, CINC-2, CINC-3, CNTF, Fractalkine, GM-CSF, ICAM-, IFN gamma, IL- alpha, IL-l beta, IL-2, IL-4, IL-6, IL-, IL-3, LIX, L-Selectin, MCP-, PDGF-AA, lactin R, RAGE, TCK-, TIMP-, TNF alpha, VEGF QAR-INF- QAP- CYT- y Rat Inflammati on Rat y Porcine Porcine IL- alpha, IL- beta, IL-2, IL-4, IL-6, IL-, IL-3, MCP-, IFN gamma, TNF alpha IL-beta, IL-4, IL-6, IL-8, IL-, IL-2, Granulocye- Macrophage Colony Stimulating Factor (GM-CSF), IFNgamma, TGFbeta, TNFalpha BioPlex 悬浮芯片细胞因子定量检测服务 编号 M500KCA F0Y MF0005K MII 名称 27-Plex Panel 2-Plex Panel 检测指标 IL-B,IL-ra,IL-2,IL-4,IL-5,IL-6,IL-7,IL-8,IL-9,IL-,IL-2(p70),IL-3,IL-5,IL- 7,Basic FGF, Eotaxin, G-CSF, GM-CSF, IFN-γ, IP-, MCP-(MCAF), MIP-α, MIP-β, PDGF-BB, RANTES,TNF-α,VEGF IL-α,IL-2Rα,IL-3,IL-2(p),IL-6,IL-8**,CTACK,GRO-α,HGF,IFN-α 2,LIF,MCP-3,M-CSF,MIF,MIG,β-NGF,SCF,SCGF-β,SDF-α,TNF-β,TRAIL

12 M YV 7A0 P 7-Plex PREC PRO ASSAY HU CYTO - 7- AA00M M A M60009R DPD MD EL M J7 M A 7K7 0 7A300 M PLEX Th7 8-Plex 23-Plex 9-Plex Rat 9-plex A Panel BPLX HU ISOTYP KIT X96 IL-B,IL-2,IL-4,IL-5,IL-6,IL-7,IL-8,IL-,IL-2(p70),IL-3,IL-7,G-CSF,GM- CSF,IFN-γ,MCP-(MCAF),MIP-β,TNF-α IL-b, IL-2, IL-4, IL-5, IL-6, IL-, IL-2(p70), IL-3, IFN-g, TNF-a. IL-β, IL-4, IL-6, IL-, IL-7A, IL-7F, IL-2, IL-22, IL-23, IL-25, IL-3, IL-33, IFN-γ, scdl, TNF-α IL-2,IL-4,IL-6,IL-8,IL-,GM-CSF,IFN-γ,TNF-α IL-α,IL-β,IL-2,IL-3, IL-4, IL-5, IL-6, IL-9, IL-, IL-2(p), IL-2(p70), IL-3, IL-7, Eotaxin, G-CSF, GM-CSF, IFN-γ, KC, MCP-(MCAF), MIP-α, MIP-β, RANTES, TNF-α IL-5,IL-8,Basic FGF, LIF, M-CSF, MIG, MIP-2, PDGF-BB, VEGF IL-2,IL-4,IL-5,IL-,IL-2(p70),GM-CSF,IFN-γ,TNF-α IL-β,IL-2,IL-4,IL-5,IL-,GM-CSF,IFN-γ,TNF-α IL-α, IL-β, IL-2, IL-4, IL-6, IL-, GM-CSF, IFN-γ, TNF-α IgG,IgG2,IgG3,IgG4,IgM,IgA,IgE

Human Cytokine Antibody Array

Human Cytokine Antibody Array Li StarFish S.r.l. Via Cavour, 35-20063 Cernusco S/N (MI), Italy Tel. +39-02-92150794 - Fax. +39-02-92157285 info@listarfish.it -www.listarfish.it Human Cytokine Antibody Array Patent Pending Technology

More information

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

Dilution Factor Serum Plasma Urine CSF (Other)

Dilution Factor Serum Plasma Urine CSF (Other) R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations

More information

RayBiotech, Inc. RayBio Mouse Cytokine Antibody Array. Please read manual carefully before starting experiment. Patent Pending Technology

RayBiotech, Inc. RayBio Mouse Cytokine Antibody Array. Please read manual carefully before starting experiment. Patent Pending Technology RayBio Mouse Cytokine Antibody Array Patent Pending Technology User Manual (Revised June 14, 2009) RayBio Mouse Cytokine Antibody Array 1 (Cat# AAM-CYT-1) RayBio Mouse Cytokine Antibody Array 2 (Cat# AAM-CYT-2)

More information

TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC. CONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA

TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC. CONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA AD Award Number: W81XWH-10-1-0433 TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC PRINCIPAL INVESTIGATOR: Elahna Paul, M.D., Ph.D. CONTRACTING ORGANIZATION: Massachusetts General Hospital

More information

Activated mast cells promote differentiation of B cells into effector cells

Activated mast cells promote differentiation of B cells into effector cells Supplementary,information, Activated mast cells promote differentiation of B cells into effector cells Anna-Karin E. Palm 1, Gianni Garcia Faroldi 2, Marcus Lundberg 1, Gunnar Pejler 3, 2 and Sandra Kleinau

More information

Multiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex

Multiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex Multiplex Suspension Arrays NF-kβ p65 TGF-β1 c-jun Smad2 EGF IL-17A/F Akt IGF-IR Stat1 MEK1 IL-12p70 Bio-Plex Multiplex Immunoassays Analyte Guide Summer 2014 2014 Bio-Rad Laboratories, Inc. The Power

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

LEGENDplex Multi-Analyte Flow Assay Kits

LEGENDplex Multi-Analyte Flow Assay Kits LEGENDplex Multi-Analyte Flow Assay Kits BioLegend is ISO 9001:2008 and ISO 13485:2003 Certified 02-0009-03 World-Class Quality Superior Customer Support Outstanding Value LEGENDplex Multi-Analyte Flow

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman D15001 C-60014 Angiopoietin 1 (HeLa cell-derived), (Ang-1), rhuman 20 µg 32,000 D15002 C-60016 Apolipoprotein A1, (APO-A1), rhuman 100 µg 32,000 D15003 C-60017 Apolipoprotein E2, (APO-E2), rhuman 500 µg

More information

ProcartaPlex multiplex immunoassays for the Luminex platform

ProcartaPlex multiplex immunoassays for the Luminex platform ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate

More information

Assay Kits

Assay Kits Assay Kits www.biogenuix.com» Immuno Assays Human Mouse Rat Rabbit Bovine Swine Equine Goat Faline Canine Chicken www.biogenuix.com Your leading RUO Assay supplier offering more than 800 Assays & Kits

More information

RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit

RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit RayBio Label-based (L-Series) Mouse Antibody Array L-308 Membrane Kit Patent Pending Technology User Manual (Revised August 8, 2017) For the simultaneous detection of the relative expression of 308 (L-308)

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

Immunoassays LEGENDplex & ELISA Kits

Immunoassays LEGENDplex & ELISA Kits Immunoassays LEGENDplex & ELISA Kits BioLegend is ISO 13485:2003 Certified Toll-Free Tel: (US & Canada): 1.877.BIOLEGEND (246.5343) Tel: 858.768.5800 biolegend.com 02-0017-00 World-Class Quality Superior

More information

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,

More information

2018/2019 Catalog ReliaTech GmbH 2018/2019. Catalog

2018/2019 Catalog ReliaTech GmbH 2018/2019. Catalog 2018/2019 Catalog ReliaTech GmbH 2018/2019 Catalog +49-5331-8586 987 +49-5331-8586 989 www.reliatech.de orders@reliatech.de A B mouse anti-human CD31 rabbit anti-human EGFR C D CD31/EGFR control Double

More information

RayBio Human Thyroglobulin ELISA Kit

RayBio Human Thyroglobulin ELISA Kit RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

ProcartaPlex Multiplex Immunoassays

ProcartaPlex Multiplex Immunoassays ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a

More information

2017 Price List. Published by: PeproTech, INC. Rocky Hill, New Jersey USA

2017 Price List. Published by: PeproTech, INC. Rocky Hill, New Jersey USA 2014 Price List 2017 Price List Published by: PeproTech, INC. Rocky Hill, New Jersey USA Toll Free Number (in the United States) (800) 436-9910 (609) 497-0253 Fax Orders (609) 497-0321 1 PEPROTECH Ordering

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

OUR QUALITY YOUR DEDICATION PRICE LIST

OUR QUALITY YOUR DEDICATION PRICE LIST PRICE LIST 2018 Price List 2018 Price List Published by: PeproTech, INC. Rocky Hill, New Jersey USA PEPROTECH Ordering Information Hours of Operation: Extended hours from 8:00 AM to 8:00 PM (Eastern Standard

More information

Cytokine Profiling in Human Colostrum and Milk by Protein Array

Cytokine Profiling in Human Colostrum and Milk by Protein Array Papers in Press. Published March 15, 2007 as doi:10.1373/clinchem.2006.077107 The latest version is at http://www.clinchem.org/cgi/doi/10.1373/clinchem.2006.077107 Clinical Chemistry 53:5 000 000 (2007)

More information

WideScreen BeadPlex Multiplex Assays. Spring 2010

WideScreen BeadPlex Multiplex Assays. Spring 2010 WideScreen BeadPlex Multiplex Assays Spring 2010 Cancer Panels Cancer Biomarkers Cancer Panel 1 (Biomarkers) Cancer Panel 2 (Growth Factors) MMP Panel Cat No: BPHCP001-6 CA 125 CEA (Carcinoembryonic Antigen)

More information

Immunology Research Related Cytokine Products

Immunology Research Related Cytokine Products Immunology Research Related Cytokine Products Copyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ 08553-0275 Tel: (800) 436-9910 (609) 497-0253 Fax: (609) 497-0321 email:

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

Assured Quality Technically Supported Competitive Costs Customization

Assured Quality Technically Supported Competitive Costs Customization Multi-Analyte Flow Assay Kits IL-6 Protein Structure Assured Quality Technically Supported Competitive Costs Customization KRISHGEN BIOSYSTEMS Unit Nos#318/319, Shah & Nahar, Off Dr E Moses Road, Worli,

More information

Circulating Levels of Inflammatory Proteins and Survival in Patients with

Circulating Levels of Inflammatory Proteins and Survival in Patients with Circulating Levels of Inflammatory Proteins and Survival in Patients with Gallbladder Cancer Zhiwei Liu 1 *, Troy J. Kemp 2, Yu-Tang Gao 3, Amanda Corbel 1, Emma E. McGee 1, Juan Carlos Roa 4,5, Bingsheng

More information

BioLegend 12 月新製品. Cross-Reactivity: Rabbit (Lapine), Guinea. Monkey, Chimpanzee, Cynomolgus, Pigtailed FC 100 tests 52,000

BioLegend 12 月新製品. Cross-Reactivity: Rabbit (Lapine), Guinea. Monkey, Chimpanzee, Cynomolgus, Pigtailed FC 100 tests 52,000 BioLegend 12 月新製品 カタログ番号 製品名 クローン 反応種 アプリケーション サイズ 定価 105845 Alexa Fluor 700 anti-mouse CD117 (c-kit) 2B8 Mouse FC 25 μg 17,000 105846 Alexa Fluor 700 anti-mouse CD117 (c-kit) 2B8 Mouse FC 100 μg 39,000

More information

Luminex Assays and High Performance Assays Product Listing _ Fall 2017

Luminex Assays and High Performance Assays Product Listing _ Fall 2017 RnDSy-lu-2945 Luminex Assays and High Performance Assays Product Listing _ Fall 2017 Analyte Streptavidin-PE Biotin Target Analyte Detection Antibody Capture Antibody Luminex Bead 1 Table of Contents Luminex

More information

DATA PACKAGE. Multiplex CVD I 96 96

DATA PACKAGE. Multiplex CVD I 96 96 DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit

More information

STI and BV prevalence in young women in Cape Town and Soweto

STI and BV prevalence in young women in Cape Town and Soweto STI and BV prevalence in young women in Cape Town and Soweto Shaun Barnabas Genital Mucosal and STI lab Desmond Tutu HIV Foundation University of Cape Town FAMCRU University of Stellenbosch WISH: Women

More information

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma P909 Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma Tedeschi R, Bidoli E 2, Bortolin MT, Pratesi C, Basaglia G, Zanussi

More information

Biomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia

Biomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia Biomarkers in drug discovery and development Margit Wissenbach, PhD Dir Business Development Scandinavia Aptuit: A Truly Integrated R&D Offering Integrated Discovery Integrated Development IND Candidate

More information

Luminex Assay Product Listing Summer 2017

Luminex Assay Product Listing Summer 2017 RnDSy-lu-2945 Luminex Assay Product Listing Summer 2017 Streptavidin-PE Biotin Target Detection Antibody Capture Antibody Luminex Bead 1 Table of Contents Luminex Panels by Research Topic/Disease State...

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Cytokine (Human) Antibody Array

Cytokine (Human) Antibody Array Cytokine (Human) Antibody Array Catalog Number AA0077 4 Samples/Slide Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

PEPROTECH. Manufacturer of Quality Cytokine Products. Published by PeproTech Inc. Rocky Hill, New Jersey USA

PEPROTECH. Manufacturer of Quality Cytokine Products.   Published by PeproTech Inc. Rocky Hill, New Jersey USA PEPROTECH Manufacturer of Quality Cytokine Products Published by PeproTech Inc. Rocky Hill, New Jersey USA Copyright 2011 by PeproTech Inc. 1 2011-2012 2 PEPROTECH 用 力力 立立 大 虫 白 用 高 長 大 高 力力 大 士 力力 3 2011-2012

More information

Cytokine 56 (2011) Contents lists available at SciVerse ScienceDirect. Cytokine

Cytokine 56 (2011) Contents lists available at SciVerse ScienceDirect. Cytokine Cytokine 56 (211) 641 647 Contents lists available at SciVerse ScienceDirect Cytokine journal homepage: www. elsevier. com/ locate/ is sn/ 1434666 Macrophage Colony Stimulating Factor and Monocyte Chemoattractant

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Instant ELISA Kits. Accelerate Time to Result

Instant ELISA Kits. Accelerate Time to Result Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable

More information

Speciality and Research Controls

Speciality and Research Controls Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

AVAILABLE BIOMARKER ASSAYS

AVAILABLE BIOMARKER ASSAYS AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated

More information

Cardiovascular Disease Products

Cardiovascular Disease Products Cardiovascular Disease Products For more information, visit: www.bosterbio.com Cardiovascular Disease Research Cardiovascular disease is the leading cause of death in developed nations. Boster Bio aims

More information

Data Package. Multiplex Oncology I 96 96

Data Package. Multiplex Oncology I 96 96 Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection

More information

ab Thyroglobulin Human ELISA Kit

ab Thyroglobulin Human ELISA Kit ab155441 Thyroglobulin Human ELISA Kit Instructions for Use For the quantitative measurement of Human Thyrogobulin in serum, plasma and cell culture supernatants. This product is for research use only

More information

U N I V E R S I T Ä T S M E D I Z I N B E R L I N

U N I V E R S I T Ä T S M E D I Z I N B E R L I N U N I V E R S I T Ä T S M E D I Z I N B E R L I N Chronic Urticaria: the role of mast cells and basophils Marcus Maurer Allergie-Centrum-Charité Department of Dermatology and Allergy Charité - Universitätsmedizin

More information

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension.

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully

More information

Modulation of Cytokines in Cancer Patients by Intravenous Ascorbate Therapy

Modulation of Cytokines in Cancer Patients by Intravenous Ascorbate Therapy CLINICAL RESEARCH e-issn 1643-3750 DOI: 10.12659/MSM.895368 Received: 2015.07.17 Accepted: 2015.09.14 Published: 2016.01.03 Modulation of Cytokines in Cancer Patients by Intravenous Ascorbate Therapy Authors

More information

Multiplex assays for biomarkers research & clinical application

Multiplex assays for biomarkers research & clinical application Multiplex assays for biomarkers research & clinical application The Multiplex Technology The study of a unique biomarker does not generate sufficient contributions to advance in the clinical research of

More information

Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer

Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Original Article Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Hongyan Huang, Yanbin Zhang, Sha Li, Jing Zhao, Xiaoli

More information

LQ SCIENTIFIC & CLINICAL MONOGRAPH

LQ SCIENTIFIC & CLINICAL MONOGRAPH LQ143.001 SCIENTIFIC & CLINICAL MONOGRAPH OrthoFlo Lyophilized Product Description OrthoFlo is a purified human amniotic fluid allograft that is intended for homologous use to protect and cushion, provide

More information

U-PLEX Custom Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES.

U-PLEX Custom Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES. U-PLEX Custom Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES. 17379-v1-2007Mar MSD U-PLEX Platform U-PLEX Custom Metabolic Group 1

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Predicting Response to Intravesical Immunotherapy (BCG) in NMIBC

Predicting Response to Intravesical Immunotherapy (BCG) in NMIBC Predicting Response to Intravesical Immunotherapy (BCG) in NMIBC Ashish M. Kamat, MD, MBBS, FACS Professor of Urologic Oncology Wayne B. Duddlesten Professor of Cancer Research President, International

More information

LIST OF AVAILABLE ASSAYS. Methods/Platforms. Biomarkers Core Laboratory 622 West 168th Street PH New York, NY

LIST OF AVAILABLE ASSAYS. Methods/Platforms. Biomarkers Core Laboratory 622 West 168th Street PH New York, NY Biomarkers Core Laboratory 622 West 168th Street PH10-105 New York, NY 10032 212.305.9306 Tel LIST OF AVAILABLE ASSAYS Assay Methods/Platforms 25 hydroxy Vitamin D2, D3 3-Aminopropanol Acetoacetate ACY-1215

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Aksentijevich I, Masters SL, Ferguson PJ, et al. An autoinflammatory

More information

Antibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg

Antibodies. Product Name Cat. No. Size. GH (Growth Hormone) Antibody µg, 100 µg GM-CSF Antibody µg, 100 µg JAK/STAT Signaling The JAK/STAT signaling pathway transmits a signal from outside the cell eventually resulting in DNA transcription and activity in the cell. Leptin (a product of the obese gene) can induce

More information

toxins ISSN

toxins ISSN Toxins 2013, 5, 336-362; doi:10.3390/toxins5020336 Review OPEN ACCESS toxins ISSN 2072-6651 www.mdpi.com/journal/toxins The Possible Diagnostic and Prognostic Use of Systemic Chemokine Profiles in Clinical

More information

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it. Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2

More information

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:

More information

TAM and cancer: from the early days on

TAM and cancer: from the early days on TAM and cancer: from the early days on RUDOLF LUDWIG KARL VIRCHOW (18211902) omnis cellula e cellula (Balkwill and Mantovani. Inflammation and Cancer: back to Virchow. Lancet 2001) Cytotoxicity Growth

More information

Supplemental Material

Supplemental Material Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

U-PLEX Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES.

U-PLEX Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES. U-PLEX Metabolic Group 1 (Human) Multiplex Assays FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES. 17379-v1-2007Mar MSD U-PLEX Platform U-PLEX Metabolic Group 1 (Human) Multiplex

More information

Using the patients immune system to treat tumors. Dirk Jäger Medical Oncology National Center for Tumor Diseases University Medical Center Heidelberg

Using the patients immune system to treat tumors. Dirk Jäger Medical Oncology National Center for Tumor Diseases University Medical Center Heidelberg Using the patients immune system to treat tumors Dirk Jäger Medical Oncology National Center for Tumor Diseases University Medical Center Heidelberg Oncology today Most treatment decisions are based on

More information

FY18 Biomarkers Core Lab Price List

FY18 Biomarkers Core Lab Price List ** *** Sample Processing - Lvl. 1 (< 15 min.) $16.75 $16.75 Sample Processing - Lvl. 2 (15-30 min.) $27.75 $27.75 Sample Processing - Lvl. 3 (30-60 min.) $50.00 $50.00 Sample Processing - Lvl. 4 (60 min.

More information

B-cell. Astrocyte SCI SCI. T-cell

B-cell. Astrocyte SCI SCI. T-cell RF #2015 P-01 PI: Azizul Haque, PhD Grant Title: Targeting Enolase in Spinal Cord Injury 12-month Technical Progress Report Progress Report (First Six Months): Enolase is one of the most abundantly expressed

More information

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Research Article Cytokine Levels in the Serum of Healthy Subjects

Research Article Cytokine Levels in the Serum of Healthy Subjects Mediators of Inflammation Volume 213, Article ID 4341, 6 pages http://dx.doi.org/1.1155/213/4341 Research Article Cytokine Levels in the Serum of Healthy Subjects Giulio Kleiner, Annalisa Marcuzzi, Valentina

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

REPRODUCTIVE CYCLE OF FEMALE MAMMAL

REPRODUCTIVE CYCLE OF FEMALE MAMMAL REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064

More information

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological

More information

antibody and ELISA experts Cancer Research Products

antibody and ELISA experts Cancer Research Products Cancer Research Products WWW.BOSTERBIO.COM Cancer Research Cancer is a leading cause of death in developed nations, affecting millions of people around the world. Research into the molecular basis of these

More information

Psoriasis and the metabolic syndrome

Psoriasis and the metabolic syndrome Psoriasis and the metabolic syndrome MD, PhD James G. Krueger 1 Inflammation as a foundation of metabolic dysregulation and cardiovascular disease risk Diseases of systemic immune activation and inflammation,

More information

invited review Chemokines and chemokine receptors in leukocyte trafficking

invited review Chemokines and chemokine receptors in leukocyte trafficking Am J Physiol Regulatory Integrative Comp Physiol 283: R7 R28, 2002; 10.1152/ajpregu.00738.2001. Chemokines and chemokine receptors in leukocyte trafficking invited review TIMOTHY S. OLSON AND KLAUS LEY

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

An explorative study comparing levels of soluble mediators in control and osteoarthritic synovial fluid.

An explorative study comparing levels of soluble mediators in control and osteoarthritic synovial fluid. Accepted Manuscript An explorative study comparing levels of soluble mediators in control and osteoarthritic synovial fluid. M. Beekhuizen, MD L.M. Gierman, MSc W.E. van Spil, MD G.J.V.M. Van Osch, PhD

More information

Induction of Innate Immune Responses in HVTN 071: a Trial using the MRKAd5 gag/pol/nef Vaccine from the Step Study

Induction of Innate Immune Responses in HVTN 071: a Trial using the MRKAd5 gag/pol/nef Vaccine from the Step Study Induction of Innate Immune Responses in HVTN 71: a Trial using the MRKAd5 gag/pol/nef Vaccine from the Step Study Erica Andersen-Nissen Vaccine and Infectious Disease Institute Fred Hutchinson Cancer Research

More information

Allergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis

Allergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis Hypersensitivity Disorders Hypersensitivity Disorders Immune Response IgE Disease Example Ragweed hay fever IgG Cytotoxic Immune complex T Cell Hemolytic anemia Serum sickness Poison ivy IgE-mediated Diseases

More information

MyBioSource.com. Catalog Number: MBS tests FOR LABORATORY RESEARCH USE ONLY NOT FOR DIAGNOSTIC USE

MyBioSource.com. Catalog Number: MBS tests FOR LABORATORY RESEARCH USE ONLY NOT FOR DIAGNOSTIC USE Human IL-2 srα ELISA Kit For the quantitative determination of human interleukin-2 soluble receptor α (IL-2 srα) concentrations in serum, plasma, cell culture supernatant, and other biological fluids.

More information

Serum cytokine levels in patients with hepatocellular carcinoma

Serum cytokine levels in patients with hepatocellular carcinoma Eur. Cytokine Netw., Vol. 21 n 2, June 21, 99-14 99 RESEARCH ARTICLE Serum cytokine levels in patients with hepatocellular carcinoma Francesca Capone 1, Susan Costantini 1, Eliana Guerriero 1, Rosa Calemma

More information

Cancer, inflammation, and immunity crosstalk

Cancer, inflammation, and immunity crosstalk Contact Technical Support BRCsupport@QIAGEN.COM 1-800-362-7737 Cancer, inflammation, and immunity crosstalk Jesse Liang, Ph.D. Legal disclaimer QIAGEN products shown here are intended for molecular biology

More information

Many randomized controlled clinical trials have demonstrated

Many randomized controlled clinical trials have demonstrated Anti-Inflammatory Peptides From Cardiac Progenitors Ameliorate Dysfunction After Myocardial Infarction Mei-Lan Liu, MD, PhD; Toshio Nagai, MD, PhD; Masakuni Tokunaga, MD, PhD; Koji Iwanaga, MD, PhD; Katsuhisa

More information

MAF Shalaby Prof. Rheumatology Al Azhar University, Cairo, Egypt.

MAF Shalaby Prof. Rheumatology Al Azhar University, Cairo, Egypt. MAF Shalaby Prof. Rheumatology Al Azhar University, Cairo, Egypt. AUTOIMMUNE DISEASE RA SLE VASCULITIS RELAPSING POLYCHONDRITIS SS DM/PM SJOGREN S SYNDROME RHEUMATOID ARTHRITIS Classically immune mediated

More information

Immunology. Antibodies for immunology research

Immunology. Antibodies for immunology research Immunology Antibodies for immunology research antibodies for immunology research BP0169 BP0003-1 BP0004-1 BP0061 CD4 + T cells Control LOB12.3 Relative Cell Number CD4 (55 kda) CD8α (35 kda) CD8α (35 kda)

More information

CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.

CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products. CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest

DECLARATION OF CONFLICT OF INTEREST. No conflicts of interest DECLARATION OF CONFLICT OF INTEREST No conflicts of interest University Heart Centre Tübingen Angiogenic actions of platelets Meinrad Gawaz, MD, FESC Tübingen, Germany ESC 2011 Paris GPIb GPIb GPVI TxA2

More information

Growth Factors. BIT 230 Walsh Chapter 7

Growth Factors. BIT 230 Walsh Chapter 7 Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

VALIDATION DATA. Multiplex CVD II 96 96

VALIDATION DATA. Multiplex CVD II 96 96 VALIDATION DATA Multiplex CVD II 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Quality Controls 3 1.3 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical

More information

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )

More information

Editor Journal of Allergy and Therapy

Editor Journal of Allergy and Therapy Editor Journal of Allergy and Therapy Biography Prof. Domenico Ribatti was awarded his MD degree on October 1981 with full marks. His present position is of a full-time professor of Human Anatomy at the

More information

Predicting Response to BCG

Predicting Response to BCG Predicting Response to BCG Ashish M. Kamat, MD, MBBS, FACS Director, Urologic Oncology Fellowship Professor, Department of Urology BCG: Since 1970s stuck in the past? ~ 1.2 Million Doses of BCG used globally

More information