A1/Bfl-1 expression is restricted to TCR engagement in T lymphocytes

Transcription

1 (3) 1, & 3 Nture Pulishing Group All rights reserved 13-97/3 $. /Bfl-1 expression is restrited to TCR enggement in T lymphoytes C Vershelde 1, T Wlzer, P Gli 1, M-C Biémont 1, L Quemeneur 1, J-P Revillrd 1, J Mrvel nd N Bonnefoy-Berrd*,1 1 Lortoire d immuno-phrmologie Lortoire d immuno-poptose, INSERM U3, Centre d étude et de Reherhe en Virologie et Immunologie, 1 Ave Tony Grnier 93 Lyon edex 7, Frne * Corresponding uthor: N Bonnefoy-Berrd, INSERM U3, Centre d Étude et de Reherhe en Virologie et Immunologie, 1 Ave Tony Grnier, 93 Lyon Cedex 7, Frne. Tel: ; Fx: ; E-mil: onnefoy@ervi-lyon.inserm.fr Reeived 18.9.; revised.3.3; epted.3.3 Edited y A Strsser Astrt We nlyzed regultion of the prosurvivl Bl- homologue, following T-ell reeptor (TCR) or ytokine reeptor enggement. Ativtion of CD + or CD8 + T ells y ntigeni peptides indued n erly ut trnsient IL--independent expression of nd Bl-xl mrna nd proteins, wheres expression of Bl- ws delyed nd required IL-. Cytokines suh s IL-, IL-, IL-7 or IL-1 prevented poptosis of tivted T ells tht effet eing ssoited with the mintenne of Bl-, ut not of expression. However, restimultion of tivted or posteffetor T ells with ntigeni peptide strongly upregulted mrna nd mintined protein expression. IL-, IL-7 or IL-1 lso prevented ell deth of nive T ells. In those ells, ytokines upregulted Bl-, ut not expression. Therefore, in nive, tivted nd posteffetor T ells, expression of is dependent on TCR ut not on ytokine reeptor enggement, inditing tht is differently regulted from Bl-xl nd Bl-. (3) 1, doi:1.138/ sj.dd.1 Keywords: T lymphoytes; poptosis; ellulr tivtion; ; Bl- Arevitions: Ag, ntigen; MA, monolonl ntiody; h, hour; TCR, T-ell reeptor; NP, nuleoprotein Introdution In wild-type nimls, the survivl of T lymphoytes is refully regulted, nd norml survivl of lymphoytes ontriutes to the development of immune defiieny, lymphoid mlignny nd utoimmune diseses. 1 Bl- fmily memers re importnt regultors of poptosis nd ply n essentil role in the mintenne of homeostsis in the immune system. In the periphery, nive CD + or CD8 + lymphoytes my survive for long periods, up to severl months in mie, in the sene of overt exposure to ntigens (Ag). Their survivl depends on the enggement of T-ell reeptors (TCRs) y seleting MHC proteins 3 nd on the vilility of ytokines, espeilly IL-7. 8 A link etween T-ell survivl nd the Bl- protein hs een provided following the demonstrtion tht IL- 7 plys n essentil role in loking poptosis during differentition nd tivtion of T lymphoytes. Indeed, the onstitutive expression of Bl- protein ws demonstrted to resue T-ell numers nd funtion in IL-7-reeptor-defiient mie. 9,1 However, the role of Bl- fmily memers in the ontrol of nive T ells survivl is still not fully understood. Mie invlidted for l- gene in lymphoytes showed rpid deline of peripherl T ells fter weeks of ge prtly euse of shortened lifespn of mture T ells. 11 In ontrst, the sene of l-x ffets the lifespn nd poptosis of developing immture lymphoid ells rther thn survivl of their mture ounterprts. 1 In response to Ags, signls trnsdued y enggement of TCR nd ostimultory moleules drive the entry of T ells into the ell yle, the expression of ytokine reeptors nd the prodution of ytokines. Cytokines will t in n utorine fshion to indue further divisions of tivted T ells. However one tivted, T ells re short lived nd only minority of effetor T ells survive to eome memory T ells. Anlysis of Bl- nd Bl-xl proteins showed tht their expression is downregulted t the pek of the T-ell response, just efore they died in vivo, 13,1 wheres memory ells persisting fter lerne of Ag show upregultion of oth Bl- nd Bl-xl gin Among the propoptoti Bl- fmily memers, Bim seems to ply ritil role in the deth of mture T ells. Indeed oth resting nd tivted T ells, from Bim-defiient mie re resistnt to ytokines withdrwl, 18 nd Bim defiieny prevents deletion of superntigen-tivted T ells oth in vitro nd in vivo. 1 Interestingly, Bim defiieny ws demonstrted to restore norml lifespn to l- / T ells following ytokine deprivtion. 19 Altogether, those studies indite tht deth of T ells following ntigeni stimultion or ytokine deprivtion is lrgely dependent on Bim, nd tht the rtio of Bim to Bl- is ruil for their survivl. In this pper we hve nlyzed the regultion of, n ntipoptoti memer of the Bl- fmily, following TCR nd ytokine reeptors enggement in oth nive nd Ag-tivted T ells. ws originlly identified s GM-CSF-induile gene produt. It is expressed in hemtopoieti ell linege inluding T nd B ells, mrophges, dendriti ells nd neutrophils.,1 shres mny properties with Bl- nd Bl-xl. Like these proteins, n heterodimerize with propoptoti proteins suh s Bx or Bid 3 nd ws shown to derese ell deth when trnsfeted into ell lines. In B lymphoytes, expression inreses when immture murine B ells trnsit to the stge of long-lived

2 1 regultion in T ells mture B ells. 7 Moreover, it hs een shown tht CD stimultes the expression of mrna in primry murine B ells nd in WEHI 31 ells, nd tht -trnsdued WEHI 31 ells hve signifintly inresed survivl rte in the presene of nti-igm. Expression of is lso regulted during T-ell development, 8 with strong expression in CD + CD8 + thymoytes nd moderte level in oth CD CD8 nd CD + or CD8 + single positive thymoytes. Finlly, ws shown to e rpidly indued y mitogens in n Rel-dependent mnner in peripherl lymphoytes.,9 We foused our interest on the role of TCR versus ytokine reeptors enggement in the regultion of expression. We took dvntge of oth DO11.1 nd F TCR-trnsgeni T ells tht n e stimulted in vitro nd in vivo with ntigeni peptides, to nlyze expression. l-w l-xl k x l- d L3 -CD h -CD3 + -CD h Results T-ell tivtion rpidly nd trnsiently indues expression To test how expression is regulted following T-ell tivtion, splenoytes from C7BL/1 mie were stimulted in the presene of mitogeni monolonl ntiody (ma) to CD3 for 3., 7, or 8 h nd RNA nlyzed in n mapo- multiproe RNse protetion ssy (Figure 1). A low level of mrna oding for ws deteted in unstimulted ells. Stimultion with ma to CD3 rpidly indued its expression with mximum oserved t 7 h. Expression returned to the sl level t 8 h. Costimultion with ma to CD8 did not modify the level of expression or kineti, wheres in the sme experiment it inresed the expression of Bl-xl mrna (Figure 1). Multiple signling pthwys re tivted downstrem of TCR, nd n e involved in the upregultion of. or its humn homologue Bfl-1 were first demonstrted to e trnsriptionlly regulted y NF-kB in lymphoytes,,9 however, more reently expression in mst ells ws reported to e dependent on lium. 3 We oserved tht PMA lone effiiently inresed mrna in T lymphoytes, wheres ionomyine lone only slightly inresed expression (two fold). However, ionomyine synergized with PMA for indution of expression (Figure 1). As expeted, expression of mrna indued y stimultion with ma to CD3 nd CD8 is prevented y the protesome inhiitor MG13, whih inhiits NF-kB tivtion. 31 Expression of is lso prevented y EDTA nd CsA (Figure 1), suggesting tht oth NF-kB- nd lium-dependent signls re required for expression in lymphoytes. TCR enggement y ntigeni peptide in vitro indues expression in nive T ells We next studied expression following ntigeni stimultion, in oth CD8 + nd CD + T ells. Splenoytes from F TCR-trnsgeni mie were stimulted with NP8 peptide (1 nm) lone or in the presene of exogenous IL- or loking nti-il- ma. CD8 + T ells were then purified nd mrna levels for, Bl-xl nd Bl- were nlyzed (Figure ). Peptide stimultion mrkedly indued the expression of Fold inrese Fold inrese h -CD3 h med PMA iono PMA+ iono 7h -CD3 + -CD8 mrna oding for with mximum t h (B-fold). Expression returned to sl level t 8 h. Similr to, Blxl mrna ws trnsiently upregulted y peptide stimultion lone in CD8 + T ells. Addition of exogenous IL- or inhiition of IL--dependent signls y ntgonisti nti-il- ma did not modify the kineti of or Bl-xl mrna expression (Figure ). In ontrst, the expression of Bl- mrna ws only minimlly indued y peptide lone, ut ws upregulted h h - l-xl l- MG13 EDTA CsA 7h -CD3 + -CD8 Figure 1 Expression of, Bl-xl nd Bl- mrna in T-ell tivtion. Purified C7BL/1 T ells were stimulted with () nti-cd3 lone (1 mg/ml) or () in omintion with nti-cd8 ( mg/ml). At different times, mrna were extrted from purified T ells nd levels of mrna oding for, Bl-xl nd Bl- were mesured y RNse protetion ssys. Amounts of mrna were normlized using the L3 internl ontrol. Normlized results re expressed s fold inrese from vlues otined t h. Results shown re representtive of three independent experiments. () Purified T ells were stimulted with PMA ( ng/ml) or ionomyine (1 mm) or oth in omintion, or with nti-cd3 + nti-cd8 in the presene of MG13 (1 mm), or EDTA (1 mm) or CsA (.1 mg/ml). After 7 h of ulture, mrna were extrted nd nlyzed y RNse protetion ssys s desried efore. Results re expressed s men7s.e.m. of three independent experiments

3 regultion in T ells 11 l-xl l- L3 peptide h peptide + IL h peptide + SB h with mximum t 9 h, nd required the presene of exogenous IL-, onfirming the mrna expression kineti shown in Figure. Fold inrese 3 1 Bl-xl Bl Peptide Fold inrese 1 1 DO DO11.1 IL--/ Figure Expression of, Bl-xl nd Bl- mrna in CD8 + T ells following peptide stimultion in vitro. () Splenoytes from F mie were stimulted with NP8 peptide (1 nm) lone or in the presene of exogenous IL- ( ng/ml) or in the presene of the loking nti-il- ma SB ( ng/ml). At different times mrna were extrted from purified CD8 + T ells using the Trizol method. () Purified CD + T ells were stimulted with OVA peptide s desried in Mteril nd Methods. At the indited times, mrna were extrted using the Trizol method. Levels of mrna for, Bl-xl nd Bl- were mesured y RNse protetion ssys. Amounts of mrna were normlized using the L3 internl ontrol. Normlized results re expressed s fold inrese from vlues otined t h in () nd vlues otined t h with mrna from DO11.1 mie in (). Results shown re representtive of three () or two () independent experiments Peptide + IL- Peptide + SB β-tin β-tin β-tin (B three fold), with delyed kineti s ompred with nd Bl-xl, when exogenous IL- is dded to peptide stimultion (Figure ). Similr kinetis of nd Bl-xl expression were oserved when CD + T ells from D11.1 TCR-trnsgeni mie were stimulted with OVA peptide (Figure ). Reinforing the ide tht IL- is not required for the upregultion of, we oserved tht OVA peptide strongly upregulted trnsription in IL- / DO11.1 mie (Figure ). protein expression, in CD8 + purified T ells, ws evluted y Western lot. protein ould not e deteted in unstimulted ells; however, following peptide stimultion ws expressed with mximum oserved etween nd 7 h (Figure 3). The expression of ws not inresed in the presene of exogenous IL- or deresed if the endogenously produed IL- ws neutrlized with loking nti-il- ma (Figure 3). In prllel, the reltive expression of Bl-xl nd Bl- proteins ws evluted y intrellulr stining nd flow ytometry nlysis (Figure 3). Similr to wht we oserved for, expression of Bl-xl ws trnsient with mximum t 8 h nd did not require IL-. Bl- protein expression ws delyed ompred to tht of nd Bl-xl, Figure 3 Expression of, Bl-xl nd Bl- proteins in CD8 + T ells following peptide stimultion in vitro. Splenoytes from F mie were stimulted with NP8 peptide lone or in the presene of exogenous IL- or the loking nti-il- ma SB. () At different times, CD8 + T ells were purified nd expression ws determined y Western lot. Amounts of loded proteins were ontrolled with nti--tin ma. Results re representtive of two independent experiments. () At different times following tivtion, splenoytes were stined for CD8, Bl-xl nd Bl-. Results show the expression of Bl-xl nd Bl- y gted CD8 + T ells. Results re expressed s rtio of MFI s indited in Mteril nd Methods, nd re expressed s the men 7 S.E.M. of three independent experiments MFI rtio MFI rtio h h 8h 7h 9h peptide peptide + IL- peptide + SB Bl Bl-xl 8 7 9

4 1 regultion in T ells Immuniztion with peptide indues expression in CD8 + T ells In order to test whether expression is lso regulted y peptide in vivo, F TCR-trnsgeni mie were injeted one i.p. with NP8 peptide ( nm) in PBS. Then we followed mrna nd protein expression in CD8 + T ells from dy to 7 nd ompred it to Bl-xl nd Bl- expression. Suh immuniztion protool leds, fter profound derese, to rpid expnsion of CD8 + T ells etween nd 7 h in spleen nd inguinl lymph nodes. The solute numer of CD8 + T ells returned pproximtely to the sl level t dy 7 (Figure ). Kineti of expression ws nlyzed t the mrna nd protein level nd ompred to tht of Bl-xl nd Bl-. Totl RNA from spleen nd inguinl lymph nodes ws extrted nd mrna expression ws nlyzed s efore y multiproe RNse protetion ssy (Figure ). As previously oserved in vitro, mrna expression ws rpidly ut trnsiently indued following peptide tivtion in vivo. Mximl expression of mrna (17-fold) ws oserved h fter immuniztion nd returned to sl level within 8 h (Figure ). Protein CD8 Reltive intensity ells x β-tin l-xl l h d h h 8h h 8h 1h 18h Bl-xl Bl- Figure Regultion of in CD8 + T ells following immuniztion with peptide. F mie were immunized with NP8 peptide. At different times fter immuniztion, ells from spleen nd inguinl lymph nodes were hrvested, ounted nd stined for CD8. () The numer of CD8 + T ells ws lulted from the totl numer of ells from spleen nd lymph nodes nd the perentge of these ells, results re expressed s men 7S.E.M. otined from six mie. () At the indited times, mrna were extrted from purified CD8 + T ells nd levels of mrna for, Bl-xl nd Bl- were mesured y RNse protetion ssys. Amounts of mrna were normlized using the L3 internl ontrol nd expressed s reltive intensities. Results re expressed s men 7S.E.M. of three independent experiments. () At the indited times, CD8 + T ells were purified nd expression ws determined y Western lot. Amounts of loded proteins hve een ontrolled with nti--tin ma. Western lot from one experiment mong two is showed. (d) Histogrms for Bl-xl nd Bl- expression, gted on CD8 + T ells, re shown. Results re expressed s rtio of MFI s indited in Mteril nd Methods nd re representtive of two independent experiments expression ws followed y Western lot. Mximl protein ws oserved 18 h fter peptide injetion in oth spleen (Figure ) nd lymph nodes (not shown). Kineti of Bl-xl mrna expression ws similr to tht of with mximum oserved h fter immuniztion, wheres Bl- mrna were not ffeted during the first 7 h following peptide injetion (Figure ). A reproduile inrese of Bl-xl protein expression ws oserved t h, wheres Bl- expression ws poorly ffeted y peptide stimultion (Figure d). All together, our results demonstrte tht in vitro nd in vivo TCR enggement y ntigeni peptide rpidly upregultes expression t oth mrna nd protein level. Regultion of mrna sutype in ntigen-tivted T ells In mie there re four genes, enoding four isoforms nmed -, -, - nd -d, of whih - is likely pseudogene. 1 We ssess the reltive proportion of -, - nd -d in resting or tivted CD8 + T ells y RT-PCR followed y restrition digestion s previously desried (Figure ). - is the mjor sutype expressed in resting CD8 + T ells, wheres - nd -d isoforms were very wekly expressed (Figure nd d). Similr pttern of expression is oserved for -, - nd -d, in resting CD + T ells s well s in B lymphoytes nd thymoytes (dt not shown). Following peptide stimultion, either in vitro (Figure ) or in vivo (Figure d), the three isoforms were upregulted, with preferentil inrese of - nd -d. Cytokines regulte Bl- ut not nd Bl-xl expression in nive CD8 + T ells As previously mentioned, oth signls medited y TCR or ytokine reeptors ply n importnt role in T-ell survivl. In greement with reent reports, 8,3, ulturing-purified nive T ells in vitro resulted in rpid ell deth tht n e prevented L3 L3 h 8 h d - -d - HPRT - -d - HPRT h 8 h reltive intensity reltive intensity d - 8 Figure Anlysis of mrna sutypes in CD8 + -tivted T ells. RNA from in vitro ( nd )orin vivo ( nd d) NP8-tivted CD8 + T ells were sujeted to Rnse protetion ssys ( nd ) or to RT-PCR followed y BglII+NsiI digestion ( nd d). The nds orresponding to - (73 p), -d ( p) nd - (71 p) re quntified s desried in Mterils nd Methods. Expression of eh sutype efore tivtion t the indited time is normlized using HPRT s internl ontrol, nd expressed s reltive intensities. Results shown re representtive of two independent experiments

5 regultion in T ells 13 y ytokines suh s IL- nd IL-7. In ontrst, IL- did not inhiit ell deth, wheres IL-1 only delyed ourrene of ell deth (Figure ). The expression of or Bl-xl protein ws not deteted in unstimulted nive CD8 + purified T ells (Figure 3). Those ells however expressed very low level of Bl- (Figures nd 3). None of the ytokines tested indued expression of or Bl-xl mrna or proteins (Figure nd dt not shown). In ontrst, Bl- mrna expression ws inresed in the presene of IL-, IL-7 or IL-1 (Figure ). As shown in Figure, Bl- protein expression eme rely detetle fter 8h of ulture in medium lone or supplemented with IL-, wheres the ddition of IL-, IL-7 or IL-1 inresed its expression. Of note, the upregultion of Bl- in the presene of IL-1 ws very trnsient, s ompred to wht ws oserved in the presene of IL- or IL-7. TCR ut not ytokine reeptors enggement regultes expression in tivted nd posteffetor CD8 + T ells Survivl of tivted T ells is lso dependent on the presene of growth ftors. 33,3 When F CD8 + T ells were ultured in the presene of NP8 peptide plus IL- for dys, then strved in fresh ulture medium, 9% of tivted T ells died tensity reltive in Numer of ells med. h IL IL Annexin V IL IL-1 8. h 9. 8h.8 7h l- med IL- IL- IL-7 IL-1 MFI rtio 3 1 h 1h h 8h med IL- IL- IL-7 IL-1 Figure Regultion of nd Bl- expression in CD8 + nive T ells y ytokines. CD8 + T ells purified from spleens of F mie were ultured in medium lone or in the presene of ytokines: IL- ( ng/ml), IL- (1 ng/ml), IL-7 (1. ng/ml) or IL-1 ( ng/ml). () Perentges of ded ells were mesured y nnexin V stining nd flow ytometry t,, 8 nd 7 h. () Totl mrna ws extrted from purified CD8 + T ells fter 1 h in ulture. The levels of mrna oding for nd Bl- were mesured y RNse protetion ssys. Amounts of mrna were normlized using the L3 internl ontrol nd expressed s reltive intensities. () At the indited times, splenoytes were stined for CD8 nd Bl-. Control IgG 3 were used s ontrol for Bl- stining nd results re expressed s rtio of MFI. Results show the expression of Bl- y gted CD8 + T ells. Results shown in () re representtive of three independent experiments, wheres results shown in ( nd ) re expressed s men 7S.E.M. of three independent experiments within 7 h (Figure 7). Cell deth ws ssoited with rpid derese of Bl- mrna nd protein expression (Figure 7). Addition of ytokine suh s IL-, IL-, IL-7 or IL-1 prevented poptosis (Figure 7), n effet whih is ssoited with the mintenne of Bl- mrna nd protein expression (Figure 7). After dys of tivtion, mrna ws expressed t low levels in CD8 + -tivted T ells (Figure 7 nd ). None of the ytokines tested (IL-, IL-, IL-7 nd IL-1) indued expression of mrna (Figure 7) or protein (Figure 7 nd dt not shown). However, restimultion of tivted CD8 + T ells in the presene of NP8 peptide strongly upregulted mrna expression nd prevented downregultion of protein (Figure 7). Of note, peptide stimultion downregulted Bl- mrna in tivted CD8 + T ells (Figure 7). % ded ells Fold inrese 1 8 medium IL- IL- IL-7 IL-1 h 8h 7h l h Med IL- IL- IL-7 IL-1 h Med IL- IL- IL-7 IL-1 8 h h med IL- peptide 8h l- L3 MFI rtio Bl- h h med IL- peptide h Ε-tin Figure 7 Regultion of nd Bl- in CD8 + -tivted T ells. Splenoytes from F mie were stimulted with NP8 peptide (1 nm) nd exogenous IL- ( ng/ml) for dys s desried in Mterils nd methods. Ded ells were removed nd vile ells were ultured in medium lone or in the presene of IL- ( ng/ml), IL- (1 ng/ml), IL-7 (1. ng/ml) or IL-1 ( ng/ml). () Perentges of ded ells were mesured y nnexin V stining nd flow ytometry t, 8 nd 7 h, nd re expressed s men7s.e.m. of duplite from four individul experiments. () Totl mrna ws extrted fter 8 h of ulture. The levels of mrna oding for nd Bl- were mesured y RNse protetion ssys. Amounts of mrna were normlized using the L3 internl ontrol nd expressed s men7s.e.m. of three individul experiments. Normlized vlues re expressed s fold inrese from vlues otined fter 8 h in medium lone (left). After h of ulture, ells were stined for CD8 nd Bl-. Results show the expression of Bl- y gted CD8 + T ells. Results re expressed s rtio of MFI7S.E.M. of four independent experiments (right). () Splenoytes from F mie were stimulted with NP8 peptide (1 nm) or exogenous IL- ( ng/ml) for dys, nd vile ells were ultured in medium lone or in the presene of IL- ( ng/ml) or NP8 peptide (1 nm). The levels of mrna oding for nd Bl- were mesured y RNse protetion ssys s in (left). Lystes were mde from CD8 + T ells fter h in ulture nd expression of ws determined y Western lot. Amounts of loded proteins were ontrolled with nti--tin ma (right). Results re representtive of two independent experiments

6 1 regultion in T ells h h med IL- IL-7 IL-1 peptide l-w l-xl k x l- d L3 Interestingly, similr results were otined when posteffetor CD8 + T ells were used. Those ells re CD8 + T ells purified from F TCR-trnsgeni mie 7 dys fter peptide immuniztion t stge where they eome resting, they hve lost their ex vivo ytolyti tivity ut they hve lredy quired some memory ell hrteristis, suh s n inresed pity to produe gifn in response to TCR enggement. 3 As shown in Figure 8, ytokines (IL-, IL-7 or IL-1) tht llowed their survivl (dt not shown) inresed Bl- ut not mrna expression, wheres TCR enggement highly upregulted ut not Bl- mrna. Of note, similr results were otined using memory CD8 + T ells purified from mie 1 month fter peptide immuniztion (dt not shown). Disussion Survivl of peripherl T lymphoytes is tightly regulted proess involving signls through TCR nd/or ytokine reeptors s well s ompetition with other lymphoytes for environmentl ftors. Regultion of T-ell survivl ontriutes to preserve T-ell homeostsis in norml individuls. Ativtion y Ag, whih results in trnsient expnsion of Agspeifi lones, is followed y ontrtion phse, so tht the totl numer of peripherl ells remins in homeostti equilirium. Bl- fmily memers through their pro- or ntipoptoti properties ply n essentil role in the ontrol of T-ell survivl. We hve studied expression following mitogeni or ntigeni stimultion of T ells. ws previously demonstrted to e developmentlly regulted in T ells, with high expression restrited to doule positive thymoytes. 8 We fold inrese fold inrese l- h med IL- IL-7 IL-1 h h med peptide Figure 8 Regultion of nd Bl- in CD8 + posteffetor T ells. F-mie were injeted twie t h intervl with NP8 peptide ( nm). At 7 dys fter the first injetion, mie were killed nd spleen CD8 T ells were purified nd ultured for h in the presene of medium, IL- (1 ng/ml), IL-7 (1. ng/ml), IL-1 ( ng/ml) ( nd ) or NP8 peptide (1 nm) ( nd ). Then, mrna were extrted nd levels of mrna oding for nd Bl- were nlyzed y RNse protetion ssys. Results re expressed s men 7SEM of two (for ytokine stimultion) nd three (peptide stimultion) independent experiments h report here tht protein is rpidly nd trnsiently upregulted following TCR enggement in mture peripherl T ells oth in vitro nd in vivo. Kineti of expression is very similr to tht of Bl-xl, with mximl expression of nd Bl-xl proteins oserved 8 h fter stimultion. However, in ontrst to wht ws found for Bl-xl, we did not oserve ny effet of CD8 ostimultion on expression. Bl- protein ws lso inresed following peptide stimultion ut with delyed time ourse. Moreover, wheres TCR stimultion lone is suffiient for expression of or Bl-xl, ddition of exogenous IL- is required for the lte Bl- expression. Previous studies identified nd its humn homologue fl-1 s two genes regulted y Rel/NF-kB trnsription ftor. More reently, it hs een demonstrted tht lium moiliztion indued expression in mst ells, suggesting tht other trnsription ftors my ontrol trnsription. The oservtion tht CsA strongly inhiits expression in T ells would suggest tht trnsription ftors from the NF-AT fmily 3 my lso e involved in the regultion of trnsription in lymphoytes. The present dt otined with murine T ells re likely to pply to humn T ells. Indeed, prllel experiments performed with enrihed T-ell suspensions of humn PBL stimulted with immoilized ma to CD3 showed omprle inrese of Bfl-1, the humn homologue of (dt not shown). As fr s we know this is the first demonstrtion, oth in vitro nd in vivo, tht expression is regulted during Ag-medited tivtion of peripherl mture T ells. Moreover, our results onfirm previous dt demonstrting tht Bl-xl nd Bl- re independently regulted following tivtion of nive T ells. 37 Cytokines drive oth the survivl nd the homeostti expnsion of lymphoytes, two mehnisms tht ontriute to the mintenne of T-ell popultions. The inresed survivl indued y ytokines is ssoited with inresed Bl- expression level. Indeed, IL-7 ws shown to inrese survivl of nive T ells in vitro or in vivo, 8,38 n effet ssoited with the pity of IL-7 to promote upregultion of Bl- protein. 8 Similrly, tivted T ells tht re reltively short lived n e resued from ell deth in vitro, y the ddition of ytokines suh s IL-, IL-, IL-7 or IL-1 ut lso IFN-. 33,3,39 We onfirmed tht most ytokines tht signl through the IL- reeptor ommon g-hin promote the survivl of nive nd tivted T ells. Delyed ell deth is ssoited with the pity of those ytokines to indue Bl- expression in nive CD8 + T ells or to prevent the downregultion of Bl- nd Bl-xl (dt not shown) in tivted T ells. However, only TCR enggement is le to indue mrna nd to mintin protein expression. Altogether, our results lerly demonstrte tht signls tht upregulte expression in T ells differ from those ting on Bl-xl nd Bl-. Indeed, in oth CD + nd CD8 + T ells, the expression of is driven only y enggement of TCR with speifi Ag, ut not y enggement of ytokine reeptors. The physiologil relevne of upregultion in T ells remins to e lerly defined. Our results suggest tht my e key element of TCR-medited survivl in lymphoytes. Interestingly, the reent study y Gonzlez et l. indites tht trnsgeni overexpression of - in T ells vi the lk distl promoter redues poptosis of oth resting nd

7 regultion in T ells 1 tivted T ells in vitro. Moreover, unlike Bl-, - overexpression does not inhiit S-phse entry of tivted T ells, nd therefore results in more effiient umultion of T ells fter -dy ulture period in vitro. However, whether upregultion of following ntigeni stimultion is essentil for T ells to survive s n tivted T ell nd to differentite in effetor nd memory ells in vivo remins to e demonstrted. This might e the se for B ells. Indeed, for peripherl B ells there is good orreltion etween expression following BCR enggement nd survivl. 1 Of interest lso is the demonstrtion tht memory T ells express higher level of, 17 s well s Bl-xl nd Bl thn nive T ells. And t lest for CD high CD8 + memory T ells, higher expression of those ntipoptoti genes hs een orrelted with their inresed resistne to poptosis. 17 However, it is not ler in those memory T ells whether high expression of or Bl-xl reflets rossretion of TCR with environmentl Ag or ytokine-indued upregultion. The murine genome ontins four genes oding for homologues, -, -, - nd d. 1 The oding regions mong genes re highly onserved (>9%) t the nuleotide nd mino-id sequene levels. With the exeption of -, whih my e pseudogene or gene enoding n errnt protein euse of single se-pir insertion, they ll seem to ode for funtionl proteins. 1 The three funtionl isoforms of nnot e disriminted y RNse protetion ssy or Western lot nlysis; however, it n e done y restrition digest on RT-PCR produts. 1 Contrry to neutrophils in whih -, - nd -d sutype mrna re expressed t omprle level, 1 we oserved tht the three sutypes re differently expressed in lymphoytes. The pttern of sutype mrna in lymphoytes is similr to the one previously desried in peritonel exudte mrophges, with strong expression of -, intermedite expression of -d nd very low expression of - in unstimulted ells. Following ntigeni stimultion, the differentil inrese of -, - nd -d isoforms in oth lymphoytes (Figure ) nd peritonel exudte mrophges following stimultion suggest some differenes in the regultory sequenes of these three genes. So fr, ll the funtionl studies demonstrting the ntipoptoti tivity of mouse hve een rried out with -.,9 Deletion of - gene hs een performed nd demonstrte n essentil role of - for neutrophil 3 nd mst ell survivl, 3 ut no enhnement of T-ell poptosis ws oserved in - / mie. 3 Suh oservtion might e explined y the very low expression of -, ompred to tht of other sutypes in T ells. Figure Nevertheless, ertinly euse of the high homology of the three proteins nd their expeted redundnt funtion, mie overexpressing - in their T ells showed n inresed ellulrity of lymphoid orgns. Therefore, omined inhiition of the three proteins y either gene trgeting or RNA interferene should give us some informtion on the rel ontriution of to T-ell survivl. In onlusion, we demonstrte here tht indution of expression is restrited to TCR enggement, nd therefore its expression n e lerly dissoited from tht of Bl-xl nd Bl- in peripherl T ells. The possiility tht plys role in TCR-medited survivl nd in the ontrol of T-ell homeostsis is urrently under investigtion. Mterils nd Methods Mie nd immuniztions In this study, we used wild-type nd IL--defiient mie ering trnsgeni DO11. 1 TCR, speifi for OVA I-A d on Bl/ kground; F mie, trnsgeni for TCR reognizing the (3 37) peptide (nuleoprotein, NP8) derived from the influenz virus NP in the ontext of the MHC lss I moleule H D on C7BL/1 kground nd C7BL/1 mie. All these mie were red nd mintined in mouse filities under onventionl onditions nd used t n ge of 8 weeks. For immuniztion, F TCR-trnsgeni mie were injeted in the peritonel vity with nm of the ANT//8 influenz virus nuleoprotein peptide: Al-Ser-Asn-Glu-Asn-Met-Asp-Al-Met (NP8-(3 37)) (Neo-systems lortoire, Strsourg, Frne). Control mie were either not treted or injeted with PBS lone. Cytokines nd ntiodies Humn ril- ws otined from Chiron (Frne, Suresnes). Murine ril-, nd humn ril-7 nd ril-1 were purhsed from TEBU (Le Perry en Yvelines, Frne). Peridinin hlorophyll- protein (PerCP)-onjugted ntimouse CD8 (3-.7), PE-nti-murine Bl- (3F11), IgG1 ontrol isotype, nti-mouse IL- ma (SB) nd nti-mouse CD8 (CD8.) were from BD Phrmingen (Le Pont de Clix, Frne). FITC-onjugted nti-humn Bl-xl (7B.) nd IgG3 ontrol isotype were otined from Clinisiene (Montrouge, Frne). Anti-mouse -tin ma (AC-1), PMA, ionomyine nd EDTA were purhsed from Sigm (St. Quentin Fllvier, Frne). MG13 ws purhsed from Cliohem (L Joll, CA, USA), nd CsA ws kindly provided y Novrtis orportion. Anti-mouse CD3 (C11) ws prepred in the lortory. Preprtion of nti-peptide ntiserum A peptide orresponding to residues 1 18 of the humn fl-1 sequene ws synthesized (Neo-systems lortoire). Rits were injeted s.. with peptide (1 mg)+cfa nd oosted every 1 dys for 1 weeks with peptide+cfa. Bleeds were sreened initilly y ELISA ginst peptide nd y Western lot nlysis of ell lystes from overexpressing ells. Serum IgG frtion ws then purified on protein G sephrose (Amershm, Sly, Frne) olumn ording to the mnufturer s instrutions. Purifition of T ells, CD8 + nd CD + lymphoytes Spleni T ells were purified y mgneti eds using negtive seletion strtegy. Briefly, ells were inuted for 3 min t 1C with mixture of ulture superntnts ontining the following rt mas nti-gr-1 (RB.8), nti-m-1 (M1/7.1) nd nti-i-a (M/11.1.). Cells were then wshed three times with medium nd inuted for 3 min t 1C with got nti-rt IgG (H+L)-oupled mgneti eds (BioMg, PerSeptive Dignostis, GB) t rtio of eds per ell. Positive ells were removed y pplition to mgnet nd entrifugtion on lyer of PANCOLL (Duther). Spleni CD8 + T ells were purified following the sme protool, with the rt mas nti-cd (GK1.), nti-gr-1 (RB.8), nti-m-1 (M1/7.1) nd nti-i-a (M/11.1.). Cell popultion purified y this method ontined 9 98% of T ells or CD8 + T lymphoytes, s ssessed y flow ytometry. CD + ells were purified y negtive seletion with immuno-olumns for CD T ells ording to the mnufturers instrutions (Cederlne/Cnd). Purity of CD ell preprtions ws typilly greter thn 93% s determined y flow ytometry.

8 1 regultion in T ells Cell ulture Purified T ells were ultured t 1 1 /ml in RPMI medium (Sigm) supplemented with 1% FSC, 1 M -merptoethnol, mm L- glutmine nd ntiiotis (1 U/ml peniillin nd 1 mg/ml streptomyin). Cells were tivted with nti-cd3 ma oted to mirotiter pltes in the sene or presene of nti-cd8 ma ( mg/ml), or tivted in the presene of PMA ( ng/ml), ionomyine (1 mm) or oth. For tivtion ssys of CD8 + T ells, splenoytes from F mie (1 1 /ml) were inuted in the presene of NP8 peptide (1 nm) plus ril- (1 ng/ml). For growth ftor withdrwl experiments, splenoytes from F mie were tivted with NP8 peptide (1 nm) plus ril- (1 ng/ml) in the presene of irrdited (3 Gy) C7BL/1 spleen ells ( 1 /ml) for dys. Then, ded ells were removed y entrifugtion on lyer of PANCOLL (Duther, Brumth, Frne), nd vile ells wshed twie nd resuspended in medium lone or supplemented with ril- ( ng/ml), ril- (1 ng/ml), ril-7 (1. ng/ml) or ril-1 ( ng/ml). For experiments with CD + ells, ells were ultured t. 1 /ml in the presene of irrdited APC (. 1 /ml) enrihed for dendriti ells in ex vivo medium (Biowhitker, MA, USA), supplemented with.8 mm L-glutmine, 1 mm sodium pyruvte, 1 non essentil mino ids, 1 M - merptoethnol, U/ml peniillin,. mg/ml streptomyin sulfte nd % hets intivted FCS. RNA preprtion nd Rnse protetion ssys Cells were lysed in TRIZOL Regent (Life Tehnologies, Cergy Pontoise, Frne). Totl RNA ws prepred following the mnufturer s instrutions. Between nd mg of totl RNA ws used in the RioQunt Multi- Proe RNse Protetion Assy System (Phrmingen). The ssys were rried out following the mnufturer s instrutions. The nds of 3 P- leled proteted proes were visulized nd quntified using PhosphoImger nd ImgQunt softwre (oth from Moleulr Dynmis, Sunnyvle, CA, USA). The length of their respetive frgments ws used to identify the trnsripts. The L3-nd intensities were used s internl stndrds. mrna sutype dignosti To distinguish -, - nd -d sutypes, DNA ws generted from RNA smple (1 mg) using Supersript premplifition (Life Tehnologies) with n oligo-dt primer. PCR ws performed on 1% of the DNA produt using either primers previously desried y Htkeym et l. 1 (forwrd primer¼aattccaacagcctccagatatg; reverse primer¼gaaacaaaatatctgcaactctgg) or HPRT primers (forwrd primer¼gtaatgatcagtcaacgggggac; reverse primer¼ccag- CCAGCAAGCTTGCAACCTTAACCA). Then PCR produt, otined with -speifi primers, ws digested with omintion of NSiI nd BGlII (Ozyme, St. Quentin Fllvier, Frne) using the mnufturer s uffer. The reltive proportion of the speifi nds representing -, - nd -d were quntified in n 8% rylmide gel y using ImgQunt softwre. Results re expressed s reltive intensities using HPRT signl s internl ontrol. Flow ytometry Bl- nd Bl-xl protein expression ws investigted y three-olor immunofluoresene fter permeiliztion of the ell memrne with Cytofix/Cytopermt kits (Phrmingen). Briefly, ells (1 1 ) were first leled with nti-cd8 ma, wshed one in phosphte-uffered sline (PBS) ontining BSA (1 g/l) nd zide.%, nd resuspended in Cytofix/Cytopermt solution. After min of inution t room temperture nd one wsh with ml of Perm/wsh uffer, ells were inuted with nti-bl-xl, nti-bl- or their ontrol isotype diluted in the Perm/wsh uffer, nd inuted for min. After wshes, ells were resuspended in PBS nd nlyzed y FACS with the CellQuest softwre. Results re expressed s MFI rtio ording to the following formul: MFI rtio ¼MFI (Bl- or Bl-xl)/MFI (ontrol isotype). Western lot nlysis Whole-ell lystes were prepred y lysing 1 1 ells in ml of Lemmli uffer. Proteins were seprted y SDS-PAGE, trnsferred on to nitroellulose memrne (Shleiher & Shuell, Equevilly, Frne) nd nlyzed y Western lot. Blots were proed with either nti-/bfl-1 A (1/1) or nti--tin ma nd ound ntiodies were deteted with HRP-onjugted got nti-rit Ig or HRP-onjugted sheep nti-mouse Ig (Amershm). An enhned hemiluminesene system (Amershm) ws used for detetion. The nds orresponding to or tin proteins were quntified fter snning using the Imge Mster softwre (Phrmingen). Mesurement of poptosis At the indited time ell deth ws evluted y nnexin V stining. Cells were resuspended in inding uffer nd inuted with FITC-onjugted nnexin V (Bender MedSystems, Austri) for min nd nlyzed y FACS with the CellQuest softwre. Aknowledgements We thnk Dr. S Fournel for her help in the preprtion of nti-/bfl-1 ntiserum. We re very grteful to A Mrçis for providing us some mrna smples s well s to Drs. B Sntner-Nnn nd E Feoktistov for experiments done with DO11.1 nd IL--/- DO11.1 mie, nd to A Shimpl for helpful disussions. This work is supported y institutionl grnts from INSERM nd dditionl support from the Assoition pour l Reherhe sur le Cner (JM nd NBB). C Vershelde is supported y fellowship from the Ministère de l Édution et de l Reherhe, T Wlzer fellowship from the Assoition pour l Reherhe sur le Cner nd L Quemeneur fellowship from the Ligue Ntionle ontre le Cner. Referenes 1. Vn Prijs L, As AK. (1998) Homeostsis nd self-tolerne in the immune system: turning lymphoytes off. Siene 8: 3 8. Cho DT, Korsmeyer SJ. (1998) BCL- fmily: regultors of ell deth. Annu. Rev. Immunol. 1: Tnhot C, Lemonnier FA, Perrnu B, Freits AA, Roh B. (1997) Differentil requirements for survivl nd prolifertion of CD8 nive or memory T ells [see omments]. Siene 7: 7. Broker T. (1997) Survivl of mture CD T lymphoytes is dependent on mjor histoomptiility omplex lss II-expressing dendriti ells. J. Exp. Med. 18: Poli B, Kunkel D, Sheffold A, Rjewsky K. (1). How lph et T ells del with indued TCR lph ltion. Pro. Ntl. Ad. Si. USA 98: Shluns KS, Kieper WC, Jmeson SC, Lefrnois L. () Interleukin-7 medites the homeostsis of nive nd memory CD8 T ells in vivo. Nt. Immunol. 1: 3

9 regultion in T ells Lntz O, Grndjen I, Mtzinger P, Di Snto JP. () Gmm hin required for nive CD+ T ell survivl ut not for ntigen prolifertion. Nt. Immunol. 1: 8 8. Rthmell JC, Frksh EA, Go W, Thompson CB. (1) IL-7 enhnes the survivl nd mintins the size of nive T ells. J. Immunol. 17: Mrskovsky E, O Reilly LA, Teepe M, Cororn LM, Peshon JJ, Strsser A. (1997) Bl- n resue T lymphoyte development in interleukin-7 reeptordefiient mie ut not in mutnt rg-1 / mie. Cell 89: Akshi K, Kondo M, von Freeden-Jeffry U, Murry R, Weissmn IL. (1997) Bl- resues T lymphopoiesis in interleukin-7 reeptor-defiient mie. Cell 89: Nkym K, Negishi I, Kuid K, Shinki Y, Louie MC, Fields LE, Lus PJ, Stewrt V, Alt FW, Loh DY. (1993) Dispperne of the lymphoid system in Bl- homozygous mutnt himeri mie. Siene 1: Motoym N, Wng F, Roth KA, Sw H, Nkym K, Negishi I, Senju S, Zhng Q, Fujii S, Loh DY. (199) Mssive ell deth of immture hemtopoieti ells nd neurons in Bl-x-defiient mie. Siene 7: Mithell T, Kppler J, Mrrk P. (1999) Bystnder virus infetion prolongs tivted T ell survivl. J. Immunol. 1: Hildemn DA, Zhu Y, Mithell TC, Bouillet P, Strsser A, Kppler J, Mrrk P. () Ativted T ell deth in vivo medited y propoptoti l- fmily memer im. Immunity 1: Gryson JM, Zj AJ, Altmn JD, Ahmed R. () Cutting edge: inresed expression of Bl- in ntigen-speifi memory CD8+ T ells. J. Immunol. 1: Gri S, DiSnto J, Stokinger B. (1999) Following the development of CD T ell response in vivo: from tivtion to memory formtion. Immunity 11: Wlzer T, Arpin C, Beloeil L, Mrvel J. () Differentil in vivo persistene of two susets of memory phenotype CD8 T ells defined y CD nd CD1 expression levels. J. Immunol. 18: Bouillet P, Metlf D, Hung DC, Trlinton DM, Ky TW, Kontgen F, Adms JM, Strsser A. (1999) Propoptoti Bl- reltive Bim required for ertin poptoti responses, leukoyte homeostsis, nd to prelude utoimmunity. Siene 8: Bouillet P, Cory S, Zhng LC, Strsser A, Adms JM. (1) Degenertive disorders used y Bl- defiieny prevented y loss of its BH3-only ntgonist Bim. Dev. Cell 1: 3. Lin EY, Orlofsky A, Berger MS, Prystowsky MB. (1993) Chrteriztion of, novel hemopoieti-speifi erly-response gene with sequene similrity to l-. J. Immunol. 11: Htkeym S, Hmski A, Negishi I, Loh DY, Sendo F, Nkym K. (1998) Multiple gene duplition nd expression of mouse l--relted genes,. Int. Immunol. 1: Zhng H, Cown-Jo SW, Simonen M, Greenhlf W, Heim J, Meyhk B. () Struturl sis of BFL-1 for its intertion with BAX nd its ntipoptoti tion in mmmlin nd yest ells. J Biol. Chem. 7: Werner AB, de Vries E, Tit SW, Bontjer I, Borst J. () Bl- fmily memer Bfl-1/ sequesters trunted id to inhiit it ollortion with pro-poptoti Bk or Bx. J. Biol. Chem. 77: Holmgreen SP, Hung DC, Adms JM, Cory S. (1999) Survivl tivity of Bl- homologs Bl-w nd only prtilly orreltes with their ility to ind propoptoti fmily memers. Cell Deth Differ. : 3. Zong WX, Edelstein LC, Chen C, Bsh J, Gelins C. (1999) The prosurvivl Bl- homolog Bfl-1/ is diret trnsriptionl trget of NF-kppB tht loks TNFlph-indued poptosis. Genes Dev. 13: Kuss AW, Knodel M, Bererih-Sieelt F, Lindemnn D, Shimpl A, Bererih I. (1999) expression is stimulted y CD in B ells nd resues WEHI 31 ells from nti-igm-indued ell deth. Eur. J. Immunol. 9: Tomyko MM, Cnro MP. (1998) Long-lived B ells re distinguished y elevted expression of. J. Immunol. 1: Tomyko MM, Punt JA, Bolvge JM, Levy SL, Allmn DM, Cnro MP. (1999) Expression of the Bl- fmily memer is developmentlly regulted in T ells. Int. Immunol. 11: Grumont RJ, Rourke IJ, Gerondkis S. (1999) Rel-dependent indution of trnsription is required to protet B ells from ntigen reeptor ligtion-indued poptosis. Genes Dev. 13: Xing Z, Ahmed AA, Moller C, Nkym K, Htkeym S, Nilsson G. (1) Essentil role of the prosurvivl l- homologue in mst ell survivl fter llergi tivtion. J. Exp. Med. 19: Hipp MS, Urih C, Myer P, Wishhusen J, Weller M, Krht M et l. () Protesome inhiition leds to NF-kppB-independent IL-8 trnstivtion in humn endothelil ells through indution of AP-1. Eur. J. Immunol. 3: Rthmell JC, Vnder Heiden MG, Hrris MH, Fruwirth KA, Thompson CB. () In the sene of extrinsi signls, nutrient utiliztion y lymphoytes is insuffiient to mintin either ell size or viility. Mol. Cell. : Vell AT, Dow S, Potter TA, Kppler J, Mrrk P. (1998) Cytokine-indued survivl of tivted T ells in vitro nd in vivo. Pro. Ntl Ad. Si. USA 9: Akr AN, Borthwik NJ, Wikremsinghe RG, Pnyoitidis P, Pilling D, Bofill M et l. (199) Interleukin- reeptor ommon gmm-hin signling ytokines regulte tivted T ell poptosis in response to growth ftor withdrwl: seletive indution of nti-poptoti (l-, l-xl) ut not pro-poptoti (x, l-xs) gene expression. Eur. J. Immunol. : Wlzer T, Mris A, Sltel F, Bell C, Jurdi P, Mrvel J. (3) Cutting edge: immedite rntes seretion y resting memory CD8 T ells following ntigeni stimultion. J. Immunol. 17: Serfling E, Bererih-Sieelt F, Chuvpilo S, Jnkevis E, Klein-Hessling S, Twrdzik T et l. () The role of NF-AT trnsription ftors in T ell tivtion nd differentition. Biohim. Biophys. At 198: Mueller DL, Seiffert S, Fng W, Behrens TW. (199) Differentil regultion of l- nd l-x y CD3, CD8, nd the IL- reeptor in loned CD+ helper T ells. A model for the long-term survivl of memory ells. J. Immunol. 1: Tn JT, Dudl E, LeRoy E, Murry R, Sprent J, Weinerg KI et l. (1) IL-7 is ritil for homeostti prolifertion nd survivl of nive T ells. Pro. Ntl. Ad. Si. USA 98: Mrrk P, Kppler J, Mithell T. (1999) Type I interferons keep tivted T ells live. J. Exp. Med. 189: 1 3. Gonzlez J, Orlofsky A, Prystowsky MB. (3) is growth-permissive ntipoptoti ftor mediting post-tivtion survivl in T ells. Blood 11: Su TT, Rwlings DJ. () Trnsitionl B lymphoyte susets operte s distint hekpoints in murine spleni B ell development. J. Immunol. 18: Kusly S, Somogyi R, Orlofsky A, Prystowsky MB. (1) Requirement of - for illus Clmette Guerin-medited protetion of mrophges ginst nitri oxide-indued poptosis. J. Immunol. 1: Hmski A, Sendo F, Nkym K, Ishid N, Negishi I, Htkeym S. (1998) Aelerted neutrophil poptosis in mie lking -, sutype of the l-- relted gene. J. Exp. Med. 188: Mtoni SE, Hsieh CS, Murphy KM, O Grr A. (1993) Dendriti ells nd mrophges re required for Th1 development of CD+ T ells from lph et TCR trnsgeni mie: IL-1 sustitution for mrophges to stimulte IFN-gmm prodution is IFN-gmm-dependent. Int. Immunol. :