YAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
|
|
- Rodger Sherman
- 6 years ago
- Views:
Transcription
1 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl ner Wei Li, Yunyun Co, Jinling Xu, Ying Wng, Weijie Li, Qin Wng, Ziwei Hu, Yping Ho,LiHu, Ywen Sun, Gunglin Xu,,3* nd Guizhen Ao 4 Astrt Bkground: Chemotherpy resistne remins mjor hllenge in ner tretment. (ylooxygense ) is involved in drug resistne nd poor prognosis of mny neoplsti diseses or ners. However, investigtions identifying new modultors of pthwy nd serhing for new hemils trgeting these vlid resistnt iomrkers re still gretly needed. Methods: HCT5, HCT-6, HT-9, COLO5, FHC, IMCE, SW48 ell lines were used to detet the expression of nd. Site-direted mutgenesis, luiferse reporter nlysis nd ChIP ssy were used to test whether tivted trnsription through intertion with TEAD inding sites in the promoter of. Cell line models exhiiting overexpression or knokdown of some genes were generted using trnsfetion gents. Coimmunopreipittion ws used to detet protein mutul intertion. mrna nd protein levels were mesured y qrt-pcr nd western lot respetively. Results: Here, we reported tht oth nd were overexpressed in oloretl ner ells. inresed expression t the level of trnsription requiring intt TEAD inding sites in the promoter. onferred drug resistne through nd its relted effetors suh s MCL, MDR, Survivin. GCCSysm-4 (G-4), nd inhiitor, effetively inhiited oth nd tivtion, indued poptosis nd deresed viility in Txol-resistnt ells. Inhiition of nd ted synergistilly nd more effiiently redued the resistne of CRC ells thn either of them lone. Conlusions: Our dt provide new mehnisms tht is new upstrem regultor of pthwy nd plys n importnt role in onferring resistne in CRC ells. G-4, trgeting -, my e novel vlule strtegy to omt resistne in CRC. Keywords: Yp,, Coloretl ner, Resistne * Correspondene: xudunlop@6.om Equl ontriutors College of life sienes, Nnjing Norml University, Nnjing, Chin Jingsu Key Lortory of 3D Printing Equipment nd Mnufturing, Nnjing Norml University, Nnjing, Chin Full list of uthor informtion is ville t the end of the rtile The Author(s). 7 Open Aess This rtile is distriuted under the terms of the Cretive Commons Attriution 4. Interntionl Liense ( whih permits unrestrited use, distriution, nd reprodution in ny medium, provided you give pproprite redit to the originl uthor(s) nd the soure, provide link to the Cretive Commons liense, nd indite if hnges were mde. The Cretive Commons Puli Domin Dedition wiver ( pplies to the dt mde ville in this rtile, unless otherwise stted.
2 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge of Bkground Adenorinom of the olon nd retum (oloretl ner, CRC) is the third most ommon ner, the fourth most ommon use of ner deth, nd the seond most ommon ner in terms of the numer of individuls living with ner five yers fter dignosis worldwide. However, the tretment of oloretl ner is still diffiult for therpists. The suess of CRC hemotherpy is often ompromised y tumor reurrene nd quired resistne. Therefore, rodening our knowledge of moleulr signling inluding proteins or iomrkers responsile for drug resistne is ruil for developing novel therpeuti strtegies to overome resistne nd inrese ptient survivl []. Cylooxygenses (suh s COX- nd ) re prostglndin (PG) synthses tlyzing the rhidoni id (AA) to the prodution of prostglndins. COX- is onsidered s housekeeping isoenzyme nd onstitutively expressed in mmmlin ells. In ontrst, serves s n induile enzyme nd tivted y vrious insults under pthologil onditions. The tivtion of results in formtion of its mjor produt, PGE, whih plys ruil role in modulting mny pthophysiologil tivities [, 3]. Reent reports show tht is overexpressed in mny solid tumors, inluding oloretl ner, nd involved in drug resistne nd poor prognosis [4 7]. By using genome mirorry nd rel-time qrt-pcr, mny ellulr genes hve een identified nd onfirmed s downstrem effetors of. The tivtion of the /PGE pthwy n up-regulte the expression of downstrem effeters, suh s three ABC (ATP-indingssette) trnsporters, MDR/P-gp (multidrug resistne/ P-glyoprotein), MRP (multidrug-resistne protein ), BCRP (rest-ner-resistne protein), nd poptosis regulting proteins, Survivin, Bl- fmily nd GST system nd PKC pthwy [3]. In ontrst, less upstrem regultors of pthwy re well hrterized exept NFkppB, MAPK, nd PI3K/Akt. Therefore, investigtions identifying new upstrem modultors of pthwy re urgently needed. The Hippo signling pthwy hs importnt regultory effets in orgn size nd ell prolifertion. is one of the two min key downstrem effetors of the Hippo signling pthwy nd is tightly regulted y some serinethreonine kinses suh s mmmlin STE-like protein kinse / (MST/), nd lrge tumor suppressor / (LATS/) [8]. A lrge ody of evidene shows tht Hippo pthwy plys ritil role in ner development [9, ] inluding CRC nd /TAZ hs een shown to medite resistne to hemotherpy in humn ners []. In preliminry studies, we found tht nd were up-regulted nd positively ssoited in CRC ells. Considering is trnsriptionl otivtor nd positive orreltion etween these two moleules, we hypothesize tht tivtes pthwy nd inreses its expression, leding to resistne to drug therpy. In this study, we provide new insights into the ide tht enhnes expression vi intertions with trnsription ftors, TEA domin fmily memers, in the promoter. ugments survivl pthwy through up-regultion nd initites therpy resistne to hemotherpeuti gents. nd t synergistilly in keeping drug resistne nd ntipoptosis. Our dt demonstrte tht is new upstrem regultor of pthwy nd G-4,trgeting -,my e novel vlule strtegy to more effetively omt resistne in CRC. Methods Cell lines, ulture nd regents HCT5, HCT-6, HT-9, COLO5, FHC, IMCE, SW48 were otined from the ATCC nd ell nk of Shnghi Institute of Cell Biology (Shnghi, Chin). Cells were ultured in 75- or 5- m flsks with Duleo s modified egle medium (DMEM) supplemented with % fetl ovine serum (FBS), U/ml peniillin, nd μg/ml streptomyin. Cells were inuted in 5% CO inutor t 37 C. Chemils nd regents Duleo s modified egle medium (DMEM) nd fetl ovine serum (FBS) (Gio BRL, USA); trypsin, propidium iodide (PI) nd MTT (Sigm Chemil Co., MO, USA); peniillin nd streptomyin (Sunshine Biotehnology, Nnjing, Chin); ntiodies to MCL, MDR, Survivin nd horserdish peroxidse (HRP)-linked nti-rit IgG were otined from Cell Signling (Beverly, MA,USA). Antiodies to,, LATS, HRP-linked got nti-mouse IgG were purhsed from Snt Cruz Biotehnology (Snt Cruz, CA, USA). DNA plsmids tht enode wild type humn (h, CMV-) nd TEAD vetor (prk5-my-tead ) nd,, LATS shrna were otined from Addgene (USA). Other gents were the highest qulity ville in mrket. G-4 ws synthesized in Guizhen Ao s lortory. Cell viility nd poptosis ssy Cell viility nd flow ytometry nlysis of ell poptosis ws mesured s desried previously []. Plsmid onstrution nd site-direted mutgenesis The DNA of [nuleotide (nt) position 8 to ] promoters were mplified y PCR from genomi DNA extrted from humn BxPC-3 ells nd susequently loned into pgl3-si luiferse reporter vetor (Promeg). Site-direted mutgenesis ws done using the QuikChnge Mutgenesis Kit (Strtgene) ording to the mnufture s protool.
3 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 3 of Immunopreipittion nd western lot The immunopreipittion ws done riefly s follows:, the nuler lystes ontining 5 μg protein were inuted with 5 μg primry ntiody overnight t 4 C. Fifty miroliters of protein A/G plus-grose (Snt Cruz Biotehnology) ws dded nd the omplex ws inuted t 4 C overnight. The eds were wshed three times with high slt uffer ( M Tris-HCl, ph 7.4,.5 M NCl, nd % Nonidet P-4) nd twie with lysis uffer to eliminte non-speifi inding. The immunopreipitted omplexes were relesed with smple uffer for Western nlysis. Western lot re s desried []. Immunofluoresene This nlysis ws performed s desried previously []. Colony formtion ssy This ssy ws onduted s desried previously []. Promoter nlysis Humn promoter upstrem of the trnsription strt site k DNA sequene ws otined from the wesite of Ntionl Institute of Helth ( nih.gov). Then inding sites of TEAD in the promoter were found in the promoter using the online JASPAR ( softwre. Luiferse reporter nlysis This ssy ws done s desried previously []. Briefly, ells ultured in 6-well pltes were trnsfeted for 4 h with luiferse reporter plsmid s well s with Renill luiferse expression plsmid (Promeg) using the Lipofetmine regent (Life Tehnologies). The ells were olleted 4 h fter trnsfetion, lysed nd nlysed for luiferse tivities using Dul-luiferse Reporter Assy system (Promeg) tht lredy ontins n internl ontrol detetle simultneously with the luiferse reporter HCT5 HCT-6 HT-9 COLO5 FHC IMCE 4 Protein expression(reltive to ) 3 4 HCT-5 HCT-6 HT-9 COLO5 FHC IMCE Cell viility (OD 57).5 4 IMCE HCT-6..3 Txol (µm) d expression 3 y =.794x R² =.9358 Apoptosis (%) 3 IMCE HCT expression..3 Txol (µm) Fig. nd re overexpressed in CRC ells nd ssoited with Txol sensitivity. nd expression in HCT5, HCT-6, HT-9, COLO5, FHC nd IMCE ells. Summry of nd expression from three independent experiments. The expression levels of nd were determined s in A nd quntified y densitometry. P <. ompred with FHC. Correltion nlysis etween nd expression. d Cell viility of IMCE nd HCT-6 ells fter tretment with Txol. Cells were ultured in 96-well pltes in the presene or sene of inresing onentrtions of Txol (.,.3, μm) for 48 h. Cell viility ws then determined y using the MTT ssy. e Apoptosis indued y Txol in IMCE nd HCT-6 ells. Cells were treted with vehile or Txol for 48 h, ells ( 5 ) were olleted nd inuted with Annexin V nd PI. The smples were nlyzed y flow ytometry. P <. ompred with IMCE. Dt re representtive of t lest three independent experiments. Error rs represent SD e
4 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 4 of gene. The tivity of firefly luiferse ws normlized y tht of the Renill enzyme. promoter. The PCR produts were run on 3% ethidium romide grose gel nd visulized under UV. Chromtin immunopreipittion ssy A ChIP-IT Express kit (tive motif) ws used for hromtin immunopreipittion (ChIP) nlysis of nd or CTGF/Cyr 6 promoter intertion. In rief, Cells expressing lnk vetor or were treted with % formldehyde, lysed, nd homogenized using Doune homogenizer. DNA ws shorn y sonition nd the shered hromtin ws inuted with mg of IgG (Sigm) or monolonl ntiody (Snt Cruz Biotehnology), followed y PCR y using the primers used for mplifition of the or CTGF/Cyr 6 Isoltion of nuler nd ytosoli frtions This isoltion ws operted ording to the mnufturer s instrution using Nuler nd Cytoplsmi Protein Extrtion Kit from Byotime Biotehnology In. Cylooxygense enzyme inhiition ssy COX inhiition effet ws tested y ommeril olorimetri COX inhiitor sreening ssy kit (Cymn Chem., Co., Ct# 76). In rief, 5 μl of ssy uffer, μl of heme, μl of enzyme nd μl of G-4 t onentrtion of, 3,, 3, nd μm wereddedinto -tin Reltive to Reltive to -tin Ctr Ctr Ctr Ctr sh Ctr sh * sh Reltive to -tin -tin Reltive to Reltive to -tin 3 3 Ctr d Ctr Sr shlats e ## ## Ctr sh Ctr ## *## Ctr Sr shlats DAPI Merge () () g Fig. up-regultes Expression in oth norml nd mlignnt CRC Cells. IMCE ells were trnsfeted with CMV- plsmid. Immunolotting using ntiodies ginst, were performed. p <.,*p <.5 ompred with ontrol. Immunolotting of, ws performed in HCT5 ells with knokdown of shrna. p <. ompred with ontrol. Immunolotting of nd in SW48 ells tht were trnsfeted with CMV- nd shrna suessively. p <.,ompred with ontrol; ## p <.ompred with. d nd ws deteted y western lot in HEK93T ells trnsfeted with expression vetors. p <. ompred with ontrol. e nd ws deteted y western lot in IMCE ells trnsfeted with LATS shrna. p <.,*p <.5 ompred with ontrol; ## p <.ompred with Srmle. f Immunofluoresent stining of nd in HCT5 ells tht were trnsfeted with shrna. g Co-IP nlysis of intertion of nd. Dt re representtive of t lest three independent experiments. p <. ompred with ontrol Control Sh Fluoresent intensity 4 3 Ctr f sh
5 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 5 of Lu fold hnge 4 3 ontrol Lu fole hnge Con Con Con Con WT Del Del Del+Del lu fold hnge ontrol +TEAD -8GCTTAGGACCAGTATTATGAGGAGAATTTACCTTTCCCGCCTCTCTTTCC Lu fold hnge 4 3 ## WT Del Del Del+Del d -75AAGAAACAAGGAGGGGGTGAAGGTACGGAGAACAGTATTTCTTCTGTTGA -7AAGCAACTTAGCTACAAAGATAAATTACAGCTATGTACACTGAAGGTAGC -65TATTTCATTCCACAAAATAAGAGTTTTTTAAAAAGCTATGTATGTATGTG -6CTGCATATAGAGCAGATATACAGCCTATTAAGCGTCGTCACTAAAACATA -55AAACATGTCAGCCTTTCTTAACCTTACTCGCCCCAGTCTGTCCCGACGTG Rreltive mrna.5 ## -5ACTTCCTCGACCCTCTAAAGACGTACAGACCAGACACGGCGGCGGCGGCG -45GGAGAGGGGATTCCCTGCGCCCCCGGACCTCAGGGCCGCTCAGATTCCTG -4GAGAGGAAGCCAAGTGTCCTTCTGCCCTCCCCCGGTATCCCATCCAAGGC WT Del Del Del+Del e -35GATCAGTCCAGAACTGGCTCTCGGAAGCGCTCGGGCAAAGACTGCGAAGA -3AGAAAAGACATCTGGCGGAAACCTGTGCGCCTGGGGCGGTGGAACTCGGG -5GAGGAGAGGGAGGGATCAGACAGGAGAGTGGGGACTACCCCCTCTGCTCC -CAAATTGGGGCAGCTTCCTGGGTTTCCGATTTTCTCATTTCCGTGGGTAA Fold enrihment 6 4 IgG -5AAAACCCTGCCCCCACCGGGCTTACGCAATTTTTTTAAGGGGAGAGGAGG -GAAAAATTTGTGGGGGGTACGAAAAGGCGGAAAGAAACAGTCATTTCGTC -5ACATGGGCTTGGTTTTCAGTCTTATAAAAAGGAAGGTTCTCTCGGTTAGC SW48 f SW G T Deletion of TEAD response element GAGAATTT TEAD response element T A Deletion of TEAD response element TCATTCCA TEAD response element Fig. 3 (See legend on next pge.)
6 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 6 of (See figure on previous pge.) Fig. 3 inreses trnsription through intt TEAD response elements. Trnsfetion of luiferse promoter reporter into SW48 ells with or without plsmids. luiferse reporter tivity ws mesured fter 48 h. Co-trnsfetion of luiferse promoter reporter with or plus TEAD into 93 T ells; luiferse reporter tivity ws deteted fter 48 h. P <. ompred with ontrol ells. Wide type TEAD response elements nd deletion of the TEAD response elements were desried. Sequene of the promoter nd two inding sites were identified (old/underlined, upper pnel). Co-trnsfetion of luiferse promoters (wide type or deleted in the TEAD inding sites, middle) with or ontrol vetor into 93 T ells; luiferse reporter tivity ws deteted fter 48 h (lower pnel). d luiferse reporter tivity (wide type or deleted in the TEAD response elements) ws deteted fter 48 h in HCT-6 ells. e mrna levels of were determined y qrt-pcr in HCT-6 ells of d. P <.ompredwithwt, ## P <. ompred with Del or Del. f ChIP nlysis of intertion with the promoter in vivo. P <. ompred with SW48. Dt re representtive of t lest three independent experiments. Error rs represent SD Fig. 4 tivtes signling nd medites ell survivl nd olony forming ilities. PGE levels in IMCE ells trnsfeted with or without plsmid. P <. ompred with ontrol ells. MDR, Survivin, MCL protein levels determined y western lot in IMCE ells trnsfeted with or without plsmid. p <.,*p <.5 ompred with ontrol; ## p <., # p <.5 ompred with empty Vetor. Cell viility of IMCE ells trnsfeted with or without plsmid (left pnel). Cell viility of HCT5 ells trnsfeted with or without shrna (right pnel). P <. ompred with ontrol ells. d Representtive imges of spheres in IMCE ells with or without indution (top left); Representtive r grph demonstrting the sphere numers in IMCE ells with or without indution (low left). Representtive imges of spheres in HCT5 ells with ontrol nd knokdown ( shrna) (top right); Representtive r grph demonstrting the sphere numers in HCT5 ells with ontrol nd knokdown ( shrna) (low right). Sle r: 5 mm. p <. ompred with ontrol. All dt re representtive of t lest three independent experiments. Error rs represent SD d
7 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 7 of 96-well plte. The plte ws shken refully nd the sorne of eh well ws mesured t 59 nm using plte reder (VICTOR X3, PE, MA). PGE mesurement This nlysis ws onduted s desried previously []. Srth wound heling ssy This ssy ws done s desried previously []. Cell invsion ssy Invsion ssy ws onduted utilizing trnswell hmers following mnufturer s instrutions..5 5 ells were plted onto ell ulture inserts preoted with mtrigel nd inuted with μm of G-4 or vehile for 48 h. The invded ells were stined with.5% rystl violet nd ounted in five rndom fields. Xenogrft mouse model Animl protools were pproved y the Institutionl Animl Cre nd Use Committee of the Nnjing Norml University, P.R.C.. Four-week-old mle nude mie weighing 6 g to g were quired from Shnghi Silike Lortory Animls Co. Ltd., Chinese Ademy of Sienes. Cells (5 6 ) were suutneously (S.C.) injeted into eh nude mouse under sterile environment. After tumor volume rehed mm 3 in size pproximtely, mie were rndomized into five groups s follows: ontrol, Txol, G-4, eleoxi, Verteporfin tretment group, mie were intrperitonelly dministered with ove hemils lone or their omintion t doses of,,, 3 mg/kg one every other dy. Tumor size ws mesured every 7 dys using liper, nd tumor volume ws lulted s.5 L W, with L inditing length nd W inditing width. Mie were euthnized t dys fter injetion nd speimens from ell viility (OD 57) ell viility (OD 57) Cell viility of ontrol h 48h 7h Hours fter txol (µm) tretment 4h 48h 7h Hours fter txol (µm) tretment IMCE IMCE IMCE (/sh )..3 Txol (µm) Cell viility ( of ontrol ) Cell viility ( of ontrol) Txol (µm) d e HCT8 HCT8TR f HCT-5 HCT-5(sh ) HCT-5(sh ) HCT-8 HCT-8(TR)..3 Fig. 5 medites hemoresistne in CRC ells. Cell viility of HCT5 ells treted with indited onentrtions of Txol for 4, 48, 7 h. Cell viility of IMCE ells treted with indited onentrtions of Txol for 4, 48, 7 h. Cell viility of IMCE ells nd IMCE ells with trnsfetion nd treted with indited onentrtions of Txol for 7 h. d Cell viility of HCT5 ells, HCT5 ells with shrna or shrna trnsfetion nd treted with indited onentrtions of Txol for 7 h. e Cell viility in HCT8 nd Txol-resistnt HCT8 (HCT8 TR) ells under the tretment of Txol t different onentrtions. p <. ompred with HCT8 ells. f Immunolotting for nd ws performed in HCT8 nd Txol-resistnt HCT8 (HCT8 TR) ells. Dt re representtive of t lest three independent experiments. Error rs represent SD
8 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 8 of representtive tumor tissue were ut with rzor lde nd frozen for western lot nlysis of nd expression. The mie were weighed every 3 dys nd were losely monitored for signs of toxiity. Sttistil nlysis The vlues re expressed s the mens ± SD from different experiments. The differenes in the mens etween eh group were tested y one-wy ANOVA followed y Student Newmn Keuls test (omprisons etween multiple groups); p <.5wsonsidered sttistilly signifint. Results nd were overexpressed in CRC ells nd ssoited with Txol sensitivity Both nd ply importnt roles in ner development [4 ]. But whether there is reltionship etween nd expression in oloretl ner ells (CRCs) remins unknown. To ddress this question, western lot ws onduted to detet their expressions in one norml, one immortlized oloretl epithelil ell line nd four CRC ell lines. As shown in Fig., oth nd levels were low in oth norml nd immortlized ells (FHC nd IMCE), ut they were signifintly higher in four CRC ell lines exmined. We lso found tht HCT5/HCT-6/ HT-9/COLO5 ells, whih expressed high levels of protein, lso exhiited high levels of protein. FHC/IMCE ells expressed low levels of protein onomitnt with low levels of protein (Fig. ). Sttistil nlysis showed tht the oeffiient of orreltion (R) ws.966 (Fig. ). These dt indited tht nd were up-regulted nd highly ssoited in CRC ells. To determine if oth nd were involved in Txol sensitivity, we susequently exmined the responses of ell lines IMCE nd HCT-6, representing low nd high nd levels, respetively, Cytosol Nuler DAPI DAPI Ctr G-4 Ctr G-4 Control G-4 Reltive to -tin or Lmin A p- (Ser 7 ) Lmin A Ctr G-4 p- p- Nuler:ytoplsmi Ctr G-4 Cytosol Nuler Fig. 6 G-4 intivtes in oloretl ner ells. Struture of G-4. G-4 tretment (6 h, μm) indues phosphoryltion in ytosol nd dereses levels in nuleus of HCT5/Tx ells. p <. ompred with ontrol. G-4 (6 h, μm) dereses nuler loliztion in HCT5 /Tx ells. suellulr loliztion ws determined y immunofluoresene stining for endogenous (green) long with DAPI for DNA (lue). Dt re representtive of t lest three independent experiments. p <. ompred with ontrol
9 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 9 of to inresing onentrtions of Txol, hemotherpeuti drug ommonly used for the tretment of ners. / -high HCT-6 hd greter ell viility nd fewer poptosis thn IMCE ells in response to Txol (Fig. d, e). The ove results supported the ide tht oth nd were involved in CRC tumor progression s well s hemotherpy sensitivity. ugmented expression in CRC ells is mjor downstrem of the Hippo pthwy. It funtions s trnsriptionl o-tivtor nd interts with TEA Domin (TEAD) DNA inding proteins to initite the expression of ell-prolifertive nd nti-poptoti genes nd promote the tumor growth [3]. The ove informtion led to the hypothesis tht might tivte pthwy y enhning expression. To onfirm this possiility, IMCE ells were trnsfeted with expression plsmid, CMV-, nd the ontrol vetor. As expeted, elevted in IMCE ells y plsmid up-regulted expression of (Fig. ). In ontrst, shrna knokdown of in HCT5 ells gretly redued protein levels (Fig. ). Moreover, in SW48 ells, overexpression indued y CMV- ws ttenuted y shrna knokdown of (Fig. ) onfirming the diret regultion of expression y. Moreover, immunofluoresene reveled tht knokdown of y shrna deresed Input IP:TEAD Ig G G TEAD G-4 TEAD 8 Cyr 6(HCT5/Tx) 8 (HCT5/Tx) Fold enrihment 6 4 IgG Fold enrihment 6 4 IgG Vehile G-4 Vehile G-4 6 fold hnge CTGF Lu 5 Ctr G-4 Cyr-6 lu fold hnge 4 Ctr G-4 Fig. 7 G-4 ( μm) distured -TEAD intertion. G-4 tretment distured the -TEAD intertion in the nuleus of HCT5/Tx ells. The -TEAD intertion ws proed in ells 4 h fter G-4 tretment nd in untreted ells using o-ip. ChIP nlysis of intertion with the Cyr 6 nd promoter in HCT5/Tx ells. ws exmined in ells 4 h fter G-4 tretment nd in untreted ells. P <. ompred with vehile group. Cyr 6 nd CTGF luiferse reporter tivity ws mesured fter tretment with G-4 for 48 h. The fold hnges in luiferse tivity were lulted y normlizing untreted ells with G-4-treted ells. Dt re representtive of t lest three independent experiments. Error rs represent SD. P <. ompred with ontrol ells
10 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge of HCT8/Tx HCT5/Tx G-4 (µm) G-4 (µm) Ctr 5 Ctr 5 Reltive to -tin HCT8/Tx HCT5/Tx Ctr 5 HCT8/Tx HCT5/Tx Vehile Vehile G Reltive to -tin.5.5 ## # ## ## Reltive to -tin.5.5 ## ## ## ## G-4 Vehile Vehile Fig. 8 (See legend on next pge.) inhiition (%) G-4 (µm)
11 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge of (See figure on previous pge.) Fig. 8 G-4 inhiited expression nd enzyme tivity. expression in HCT8 nd 5/Tx ells treted with different onentrtions of G-4 (5 μm) for 4 h. P <. ompred with ontrol ells. nd expression in HCT8 nd 5/Tx ells trnsfeted with expressing plsmids following G-4 tretment ( μm). P <. ompred with vehile group. # P <.5, ## P <. ompred with G-4 μm group. enzyme tivity inhiition y different onentrtions of G-4 t, 3,, 3, nd μm. Dt re representtive of t lest three independent experiments. Error rs represent SD expression in HCT5 ells (Fig. f). Similr oservtions were lso found in HT-9 ells (dt now shown). Colletively, these studies lerly suggested tht inresed expression in CRC ells. To exmine if expression ws medited y in primry ells, humn emryoni kidney (HEK93T) ells were used. Results showed tht HEK93T ells trnsfeted with CMV- plsmid demonstrted higher expression thn ells with ontrol vetor (Fig. d). Additionlly, western lots nlysis in LATS-disrupted immortl IMCE ells displyed inrementl expression ompred to the ontrol vetor-trnsfeted ells (Fig. e). Consequently, ould e up-regulted in severl types of ells vi expression of onstitutively tive form of or y stimultion of endogenous protein tht resulted from disruption of Hippo pthwy upstrem memers. Intertion etween nd From Fig. f, we found tht oth nd ololized in ytoplsm. So we wnt to know if they hve mutul diret intertion. To gin further insight into the reltionship etween nd expression, we onduted reiprol oimmunopreipittion (Co-IP) experiments nd found tht ould not e redily pulled down y nd ould not e pulled down y vie vers (Fig. g). This suggested tht these two proteins didn t intert with eh other. tivted trnsription through intertion with TEAD inding sites in the promoter of Hving known tht there is no intertion etween nd proteins, we next investigted whether ould regulte expression t the trnsriptionl level euse ws trnsriptionl otivtor nd ould initite the ell prolifertion nd growth [4]. Anlysis of the humn proximl promoter region revels two TEAD response elements loted round 778 to 773 (AGAATT) nd 645 to 64 (CATTCC) of se pirs upstrem of the trnsription strt site. The promoter inluding these TEAD response elements from the trnsription strt site ws loned nd fused to luiferse DNA nd loned to the pgl3 vetor nd then were trnsfeted into SW48 ells. When the plsmids were introdued into SW48 ells, we found tht tivted theluifersetivityofpromotersthreendhlf fold (Fig. 3). As hs een shown to ind to TEAD trnsription domins, we wnted to onfirm whether nd TEADs ould trnstivte promoter-luiferse onstrut in non-tumor ells. Therefore, the promoter ws o-trnsfeted with either lone or with oth /TEAD into 93 T ells, Luiferse tivities were inresed more thn three fold y, while otrnsfetion of with TEAD signifintly enhned the trnsriptionl tivity y nerly six fold (Fig. 3). This indited tht nd TEAD were oth required to indue trnsription. To exmine if the TEAD response elements in the promoter were essentil for the rousl of y, the deletion of the TEAD response elements ws generted in the promoter using site-direted mutgenesis s shown in Fig. 3. Our luiferse ssy showed tht deletion of the TEAD response elements in the promoter gretly diminished trnsriptionl tivity in 93 T ells. Similrly, in HCT-6 ells, trnsriptionl tivity ws signifintly redued, when deletion of the TEAD response elements in the promoter ws rried out. Aordingly, there ws redued mrna level fter deletion, whih ws in onert with deresed trnsriptionl tivity (Fig. 3d, e). Finlly, our ChIP ssy showed tht ould e oimmunopreipitted with the promoter DNA in vivo (Fig. 3f). These dt indited tht the intertion of with TEAD response elements ws ritil for its tivtion of trnsription. tivted pthwy nd regulted ell survivl nd olony formtion ilities It hs een shown tht is le to use n inrese of expression. We next wnted to exmine if lso inresed its downstrem effeters. Inresed expression of in IMCE ells signifintly indued its tlyzed produt PGE inrese in onert with the inrese in nti-poptoti protein MCL. Further, inresed nd sustined MDR nd Survivin expression (Fig. 4, ). To determine the iologil funtions of indution in CRC ells, we onduted severl ssys nd found tht elevted expression in IMCE ells inresed its prolifertion (Fig. 4), nd olony forming ility (Fig. 4d). In ontrst, down-regultion of
12 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge of 4 4 Apoptosis(%) 3 Apoptosis (%) 3 Ctr Txol G-4/Tx Ctr Txol G-4/Tx HCT8/Tx HCT5/Tx 3 olony numers Ctr Txol G-4/Tx 4 h h 8 wound losure (%) 4 h 4h Ctr Txol G-4/Tx 3 invded ells Fig. 9 (See legend on next pge.) Ctr Txol G-4/Tx d
13 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 3 of (See figure on previous pge.) Fig. 9 G-4 ( μm) indued poptosis nd suppressed ell olony formtion, migrtion nd invsion. Flow ytometri nlysis for poptosis. HCT8/Tx nd HCT5/Tx ells were treted with G-4 for 48 h. Txol-treted ells were used in prllel s ontrol. Effet of G-4 on ell olony formtion. HCT5/Tx ells were seeded into 6-well pltes nd 9 dys lter, the olonies were stined with rystl violet, photogrphed (upper pnel) nd ounted (lower pnel). Sle r: 5 mm. Effet of G-4 on ell migrtion in HCT5/Tx ells. Cells were seeded into 6-well pltes t 7 8% onfluene. Cell migrtion ws monitored y optil inspetion for 4 h using mirosope nd pitures were tken t nd 4 h (upper pnel) nd quntified (lower pnel). d Effet of G-4 on ell invsion in HCT5/Tx ells. Invsion ssy ws onduted utilizing trnswell hmers. The invded ells were photogrphed (upper pnel) nd quntified (lower pnel). Dt re representtive of t lest three independent experiments. Error rs represent SD. P <. ompred with Txol. G-4 nd Txol ws pplied t nd μm respetively. HCT8/Tx nd HCT5/Tx:Txol- resistnt HCT8 nd HCT5 ell lines. G-4: GCCSysm-4, Tx:Txol y shrna in HCT5 ells deresed ell viility (Fig. 4) nd gretly redued lonogeni ility (Fig. 4d). These suggested tht ws required for tumor ell survivl nd mintenne whih proly emred tivtion of signling. onferred therpy resistne in CRC ells through tivtion Expressions of nd hve een oth reported to inrese in tumor ells nd prtiipte in drug sensitivity s shown in Fig.. We next wnt to know whether -regulted ws essentil for hemotherpy response in CRC ells. HCT5 nd IMCE hd high or low levels of / expression. As shown in Fig. 5,, HCT5 ells with high / expression hd poorer response to Txol thn IMCE ells with low nd. To further exmine the diret reltionship etween / nd hemotherpy response, IMCE ells with higher / expression reveled worse response on exposure to Txol thn prentl ells (Fig. 5). In ddition, down-regultion of in HCT5 ells drstilly enhned ell sensitivity to Txol thn its prentl ells (Fig. 5d). Wht s more, in the stle Txolhemoresistnt CRC ells HCT8 (HCT8 TR), there were high expressions of nd ompred to their prentl ells, whih ws onsistent with their signifint resistne to Txol tretment (Fig. 5e, f). Furthermore, s shown in Fig. 5, when we knoked down in IMCE () ells (i.e., IMCE(/sh)), they eme more sensitive to Txol tretment thn intt IMCE () ells. These results indited tht indued expression ugmented hemoresistne in CRC ells. G-4 indued phosphoryltion nd ytosol loliztion of The Hippo sde promotes phosphoryltion nd ytosoli retention of the, leding to degrdtion of, while dephosphoryltion of drives to enter the nuleus nd intert with TEA Domin (TEAD) DNA inding proteins to promote ell growth [5]. G-4 is newly developed hydrogen sulfide-relesing drug in our l with remrkle inhiition on (see struture in Fig. 6). Reently, hydrogen sulfiderelesing drugs hve een shown to exhiit inhiitory effet on the growth of humn ner ells. Considering the ove reltionship etween Hippo- nd pthwy in ner progress, we wnted to know whether G-4 hd effet of on these two pthwys. First, we tested whether G-4 ffeted the phosphoryltion sttus of in nuler nd ytosol frtions of HCT8 nd HCT5 txol-resistnt ells. We found n inrese in the level of p- in ytosoli frtions nd derese of in nuleus fter G-4 tretment (Fig. 6, Additionl file : Figure SA). The sme phenomenon ws oserved under immunofluoresene s shown in Fig. 6 nd Additionl file : Figure SB. These dt demonstrted tht G-4 ould potently intivte y induing phosphoryltion nd ytosol loliztion. G-4 impired -TEAD omplex in CRC ells After onfirming the effet of G-4 on loliztion, we next exmined the intertion etween nd TEAD. Thus, we first verified the existene of -TEAD intertion in HCT8 nd 5/Tx ells nd tested the effet of G-4 tretment on them. To exmine the existene of -TEAD intertion, we dopted oimmunopreipittion (o-ip) ssys. In this ssy, TEAD ws preipitted from the nuler frtion y n nti-tead ntiody nd the presene of in the preipitte ws monitored using nti- ntiody in the finl immunolot. With the id of this tehnique, we disovered -TEAD intertion in the nuler frtion of HCT8 nd 5/Tx ells (Fig. 7, Additionl file : Figure SA) nd next found tht tretment with G-4 onspiuously redued the mount of reovered in the immunopreipittes of TEAD, inditing tht G-4 lerly redued the TEAD intertion. Therefore, we ore out the intertion etween nd TEAD in HCT8 nd 5/Tx ells nd identified G-4 s n inhiitor trgeting the physil intertions etween nd TEAD. To further understnd the role of /TEAD trnsriptionl tivity in the effet of G-4 on HCT8 nd 5/Tx ells, we ompred the level of DNA inding tivity in ontrol ells with tht of G-4-treted ells. Consistent with previous oservtion of redued intertion etween nd TEAD, our ChIP ssy showed signifint derese in the mount of tht ws oimmunopreipitted with the Cyr6 promoter
14 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 4 of DNA in G-4-treted ells ompred to the untreted ells (Fig. 7, Additionl file : Figure SB). Furthermore, we found tht signifintly tivted the luiferse tivity of oth Cyr6nd CTGF promoters (Cyr6-lu or CTGF-lu) in ontrol ells, wheres tretment with G-4 olished s tivtion of the Cyr6 nd CTGF promoters (Fig. 7). wound losure (5%) in omprison with tht of Txol group (65%) for 4 h in HCT5/Tx ells (Fig. 9). Similr results were oserved using HCT8/Tx ells (Additionl file 3: Figure S3C). The results from hmer invsion ssy demonstrted tht HCT5/Tx ell invsion ws signifintly deresed y ~5% upon G-4 ttenuted expression nd intivted enzyme tlyztion plys n importnt role in oth inflmmtory nd ner proess. Beuse G-4 hs een shown to exhiit signifint nti-inflmmtory properties with inhiition of [6], we wnt to know whether it hs effet on expression in ner ells. As shown in Fig. 8, expressed t high level in untreted HCT8 nd 5/Tx ells. Upon G-4 tretment, signifint redution of expression ws oserved ompred to the G-4-untreted ells in onentrtion-dependent mnner. Considering the inhiition of G-4 might result in low expression, we use -expressing vetors to reverse the low level of. FigURE 8 showed tht fter trnsfetion, level ws inresed to high level omprle to the pretretment sitution, while the low expression did not hnge signifintly following inrese. These dt suggested tht G-4 ffeted expression independent of its inhiitory tivity. Further enzyme inhiition ssy ws rried out to determine whether it hd diret inhiitory effet on enzyme. As shown in Fig. 8, G-4 inhiited enzymes in dose-dependent mnner. Colletively, G-4 ffeted not only expression t posttrnsriptionl level ut lso enzyme tlyti tivity. Together with the ove-mentioned intivtion, G-4 n e identified s dul inhiitor of nd. Reltive mrna expression.5.5 G CTGF Cyr 6 MCL MDR Survivin Bl-xL XIAP tr G-4 G-4, dul inhiitor of nd, inresed poptosis nd inhiited migrtion/invsion Now tht G-4 exhiited hrteristis of dul inhiition on nd, we next sought to test its impt on resistnt HCT8 nd 5/Tx ells. As shown in Fig. 9, Txol used poptosis in 6% of HCT8/Tx ells nd 9% of HCT5/Tx ells. G-4/Txol inresed the poptosis perentge from 6% to 3% in HCT8/Tx nd from 9% to 34% in HCT5/Tx ell ultures respetively. We lso found tht their omintion hd similr effets on deresing ell viility, more effiious thn Txol in HCT8 nd 5/Tx ells (Additionl file 3: Figure S3A). Coinidently, omintion of G-4 nd Txol hmpered the lonogeni formtion, resulting in remrkle deline in the numer of olonies (Fig. 9, Additionl file 3: Figure S3B). In ell migrtion nd invsion ssys, results showed tht G-4/Txol mrkedly inhiited the -tin Reltive to Ctr G-4 CTGF Cyr 6 MCL MDR Survivin Bl-xL XIAP Fig. G-4 ( μm) hnged the expression of downstrem effetors. Cells were treted with G-4 for 4 h nd expressions of CTGF, Cyr6, MCL, MDR, Survivin, Bl-xL, XIAP were determined y quntittive RT-PCRndwerenormlizedtoontrol. Protein levels of CTGF, Cyr6, MCL, MDR, Survivin, Bl-xL, XIAP were onfirmed y Western lot. Dt re representtive of t lest three independent experiments. Error rs represent SD. P <. ompred with ontrol
15 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 5 of omintion tretment ompred to Txol lone (Fig. 9d). The similr results were otined using HCT8/Tx ells (Additionl file 3: Figure S3D). These results suggest tht G-4 is ple of inhiiting ell growth nd moile ilities of HCT8 nd 5/Tx ells nd overoming its resistne ginst Txol. G-4 hnged downstrem effetors of nd To investigte the underlying moleulr mehnism of the nti-resistne properties of G-4, we exmined the expression of downstrem effetors utilizing reltime PCR nd western lot. Figure, reveled tht the mrna nd protein levels of CTGF, Cyr6, MCL, MDR, Survivin, Bl-xL, XIAP were oviously deresed y G-4. nd were required for the effet of G-4 nd ted synergistilly to overome the resistne of HCT8 nd 5/tx ells To determine whether the nd were the ritil determinnts of drug-indued resistne in these ells, we ssessed the effets of nd expressing vetors on poptosis indued y G-4. The or G-4 G-4 -tin Reltive to.5.5 -tin Reltive to.5.5 -tin Reltive to * Reltive to -tin * 3 G-4 4 G-4 Ctr h 4h 48h 7h Ctr h 4h 48h 7h Trnsfetion time Trnsfetion time Ctr sh Apoptosis (%) Apoptosis (%) 3 Ctr sh G-4 HCT8/Tx G-4 HCT5/Tx d Apoptosis(%) 3 ##&& Ctr Tx T+V T+C T+G Reltive viility.5.5 ##&& Ctr Tx T+V T+C T+G Apoptosis (%) 4 3 ##&& Ctr Tx shy shc shy/c e Reltive viility..6 ##& & Ctr Tx shy shc shy/c Fig. nd were essentil for the effet of G-4 ( μm) nd ted synergistilly to overome the resistne. Western lot nlysis of nd in or expressing vetor-trnsfeted HCT5/Tx ells treted with G-4 ( μm) for 48 h. P <. ompred with G-4. Flow ytometri nlysis for poptosisin or expressing vetor-trnsfeted ells treted with G-4 ( μm) for 48 h. Left pnel: HCT8/Tx ells; right pnel: HCT5/Tx ells. P <. ompred with G-4. Apoptosis nd ell viility of HCT5/Tx ells treted with Txol, Txol plus Verteporfin (T + V), Txol plus Celeoxi (T + C), Txol plus G-4 (T + G) respetively for 48 h. P <. ompred with Txol, ## P <. ompred with T + V, && P <. ompred with T + C. (Txol: μm; Verteporfin, Celeoxi, G-4 re ll μm). d or expression fter shrna trnsfetion for different time (upper pnel), nd western lot of nd (lower pnel) fter 48 h sh or sh trnsfetion in HCT5/Tx ells. *P <.5,P <. ompred with ontrol. e Apoptosis nd ell viility of HCT5/Tx ells fter sh or sh ws introdued. P <. ompred with Txol, ## P <. ompred with sh, && P <. ompred with sh. All dt re representtive of t lest three independent experiments. Error rs represent SD. Tx: Txol, VP: verteporfin, Cel: eleoxi, G-4: GCCSysm-4.
16 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 6 of vetor effetively up-regulted expression of the trget proteins, ompred with the ontrol vetor in G- 4-treted HCT8 nd 5/Tx ells (Fig. ). Then, these ells were exposed to G-4 gin nd were further nlyzed y flow ytometry nd MTT ssys. G-4 indued poptosis in 4% of intt HCT8/Tx ells nd 3% of HCT5/Tx ells. Trnsfetion with vetor deresed the poptosis perentge from 4% to % in HCT8/Tx ells nd 3% to 8% in HCT5/Tx ells. The vetor hd similr effets nd deresed poptosis in HCT8 nd 5/Tx ells too (Fig. ). We lso found tht oth vetors hd similr effets on inresing ell viility in HCT8 nd 5/Tx ells (Additionl file 4: Figure S4A). G-4 indued poptosis more signifintly thn either VP ( inhiitor) or Cel ( seletive inhiitor) lone in HCT8 nd HCT5/Tx ells. Simultneously, G-4 resulted in more dereses of viility of HCT8 nd HCT5/Tx ells thn VP or Cel lone (Fig., Additionl file 4: Figure S4B). Aording to these results, oth nd re importnt regultors in G-4-redued drug resistne in HCT8 nd 5/Tx ells. To further determine whether the down-regultion of nd were synergisti in poptosis of these ells, we ssessed the effets of shrna trgeting nd on poptosis sensitivity in HCT8 nd 5/Tx ells. The shrna trgeting or effetively downregulted expression of the trget proteins, ompred with the ontrol shrna (Fig. d). Then, the HCT8 ells were exposed to Txol fter shrna tretment nd were further nlyzed y flow ytometry nd MTT ssys. Trnsfetion with shrna trgeting inresed the poptosis perentge from 6% to 5% in HCT8/Tx ells nd 9% to 8% in HCT5/Tx ell ultures (Fig. e, Additionl file 4: Figure S4C). The shrna trgeting hd similr effets nd inresed poptosis in HCT8 nd 5/Tx ells too. The otrnsfetion of these two shrnas synergistilly inresed poptosis in HCT8 nd 5/Tx ells. We lso found tht oth shrnas hd synergisti effets on deresing ell viility in HCT8 nd 5/Tx ells (Fig. e, Additionl file 4: Figure S4C). Bsed on these results, nd re importnt synergisti regultors of drug resistne in HCT8 nd 5/Tx ells, whih is onsistent with G-4 s more poteny on them thn nd inhiitor lone. G-4 inhiited tumor growth in xenogrft mouse model Mle thymi nude mie, llowing for the development of suutneous tumors, were used to demonstrte whether G-4 ws le to redue the tumor volume/ weight in mie where the tumor ws lredy detetle. They were oserved losely, there were no overt signs of toxiity, sed on the verge weights of the mie in eh group t the eginning nd end of the study nd overll pperne of the treted nimls. The G-treted mie showed more onsiderle redution in tumor volume nd weight thn other treted mie (Fig., ). Compred with the ontrol group, VP, eleoxi nd tumor volume (mm 3 ) tumor weight (g) 5.5 tr Tx G-4 VP Cel 7 4 tr Tx G-4 VP Cel Dys fter tretment 7 4 dys fter tretment Ctr Tx Cel VP G-4 Fig. G-4 inhiited in vivo tumor growth. Mie were rndomly divided into five groups: ontrol, Txol, G-4/Tx, verteporfin/tx nd eleoxi/tx. HCT5/Tx ells (5 6 ) were suutneously (SC) injeted into nude mie. Mie were intrperitonelly dministered with Txol, G-4, VP, eleoxi t dose of,, 3, mg/kg lone or their omintion. Tumor size ws mesured every 7 dys using liper, nd tumor volume ws lulted s.5 L W, with L inditing length nd W inditing width. G-4 signifintly deresed in vivo tumor growth ording to the results of lulted tumor volume nd tumor weight. nd expression in G-4-treted nude mie smples. (n = 5 eh group) p <. ompred with Txol group, ## p <., && p <. ompred with VP/Tx nd Cel/Tx group respetively. Tx: Txol, VP: verteporfin, Cel: eleoxi, G-4: GCCSysm-4
17 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 7 of G-4 redued the tumor weight with perentge of 39%, 3% nd 69% respetively, suggesting tht G-4 hd n effet on tumor prolifertion in mie where the tumor ws detetle t the time of tretment. In ddition, the levels of, in mie tumors were signifintly redued y the therpy of G-4 (Fig. ). Hene, G-4 ould ountert the otined hemo-resistne in CRC tumors vi suppression of oth nd in vivo. Disussion Although tremendous progress hs een mde towrd understnding the moleulr mehnism underlying oloretl ner development nd tretment, the drugresistne is still n unonquerle rrier for suessful survivl. Therefore, the identifition of pthwy networks inluding proteins or iomrkers responsile for drug resistne is still ruil for suessful oloretl ner tretment [7]. In this study, we desried for the first time tht up-regulted expression t the level of trnsription through intt TEAD inding sites. Both nd were overexpressed in CRC ells nd ssoited with quired hemo-resistne in ell lines. inresed expression nd exerted the effet of therpy resistne. VP, novel inhiitor, effetively inhiited oth nd expression nd sensitized CRC ells to Txol tretment. Additionlly, omintion of VP nd inhiitor eleoxi more effiiently redued the viility of CRC ells thn either of them lone. Our dt point to the ide tht the -TEAD-/PGE signling pthwy is n importnt regultor of the Txol response in CRC ells, s well s tht dul nd inhiition is novel therpeuti pproh to tret drug-resistnt oloretl ners. (ylooxygense ), n induile form of the enzyme tht tlyses AA (rhidoni id) into prostglndins (PGs), is ssoited with inflmmtory diseses nd rinogenesis. Reently, is lso found to e involved in drug resistne nd poor prognosis of mny neoplsti diseses or ners [8 ]. Although hs een shown to e ssoited with drug resistne, the upstrem regultors mediting resistne remin to e further identified. Till now, few moleules hve een identified nd onfirmed s upstrem modultors of. They re NF-kppB, MAPK nd PI3K/Akt [, ]. However, in this study, we hve hrterized nd onfirmed s n upstrem regultor of. First, we hd shown tht overexpression of in IMCE ells used inresed protein levels of nd relese of its tlyzed produt PGE. Seond, we hd lso demonstrted tht knokdown of in Fig. 3 Agents tht ffet the Hippo pthwy (Nt Rev Cner. 5;5():73-79.)
18 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 8 of -overexpressing HCT5 redued the inresed COX- protein levels. Third, we hd shown tht tivted t the level of trnsription through TEAD inding site in the promoter. Reently, is lso found to medite drug resistne through regultion of survivin, l- fmily, mdr genes [3 8]. In this study, we found tht overexpression resulted in up-regultion of downstrem effeters of COX-, MDR, MCL, Survivin, ll of whih prtiipted in the progression of drug resistne. These up-regultions re omptile with previous oservtions tht is ssoited with poor prognosis in ner ptients nd the enhned metstti ility of ner ells. We lso showed tht its intivtion y G-4 effetively redued the upregultion of MDR, MCL, Survivin in -overexpressing ells. Thus, we proposed novel mehnism in whih ugments expression s well s its downstrem trgets, Survivin, MDR, MCL, nd therey up-regultes the effet of drug resistne in CRC ells. Reently, with the identifition of more regultory omponents, the Hippo pthwy seems to e fr from simple liner pthwy. Its tivity is lerly medited through rosstlk with other signling pthwys. The WNT, trnsforming growth ftor-β (TGFβ) one morphogeneti protein (BMP), Hedgehog (HH), Noth, insulin nd mtor pthwys hve ll een reported to funtionlly intert with the Hippo pthwy [9]. Although oth nd ply importnt role in ell prolifertion, survivl nd tumor mintenne, whether there is ross-tlk etween them remins poorly understood. In the present study, we found tht nd were oth overexpressed in CRC ells. up-regulted protein expression t the level of trnsription. Deletion of the TEAD inding site in the promoter diminished trnsriptionl indution y inditing tht n intt TEAD inding site ws neessry for s indution of. Also, up-regulted tlyzed produt, PGE, nd downstrem trgets MDR, MCL nd Survivin. These findings lerly indite tht Hippo- signling medites the funtions of / PGE /EPs pthwy nd is nexus of the two pthwys. Hving shown tht there ws n intertion etween Hippo- nd pthwy nd -medited hemoresistne ws regulted y signling, ws there possiility tht regulted expression vie vers? Our preliminry study showed tht in - LATS/ P P P P P P Cytoplsmi retention G-4 Nuleus TEAD TEAD MDR MCL Survivin Drug resistne Apoptosis Invsion Migrtion Fig. 4 medites drug-resistne through triggering over-expression nd regultory effets of G-4
19 Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 Pge 9 of overexpressing HepG ells, knokdown redued the expression of. In ddition, y overexpressing in -low immortl THLE-3 hepti ells, enhned levels of were ompnied y upregultion of expression (dt not shown). These results suggested tht feedk loop my exist etween nd. Hydrogen sulfide-relesing non-steroidl ntiinflmmtory drugs (HS-NSAIDs) re new lss of ompounds with potentil in lleviting gstrointestinl nd rdiovsulr dverse effets [3]. Some of them re now in linil tril II. Reently, some of HS-NSAIDs hve een shown with poteny in inhiiting the growth of humn ners. However, studies regrding the underlying mehnism hve not een undntly rried out. In this study, we found tht G-4 ould drive from nuleus to ytosol nd promote its retention in ytosol through phosphoryltion, hene ffeting the downstrem events suh s trnsription. This mehnism hs eome one of the therpeuti trgets for gents tht hve een found to distur the Hippo pthwy (Fig. 3). Additionlly, s expeted, G-4 showed diret inhiition independent of its suppression on. As result, G-4 n e identified s dul inhiitor of nd. Beuse nd re involved in drug resistne, we further disovered tht their downstrem effetors suh s CTGF, Cyr 6, MCL, MDR, Survivin, Bl-xL were down-regulted nd G-4 demonstrted remrkle effet on iologil ehviors of Txol resistnt ells (Fig. 4). Finlly, we turned to whether nd hd synergisti performne in keeping resistne. Results showed tht not only G-4 ws more potent thn VP or eleoxi ( single inhiitor of or ) in induing poptosis nd reduing viility of Txol resistnt CRC ells, ut lso omintion of sh nd exhiited dvntges over either sh or sh lone. These results point to the ide tht trgeting nd would e more effiious thn single inhiition in overoming drug resistne regrding / high expression nd G-4 ould e novel drug ndidte for suessful drug resistnt CRC tretment. Conlusions In onlusion, this study demonstrtes tht is n upstrem regultor of nd trgeting - my e potentil promising strtegy to tret drugresistnt oloretl ners. G-4 my provide promising lterntive therpeuti pproh for ner ptients who re not sensitive to or inhiitor. Dul inhiitors of nd my e of prtiulr vlue for hemotherpeuti drug resistne in tumors with high levels of / expression. Additionl files Additionl file : Figure S. G-4 intivtes in oloretl ner ells. G-4 tretment (6 h, 5,, μm) indues phosphoryltion in ytosol nd dereses levels in nuleus of HCT8/Tx ells. G-4 ( μm) dereses nuler loliztion in HCT8/Tx ells. suellulr loliztion ws determined y immunofluoresene stining for endogenous (green) long with DAPI for DNA (lue). P <. ompred with ontrol. (PDF 4 k) Additionl file : Figure S. G-4 distured -TEAD intertion. G-4 tretment distured the -TEAD intertion in the nuleus of HCT8/Tx ells. The -TEAD intertion ws proed in ells 4 h fter G-4 tretment nd in untreted ells using o-ip. ChIP nlysis of intertion with the Cyr 6 nd promoter in HCT8/Tx ells. ws exmined in ells 4 h fter G-4 tretment nd in untreted ells. P <. ompred with Vehile group. (PDF 7 k) Additionl file 3: Figure S3. G-4 ( μm) deresed viility nd suppressed ell olony formtion, migrtion nd invsion. MTT ssy for ell viility. HCT8 nd 5/Tx ells were treted with G-4 for 48 h. Effet of G-4 on ell olony formtion. HCT8/Tx ells were seeded into 6-well pltes nd 9 dys lter, the olonies were stined with rystl violet, photogrphed (upper pnel) nd ounted (lower pnel). Sle r: 5 mm. Effet of G-4 on ell migrtion in HCT8/Tx ells. Cells were seeded into 6-well pltes t 7 8% onfluene. Cell migrtion ws monitored y optil inspetion for 4 h using mirosope nd pitures were tken t nd 4 h (upper pnel) nd quntified (lower pnel). d Effet of G-4 on ell invsion in HCT8/Tx ells. Invsion ssy ws onduted utilizing trnswell hmers. The invded ells were photogrphed (upper pnel) nd quntified (lower pnel). P <. ompred with Txol. Txol ws pplied t μm in ll experiments. G-4: GCCSysm-4, Tx:Txol. (PDF 34 k) Additionl file 4: Figure S4. nd were essentil for the effet of G-4 nd ted synergistilly to overome the resistne. Cell viility nlysis in or expressing vetor-trnsfeted ells treted with G-4 ( μm) for 48 h. P <. ompred with G-4. Apoptosis nd ell viility of HCT8/Tx ells treted with onentrtions of μm Txol nd μm Verteporfin, Celeoxi, G-4 for 48 h. Apoptosis nd ell viility of HCT8/Tx ells fter sh or sh ws introdued. Tx:Txol, VP: verteporfin, Cel: eleoxi, G-4: GCCSysm-4. (PDF 66 k) Arevitions ABC: ATP-inding-ssette trnsporters; BCRP: Brest-ner-resistne protein; ChIP: Chromtin immunopreipittion; : Cylooxygense ; CRC: Coloretl ner; HCT8 nd 5/Tx ells: Txol-resistnt HCT8 nd HCT5 ells; MCL: Myeloyti leukemi; MDR/P-gp: Multidrug resistne/pglyoprotein; MRP: Multidrug-resistne protein ; TEAD: TEA domin; VP: Verteporfin; : Yes-ssoited protein Aknowledgements The uthors re grteful for hemils from Guizhen Ao lortory. Funding This work ws supported y Projet 8,773,948 supported y Ntionl Nturl Siene Foundtion of Chin, the Sientifi Reserh Foundtion for the Returned Overses Chinese Sholrs, Stte Edution Ministry (SRF for ROCS, SEM,,5,3), the Priority Ademi Progrm Development of Jingsu Higher Edution Institutions (PAPD), NSFC for Tlents Trining in Bsi Siene (Grnt Nos. J357, J5). Avilility of dt nd mterils All dt used in this study re inluded within the rtile nd dditionl files. Authors ontriutions WL, QW nd GLX oneived nd designed the study. WL, JLX, WJL, ZWH, YPH, LH, YWS, QW, YW nd YYC otined the dt. WL, QW nd GLX figured out the methodology. WL, QW, YW nd YYC onduted experiments. WL, QW, YW, YYC, GLX nd GZA nlyzed nd deoded the dt. All uthors ontriuted to the writing of the mnusript, red nd pproved the finl version.
Cos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationRoles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells
ritish Journl of Cner (23) 89, 18 191 & 23 Cner Reserh UK All rights reserved 7 92/3 $2. www.jner.om Roles of the PI-3K nd MEK pthwys in Rs-medited hemoresistne in rest ner ells W Jin 1,LWu 1, K Ling 1,
More informationRole of HCP5-miR-139-RUNX1 Feedback Loop in Regulating Malignant Behavior of Glioma Cells
originl rtile The Amerin Soiety of Gene & Cell Therpy Role of HCP-miR-19-RUNX1 Feedk Loop in Regulting Mlignnt Behvior of Gliom Cells Ho Teng 1,2, Ping Wng, Yixue Xue, Xioi Liu 1,2, Jun M, Heng Ci 1,2,
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationMicroRNA 125b promotes tumor metastasis through targeting tumor protein 53 induced nuclear protein 1 in patients with non small cell lung cancer
Li et l. Cner Cell Int (15) 15:8 DOI 1.118/s1935-15-33-x PRIMARY RESEARCH MiroRNA 15 promotes tumor metstsis through trgeting tumor protein 53 indued nuler protein 1 in ptients with non smll ell lung ner
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationRNAi Targeting CXCR4 Inhibits Tumor Growth Through Inducing Cell Cycle Arrest and Apoptosis
originl rtile RNAi Trgeting CXCR4 Inhiits Tumor Growth Through Induing Cell Cyle Arrest nd Apoptosis To Yu 1,2, Yingying Wu 2, Yi Hung 1,2, Chorn Yn 1, Ying Liu 1, Zongsheng Wng 3, Xioyi Wng 1, Yuming
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationFAK integrates growth-factor and integrin signals to promote cell migration
integrtes growth-ftor nd integrin signls to promote ell migrtion rtiles Dvid J. Sieg*, Christof R. Huk*, Dusko Ili, Cndie K. Klingeil*, Erik Shefer, Croline H. Dmsky nd Dvid D. Shlepfer* *Deprtment of
More informationRapamycin toxicity in MIN6 cells and rat and human islets is mediated by the inhibition of mtor complex 2 (mtorc2)
Dietologi (212) 55:1355 1365 DOI 1.17/s125-12-2475-7 ARTICLE myin toxiity in MIN6 ells nd rt nd humn islets is medited y the inhiition of mtor omplex 2 (mtorc2) A. D. Brlow & J. Xie & C. E. Moore & S.
More informationActivation of Akt as a Mechanism for Tumor Immune Evasion
The Amerin Soiety of Gene Therpy originl rtile Ativtion of Akt s Mehnism for Tumor Immune Evsion Kyung Hee Noh 1, Te Heung Kng 1, Jin Hee Kim 1, Sr I Pi 2, Ken Y Lin 3, Chien-Fu Hung 4, T-C Wu 4 7 nd Te
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationInhibition of mtor induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease
Inhiition of mtor indues utophgy nd redues toxiity of polyglutmine expnsions in fly nd mouse models of Huntington disese Brind Rvikumr 1,6, Corlie Vher 1,6, Zdenek Berger 1,2, Jnet E Dvies 1, Shouqing
More informationResearch Article TNF-α and IFN-s-Dependent Muscle Decay Is Linked to NF-κB- and STAT-1α-Stimulated Atrogin1 and MuRF1 Genes in C2C12 Myotubes
Hindwi Pulishing Corportion Meditors of Inflmmtion Volume 213, Artile ID 171437, 18 pges http://dx.doi.org/1.1155/213/171437 Reserh Artile nd IFN-s-Dependent Musle Dey Is Linked to NF-κB- nd STAT-1α-Stimulted
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationInsulin-like Growth Factor-binding Protein-7 (IGFBP7): A Promising Gene Therapeutic for Hepatocellular Carcinoma (HCC)
originl rtile The Amerin Soiety of Gene & Cell Therpy Insulin-like Growth Ftor-inding Protein-7 (IGFBP7): A Promising Gene Therpeuti for Heptoellulr Crinom (HCC) Dong Chen 1, Ayesh Siddiq 2, Luni Emdd
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationFates-shifted is an F box protein that targets Bicoid for degradation and regulates developmental fate determination in Drosophila embryos
ARTICLES Ftes-shifted is n F ox protein tht trgets Bioid for degrdtion nd regultes developmentl fte determintion in Drosophil emryos Juno Liu 1 nd Jun M 1,2,3 Bioid (Bd) is morphogeneti protein tht instruts
More informationTiffany A. Katz Shauna N. Vasilatos Emily Harrington Steffi Oesterreich Nancy E. Davidson Yi Huang
Brest Cner Res Tret (214) 146:99 18 DOI 1.17/s1549-14-312-9 PRECLINICAL STUDY Inhiition of histone demethylse, LSD2 (KDM1B), ttenutes DNA methyltion nd inreses sensitivity to DNMT inhiitorindued poptosis
More informationTargeting BIG3 PHB2 interaction to overcome tamoxifen resistance in breast cancer cells
Reeive Fe 13 Aepte 15 Aug 13 Pulishe Sep 13 DOI: 1.13/nomms33 OPEN Trgeting intertion to overome tmoxifen resistne in rest ner ells Tetsuro Yoshimru 1, Msto Komtsu 1, Tisuke Mtsuo 1, Yi-An Chen, Yoihi
More informationER-α36 mediates cisplatin resistance in breast cancer cells through EGFR/HER-2/ ERK signaling pathway
Zhu et l. Journl of Experimentl & Clinil Cner Reserh (218) 37:123 https://oi.org/1.1186/s134618798z RESEARCH Open Aess ERα36 meites ispltin resistne in rest ner ells through /HER2/ signling pthwy Linlin
More informationMelatonin, a novel selective ATF-6 inhibitor, induces human hepatoma cell apoptosis through COX-2 downregulation
Submit Mnusript: http://www.wjgnet.om/esps/ Help Desk: http://www.wjgnet.om/esps/helpdesk.spx DOI: 10.3748/wjg.v23.i6.986 World J Gstroenterol 2017 Februry 14; 23(6):986-998 ISSN 1007-9327 (print) ISSN
More informationThe soy isoflavone genistein promotes apoptosis in mammary epithelial cells by inducing the tumor suppressor PTEN
Crinogenesis vol. no.1 pp.1793 183, 5 doi:1.193/rin/gi131 dvne ess pulition My 19, 5 The soy isoflvone genistein promotes poptosis in mmmry epithelil ells y induing the tumor suppressor huvnesh Dve 1,,
More informationCAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY
CAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY 1 1 2 R. K. Frnk, M. W. Vorhies, nd M. M. Chengpp Summry Cuses of dirrhe, pneumoni, nd
More informationInvolvement of thioredoxin-interacting protein (TXNIP) in glucocorticoid-mediated beta cell death
Dietologi (12) 55:148 157 DOI 1.7/s125-11-2422-z ARTICLE Involvement of thioredoxin-interting protein (TXNIP) in gluoortioid-medited et ell deth E. Reih & A. Tmry & R. Vogt Sionov & D. Melloul Reeived:
More informationPlant Physiology Preview. Published on February 21, 2017, as DOI: /pp
Plnt Physiology Preview. Pulished on Ferury 21, 217, s DOI:1.114/pp.16.1928 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 Running title: Spliing regultor STA1 in het stress dpttion Corresponding Author:
More informationTargeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma
Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn.216.29 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationJeffrey D. Coleman, 1 Jerry T. Thompson, 1 Russell W. Smith III, 1 Bogdan Prokopczyk, 2,3 and John P. Vanden Heuvel 1,3,4. 1.
PPAR Reserh Volume 213, Artile ID 121956, 11 pges http://dx.doi.org/1.1155/213/121956 Reserh Artile Role of Peroxisome Prolifertor-Ativted Reeptor β/δ nd B-Cell Lymphom-6 in Regultion of Genes Involved
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationOsteoblasts secrete Cxcl9 to regulate angiogenesis in bone
Reeived 2 De 215 Aepted 9 Nov 216 Pulished 14 De 216 DOI: 1.138/nomms13885 OPEN Osteolsts serete to regulte ngiogenesis in one Bin Hung 1,, Wenho Wng 1,, Qinghu Li 1,, Zhenyu Wng 1,BoYn 1, Zhongmin Zhng
More informationInhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity
2 Nture Pulishing Group http://www.nture.om/nturemediine Inhiiting Stt3 signling in the hemtopoieti system eliits multiomponent ntitumor immunity Mrin Kortylewski 1,4, Miej Kujwski 1,4, Tinhong Wng 2,
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationF-FDG PET/CT for Monitoring the Response of Breast Cancer to mir-143-based Therapeutics by Targeting Tumor Glycolysis
Cittion: Moleulr Therpy Nulei Aids () 5, e57; doi:.8/mtn..7 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn F-FDG PET/CT for Monitoring the Response of Brest Cner to -Bsed Therpeutis
More informationLETTERS. Chfr is required for tumor suppression and Aurora A regulation
25 Nture Pulishing Group http://www.nture.om/nturegenetis Chfr is required for tumor suppression nd Auror A regultion Xiohun Yu 1, Ktherine Minter-Dykhouse 1, Liviu Mlurenu 2, Wei-Meng Zho 3, Dongwei Zhng
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationARTICLE. I. Chopra & H. F. Li & H. Wang & K. A. Webster
Dietologi (212) 55:783 794 DOI 1.17/s125-11-247-y ARTICLE Phosphoryltion of the insulin reeptor y AMP-tivted protein kinse (AMPK) promotes lignd-independent tivtion of the insulin signlling pthwy in rodent
More informationN6-methyladenosine (m6a) is the most prevalent messenger
https://oi.org/8/s556-8-7- m 6 A mrna methyltion regultes tivity to promote the prolifertion n tumorigeniity of enometril ner Jun Liu,,, Mrk A. Ekert,, Bryn T. Hr,,, Song-Mei Liu,, Zhike Lu,, Kngkng Yu,,5,
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationEffects of Plant Sphingolipids on Inflammatory Stress in Differentiated Caco-2 Cells
Journl of Oleo Siene Copyright 2017 y Jpn Oil Chemists Soiety doi : 10.5650/jos.ess17171 J. Oleo Si. 66, (12) 1337-1342 (2017) NOTE Effets of Plnt Sphingolipids on Inflmmtory Stress in Differentited Co-2
More informationThe histone H3K9 methyltransferase SUV39H links SIRT1 repression to myocardial infarction
Reeived 8 Jun 6 Aepted Fe 7 Pulished Mr 7 DOI:.8/nomms9 OPEN The histone HK9 methyltrnsferse SUV9H links SIRT repression to myordil infrtion Gung Yng,, Xinyu Weng,,,, Yuho Zho, Xinjin Zhng, Yunping Hu,
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationEpiphyseal growth plate growth hormone receptor signaling is decreased in chronic kidney disease related growth retardation
http://www.kidney-interntionl.org & 213 Interntionl Soiety of Nephrology Epiphysel growth plte growth hormone reeptor signling is deresed in hroni kidney disese relted growth retrdtion Ariel Troi 1, Dniel
More informationA1/Bfl-1 expression is restricted to TCR engagement in T lymphocytes
(3) 1, 19 17 & 3 Nture Pulishing Group All rights reserved 13-97/3 $. www.nture.om/dd /Bfl-1 expression is restrited to TCR enggement in T lymphoytes C Vershelde 1, T Wlzer, P Gli 1, M-C Biémont 1, L Quemeneur
More informationProgestin effects on cell proliferation pathways in the postmenopausal mammary gland
Wood et l. Brest Cner Reserh 213, 15:R62 http://rest-ner-reserh.om/ontent/15/4/r62 RESEARCH ARTICLE Open Aess Progestin effets on ell prolifertion pthwys in the postmenopusl mmmry glnd Chrles E Wood 1,
More informationHydrogen sulfide-induced inhibition of L-type Ca 2+ channels and insulin secretion in mouse pancreatic beta cells
Dietologi (213) 56:533 541 DOI 1.17/s125-12-286-8 ARTICLE Hydrogen sulfide-indued inhiition of L-type C 2 hnnels nd insulin seretion in mouse pnreti et ells G. Tng & L. Zhng & G. Yng & L. Wu & R. Wng Reeived:
More informationWhangarei District Council Class 4 Gambling Venue Policy
Whngrei Distrit Counil Clss 4 Gmling Venue Poliy April 2013 Whngrei Distrit Counil Clss 4 Gmling Venue Poliy Tle of ontents Introdution... 3 1 Ojetives of the poliy in so fr s promoted y the Gmling At
More informationGSK-3 is a master regulator of neural progenitor homeostasis
GSK-3 is mster regultor of neurl progenitor homeostsis Woo-Yng Kim 1, Xinshuo Wng 1, Yohong Wu 1, Brdley W Dole 2, Stish Ptel 3, Jmes R Woodgett 3 & Willim D Snider 1 The development of the rin requires
More informationPathogenesis of NSAID-induced gastric damage: Importance of cyclooxygenase inhibition and gastric hypermotility
Online Submissions: http://www.wjgnet.om/7-9327offie wjg@wjgnet.om doi:.3748/wjg.v18.i18.2147 World J Gstroenterol 12 My 14; 18(18): 2147-21 ISSN 7-9327 (print) ISSN 2219-28 (online) 12 Bishideng. All
More informationThymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy
The Phrmogenomis Journl (2001) 1, 65 70 2001 Nture Pulishing Group All rights reserved 1470-269X/01 $15.00 www.nture.om/tpj ORIGINAL ARTICLE Thymidylte synthse gene polymorphism determines response nd
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationResearch Article Thyroid Hormone Status Interferes with Estrogen Target Gene Expression in Breast Cancer Samples in Menopausal Women
ISRN Endorinology, Artile ID 317398, 8 pges http://dx.doi.org/1.1155/14/317398 Reserh Artile Thyroid Hormone Sttus Interferes with Estrogen Trget Gene Expression in Brest Cner Smples in Menopusl Women
More informationSETD1A modulates cell cycle progression through a mirna network that regulates p53 target genes
SETDA modultes ell yle progression through mirna network tht regultes p5 trget genes The Hrvrd ommunity hs mde this rtile openly vilble. Plese shre how this ess benefits you. Your story mtters Cittion
More informationANGPTL binding ANGPTL binding ANGPTL4 GST ANGPTL5 ANGPTL6 ANGPTL7. A5+LILRB2 Fc. A5+Tie-2 Fc 10,000 7,500. Tie-2 Fc LILRB2 Fc. 5,000 K d = 5.
doi:1.138/nture1195 ; Inhiitory reeptors ind ANGPTLs nd support < lood stem ells nd leukemi development Junke Zheng 1,2, Msto Umikw 1,3, Chngho Cui 1, Jiyun Li 1, Xioli Chen 1, Chozheng Zhng 1, HongDinh
More informationBRAF Inhibition Generates a Host Tumor Niche that Mediates Therapeutic Escape
See relted ommentry on pg 9 ORIGINAL ARTICLE BRAF Inhiition Genertes Host Tumor Nihe tht edites Therpeuti Espe Inn V. Fedorenko 1, Jennifer A. Wrgo, Keith T. Flherty, Jne L. essin nd Keirn S.. Smlley 1,
More informationCoadministration of a Plasmid Encoding HIV-1 Gag Enhances the Efficacy of Cancer DNA Vaccines
originl rtile The Amerin Soiety of Gene & Cell Therpy Codministrtion of Plsmid Enoding HIV-1 Gg Enhnes the Effiy of Cner DNA Vines Lure Lmriht 1, Kevin Vnvrenerg 1, Ans De Beukeler 2, Lien Vn Hoeke 2,3,
More informationARTICLES. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis
Vol 1 April 7 doi:1.13/nture57 ARTICLES Meditors of vsulr remodelling o-opted for sequentil steps in lung metstsis Gorv P. Gupt 1, Don X. Nguyen 1, Anne C. Ching 1,, Pul D. Bos 1, Juliet Y. Kim 1, Cristin
More informationAntitumor Effects of Chimeric Receptor Engineered Human T Cells Directed to Tumor Stroma
The Amerin Soiety of Gene & Cell Therpy originl rtile Antitumor Effets of Chimeri Reeptor Engineered Humn T Cells Direted to Tumor Strom Sunith Kkrl 1,2,3, Kevin KH Chow 1,2,3, Melind Mt 1,2,4, Donld R
More informationARTICLE. Keywords Lipotoxicity. MicroRNA. Pancreatic beta cells. Stearic acid
Dietologi (6) 59:7 57 DOI.7/s5639 ARTICLE Elevted irulting steri id leds to mjor lipotoxi effet on mouse pnreti et ells in hyperlipidemi vi mir35pmedited PERK/p53dependent pthwy Huimin Lu & Liuyi Ho &
More informationThioredoxin-interacting protein links oxidative stress to inflammasome activation
A rt i l e s Thioredoxin-interting protein links oxidtive stress to inflmmsome tivtion Rongin Zhou 1, Aury Trdivel 1, Bernrd Thorens 2, Inpyo Choi 3 & Jürg Tshopp 1 29 Nture Ameri, In. All rights reserved.
More informationARTICLE. Keywords ACE-2. Akita mice. Angiotensinogen. Diabetes. Heterogeneous nuclear ribonucleoprotein F. Hypertension. Renal fibrosis.
Dietologi (5) 58:44 454 DOI.7/s5-5-7-y ARTICLE Overexpression of heterogeneous nuler rionuleoprotein F stimultes renl Ae- gene expression nd prevents TGF-β-indued kidney injury in mouse model of dietes
More informationsupplementary information
DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.
More informationDocosahexaenoic acid suppresses arachidonic acid-induced proliferation of LS-174T human colon carcinoma cells
Online Sumissions: wjg.wjgnet.om World J Gstroenterol 29 Mrh 7; 15(9): 179-184 wjg@wjgnet.om World Journl of Gstroenterology ISSN 17-9327 doi:1.3748/wjg.15.179 29 The WJG Press nd Bishideng. All rights
More informationUpregulation of tissue inhibitor of matrix metalloproteinases-1 confers the anti-invasive action of cisplatin on human cancer cells
(27) 26, 5822 5827 & 27 Nture Pulishing Group All rights reserved 95-9232/7 $3. SHORT COMMUNICATION Upregultion of tissue inhiitor of mtrix metlloproteinses-1 onfers the nti-invve tion of ispltin on humn
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationEstrogens and androgens affect human luteal cell function
Estrogens nd ndrogens ffet humn lutel ell funtion Ann Trope, M.D., Antonio Lnzone, M.D., Federi Tieri, B.S., Federi Romni, M.D., Stefni tino, M.L.T., nd Rosnn Ap, M.D. ttedr di Fisioptologi dell Riproduzione
More informationBraf V600E cooperates with Pten loss to induce metastatic melanoma
Brf V6E oopertes with Pten loss to indue metstti melnom Dvid Dnkort 1,5,6, Dvid P Curley 2,6, Roert A Crtlidge 1, Betsy Nelson 2, Anthony N Krnezis 3, Willim E Dmsky, Jr 2, Mingjin J You 4,5, Ronld A DePinho
More information