original article Received 7 November 2008; accepted 2 March 2009; published online 24 March doi: /mt

Transcription

1 The Amerin Soiety of Gene Therpy originl rtile Immuniztion With Adenovirusvetored Tuerulosis Vine Provides Mrkedly Improved Protetion Over Its Counterprt Aginst Pulmonry Tuerulosis Jingyu Mu 1, Mnglkumri Jeynthn 1, Cherrie-Lee Smll 1, Xizhong Zhng 1, Elizeth Roediger 1, Xuey Feng 1, Dunn Chong 1, Jk Guldie 1 nd Zhou Xing 1 1 Centre for Gene Therpeutis, M.G. DeGroote Institute for Infetious Disese Reserh, Deprtment of Pthology nd Moleulr Mediine, MMster University, Hmilton, Ontrio, Cnd Reominnt virus-vetored vines hold gret promise for tuerulosis (TB) vintion strtegies. However, there is lk of side-y-side omprtive investigtions to disset the funtionl differenes nd support the dvntge of multivlent virus-vetored vine over its monovlent ounterprt. We previously suessfully developed monovlent denovirus (Ad)-vetored vine expressing Ag85 (AdAg85) nd demonstrted its superior protetive effiy in models of pulmonry TB. In this study, we hve developed ivlent Ad TB vine expressing Ag85 nd TB1.4 ntigens s fusion protein (AdAg85:TB1.4) nd ompred its T-ell tivting nd immune protetive effiy with tht y monovlent AdAg85. A single intrnsl (i.n.) dministrtion of AdAg85:TB1.4 indued roust T-ell responses towrd the respetive ntigens within the irwy lumen nd spleen, lthough the level of Ag85speifi T-ell responses in the irwy lumen triggered y ivlent AdAg85:TB1.4 ws lower thn tht y its monovlent ounterprt t erlier time points. Thus, single i.n. delivery of AdAg85:TB1.4 onferred mrkedly improved nd sustined level of protetion in the lung ginst Myoterium tuerulosis (M.t)hllenge over tht y AdAg85 or y onventionl BCG immuniztion with similrly indued levels of protetion in the spleen. Our results indite unique dvntge of multivlent virl-vetored TB vines for immuniztion ginst pulmonry TB. Reeived 7 Novemer 28; epted 2 Mrh 29; pulished online 24 Mrh 29. doi:1.138/mt.29.6 Introdution Pulmonry tuerulosis (TB) used y Myoterium tuerulosis (M.t) remins one of the leding infetious uses of deth. Every yer, 8 million new ses nd million deths our due to TB. 1 Control of TB is hieved y omintion of hemotherpy nd vintion. BCG (ille Clmette-Guérin) vintion ginst TB hs een implemented worldwide sine Although BCG is n effetive vine in proteting from severe forms of hildhood TB, it fils to protet ginst dult pulmonry TB. 2 This is primrily due to the ft tht BCG-medited immunity n lst only for 1 15 yers. Given the ineffetiveness of BCG vintion nd ontinuing inrese in TB inidene, during the lst dede, onsiderle efforts hve een mde to develop new genertion of TB vines tht my reple the urrent BCG vine or e used to oost nd prolong BCG-medited protetion. To dte, nerly 2 new vine ndidtes hve een developed y different reserh groups. 3 Among the new vine pltforms, geneti vetors inluding reominnt plsmid DNA nd virus vetors hve widely een utilized to deliver miroil ntigen-oding genes for the purpose of vintion. 4 These geneti vetors re potent in induing oth CD4 nd CD8 T-ell responses, whih re desired for effetive TB vintion. Hene, geneti, prtiulrly virl-vetored, TB vines hold gret promise to e used for oosting protetive immunity following BCG prime immuniztion. 5,6 Over the pst 1 yers or so, suh vetors hve een used to deliver numer of immunogeni M.t ntigens. 7 In this regrd, we were the first to hve developed monovlent, reominnt humn type 5 denovirus (Ad)-vetored TB vine expressing n immunodominnt M.t ntigen Ag85 (AdAg85). 8 We found tht intrnsl (i.n.), ut not intrmusulr, vintion with AdAg85 in mouse model provided level of protetion ginst pulmonry M.t hllenge tht ws omprle to or even etter thn tht y stndrd BCG vintion. 8,9 However, it is elieved tht when onsidered for humn pplitions, vine formultion expressing >1 immunodominnt M.t ntigens will e desired, s suh multivlent vines will e le to tivte T ells of multilonlities nd thus will likely provide etter immune protetion thn monovlent vines in genetilly diverse humn popultions. 7 Although this strtegy hs een explored with protein-sed nd plsmid DNA TB vines, 1 14 little hs een done with reominnt virlvetored TB vines. 15 Thus, how multivlent virl-vetored TB Correspondene: Zhou Xing, Rm.412-MDCL, Deprtment of Pthology nd Moleulr Mediine, MMster University, 12 Min Street West, Hmilton, Ontrio L8N 3Z5, Cnd. E-mil: xingz@mmster. Moleulr Therpy vol. 17 no. 6, june

2 Comprison of nd Adenovirus-sed TB Vines The Amerin Soiety of Gene Therpy vine my differ in T-ell tivting pilities nd whether it my onfer etter immune protetion thn its monovlent ounterprt still remin to e estlished. Bsed on our previous suess in developing nd using monovlent AdAg85 vine, in the urrent study we hve developed reominnt Ad vetor expressing two full-length M.t ntigens Ag85 nd TB1.4 (AdAg85:TB1.4) strutured in the vetor s single fusion protein (ivlent) nd evluted its ility to eliit CD8 nd CD4 T-ell responses in lol nd systemi omprtments following respirtory muosl immuniztion. Importntly, we hve lso ompred its immunogeniity nd protetive effets side y side to monovlent AdAg85. We show tht the fusion protein enoded y AdAg85:TB1.4 ws effiiently produed nd indued T-ell responses speifi for individul ntigens. More importntly, we show tht tivtion of oth Ag85- nd TB1.4-speifi T ells y AdAg85:TB1.4 immuniztion led to level of immune protetion tht ws mrkedly etter thn tht y AdAg85 or onventionl BCG immuniztion. Results Constrution nd hrteriztion of ivlent AdAg85:TB1.4 vine In n ttempt to develop even more potent vine formultion thn AdAg85, we onstruted reominnt Ad vine expressing fusion protein ontining oth full-length Ag85 nd TB1.4 ntigens linked y four mino-id linker (AdAg85:TB1.4; Figure 1). After onfirming the orret orienttion of the reominnt plsmid vetor y restrition digestion nd the orret sequenes of the genes enoding the ntigens y gene sequene nlysis, AdAg85:TB1.4 ws resued, mplified, nd titrted. As we pled the humn tissue plsminogen tivtor (tpa) signl peptide sequene in the onstrut to filitte the seretion of fusion protein from infeted ells, we next exmined the presene of oth Ag85 nd TB1.4 proteins in the ulture superntnt nd ellulr lystes of AdAg85:TB1.4-infeted A549 ells y western lotting. As ontrol, ulture superntnts nd ellulr lystes of monogeni AdAg85-infeted A549 ells were lso inluded. Using n ma speifi for Ag85, protein nd of ~3 kd ws deteted in the ellulr lystes nd superntnts of AdAg85-infeted ells (Figure 1, lnes 1 nd 5). As expeted, higher moleulr weight protein nd (~42 kd) of Ag85 ws deteted in the ellulr lystes nd ulture superntnts generted from AdAg85:TB1.4- infeted ells, resulting from the fusion of Ag85 with TB1.4 proteins (Figure 1, lnes 2 nd 4). On the other hnd, y using n ma for TB1.4, the fusion protein ontining TB1.4 (~42 kd) ws lso deteted in ulture superntnts nd ellulr lystes generted only from AdAg85:TB1.4-infeted (Figure 1, lnes 2 nd 4) ut not from AdAg85-infeted ells (Figure 1, lnes 1 nd 5). Tken together, the ove dt show tht the fusion protein ontining oth Ag85 nd TB1.4 ntigens ws suessfully produed nd sereted y AdAg85:TB1.4-infeted ells. TB1.4-speifi T-ell responses y immuniztion with ivlent AdAg85:TB1.4 vine Hving previously demonstrted tht the respirtory muosl, ut not prenterl, route of vintion with geneti virl vine provides roust protetion ginst pulmonry TB, 8,9,16 we Amp MCMV Ag85 TB kd 6 kd 5 kd 4 kd 25 kd Ori ITR pcy1ag85 4 Gly linker TB p MCMV loxp SV4 poly (A) TB1.4 Ag85 tpa signl Ad5MCMVAg85 4 glyine linker TB1.4 ntiag85 TD-17mA AdAg85-infeted A AdAg85:TB1.4-infeted A Mrker 4. Superntnt of AdAg85:TB1.4-infeted A Superntnt of AdAg85-infeted A549 5 kd 38 kd 28 kd 17 kd Lineriztion site ITR sequene SV4 poly (A) Cre HCMV Amp pbhglox E1,3Cre 3477 p ntitb hose i.n. route of immuniztion to evlute the immunogeni effet of AdAg85:TB1.4 vine in vivo. As we hve previously reported tht irwy luminl T ells hold the key to immune protetion, 9,16,17 we first exmined the ility of AdAg85:TB1.4 to indue TB1.4-speifi T-ell responses in the irwy lumen. By using TB1.4 CD8 T-ell peptide for stimultion nd intrellulr ytokine stining (ICCS), we oserved mrked level of TB1.4 ntigen-speifi IFN-γ produing CD8 T-ell responses indued in the irwy lumen t 4 nd 8 weeks following immuniztion only y ivlent AdAg85:TB1.4 ut not y monovlent AdAg85 (Figure 2). Suh irwy luminl TB1.4-speifi CD8 T-ell responses ppered muh higher t 8 weeks thn t 4 weeks (Figure 2). In ontrst, there ws only minimlly inresed ell popultion deteted in the smples of monovlent AdAg85-immunized mie (Figure 2). To ssess the systemi T-ell responses, y using the sme pproh, we nlyzed TB1.4-speifi CD8 T-ell responses in the spleen. Compred to the irwy T-ell responses y ivlent AdAg85:TB1.4 vine, the spleni responses were in generl muh smller nd displyed different kinetis. Although we deteted smll loxp 1. Superntnt of AdAg85-infeted A Superntnt of AdAg85:TB1.4-infeted A Mrker 4. AdAg85:TB1.4-infeted A AdAg85-infeted A549 Figure 1 Constrution nd hrteriztion of ivlent AdAg85: TB1.4 vine. () A shuttle plsmid vetor pcy1ag85 4 Gly linker TB1.4 ws onstruted y multiple suloning steps nd o-trnsfeted into 293 ells long with virus resue plsmid pbhgloxδe1,3cre to resue reominnt AdAg85:TB1.4 virus s detiled in Mterils nd Methods. To verify the prodution of trnsgene fusion protein in AdAg85:TB1.4-infeted ells, purified nd titered AdAg85:TB1.4 virus ws used to infet A549 epithelil ells. Cell ulture superntnts nd ell lystes were prepred nd sujeted to western lotting with n () ntiag85a ma or () ntitb1.4 ma. Amp, mpiillin; Cre, Cre reominse; HCMV, humn ytomeglovirus; ITR, inverted terminl repet; loxp, lous of rossover in P1; MCMV, murine ytomeglovirus; Ori, origin; tpa, tissue plsminogen tivtor vol. 17 no. 6 june 29

3 The Amerin Soiety of Gene Therpy Comprison of nd Adenovirus-sed TB Vines BAL TB1.4 CD8 + IFNγ Asolute numers per BAL ( 1 3 ) Asolute numers per spleen ( 1 3 ) Spleen 1 4 weeks 8 weeks TB1.4 protein stimultion Asolute numers per spleen ( 1 3 ) 15 4 weeks 8 weeks 1 5 CD8 + IFNγ + CD4 + IFNγ + Figure 2 TB1.4-speifi T-ell responses in the irwy lumen nd spleen following immuniztion with AdAg85:TB1.4. Mie were killed either t 4 or 8 weeks following immuniztion with either monovlent AdAg85 or ivlent AdAg85:TB1.4. Mononuler ells isolted from the irwy lumen () nd spleen (,) were stimulted with TB1.4 CD8 T-ell peptide (,) or reominnt TB1.4 protein () nd sujeted to intrellulr ytokine stining nd fluoresene-tivted ell sorting nlysis. Dt re presented s dot plots of perentge of CD8 + IFNγ + T ells out of totl CD8 T ells (,) or s the verge solute numers ± s.e.m. of CD8 + IFNγ + T ells per BAL () or CD8 + IFNγ + T ells per spleen () or CD4 + IFNγ + T ells per spleen () from three mie/group/time, representtive of two independent experiments. P <.5 ompred to ivlent vine; P <.1. BAL, ronholveolr lvge. kground of TB1.4-speifi CD8 T-ell responses t 4 weeks nd no kground t 8 weeks postimmuniztion with monovlent AdAg85 vine, inresed smll TB1.4-speifi CD8 T-ell responses were deteted in the spleen t these times postimmuniztion with ivlent AdAg85:TB1.4 vine nd these responses were higher t 4 weeks (Figure 2). To exmine whether AdAg85:TB1.4 immuniztion my lso tivte CD4 T ells, we exmined TB1.4-speifi CD4 nd CD8 T-ell responses in the spleen t 4 weeks y using full-length reominnt TB1.4 protein for stimultion. Indeed, upon stimultion y full-length TB1.4 protein ntigens, TB1.4-speifi IFN-γ produing CD4 T-ell responses nd to lesser extent CD8 T-ell responses were redily detetle in the splenoytes of mie immunized y ivlent AdAg85:TB1.4 (Figure 2). There ws only minimum of kground CD4 T-ell responses deteted in the ells from monovlent AdAg85-immunized mie. Strong spleni CD4 nd CD8 T-ell responses were lso oserved in the spleen of AdAg85:TB1.4-immunized mie s ssessed y enzyme-linked immunosorent spot (ELISPOT) ssy (dt not shown). These results together suggest tht strong TB1.4-speifi T-ell responses were eliited oth in the irwy nd spleen y ivlent AdAg85:TB1.4 immuniztion. Comprison of Ag85-speifi T-ell responses y immuniztion with monovlent AdAg85 nd ivlent AdAg85:TB1.4 vines Hving hrterized the pility of ivlent AdAg85:TB1.4 vine to eliit TB1.4-speifi T-ell responses, we investigted its pility to eliit Ag85-speifi T-ell responses y using tetrmer immunostining nd ICCS tehniques nd ompred with those y monovlent AdAg85. To this end, BALB/ mie were immunized i.n. with the identil dose of either AdAg85:TB1.4 or AdAg85. Mie were killed t 4 nd 8 weeks postimmuniztion nd mononuler ells isolted from the irwy lumen nd spleens were sujeted to Ag85 tetrmer stining or ICCS. We found tht lthough oth vines eliited high frequenies of Ag85 tetrmer-positive CD8 T ells in the irwy lumen t oth 4 nd 8 weeks postimmuniztion, the monovlent vine rought out greter frequenies thn the ivlent ounterprt in the irwy lumen (Figure 3, dot plots). However, the solute numers of tetrmerpositive CD8 T ells in the irwy lumen y oth vines were omprle t 8 weeks postimmuniztion (Figure 3, r grph). In omprison, lthough immuniztion with monovlent AdAg85 vine eliited greter frequeny nd solute numer of IFNγ produing CD8 T ells in the irwy lumen t 4 weeks thn with ivlent AdAg85:TB1.4 vine, the frequeny nd solute numers of suh CD8 T ells were omprle etween the two t 8 weeks (Figure 3, dot plots nd r grph). Upon exmintion of CD4 T-ell response in the irwy lumen, we found tht oth monovlent nd ivlent vines triggered smll ut lrgely omprle levels of Ag85-speifi CD4 T-ell responses in the irwy lumen (Figure 3, dot plots nd r grph). In the spleen, the overll levels of Ag85-speifi CD8 nd CD4 T-ell responses were similr t 4 nd 8 weeks etween the two (Figure 4 ). These results together suggest tht oth monovlent AdAg85 nd ivlent AdAg85:TB1.4 vines ould indue potent Ag85 ntigenspeifi T-ell responses in the irwy lumen nd spleen, lthough monogeni AdAg85 vine seems to stimulte higher level of Ag85 ntigen-speifi CD8 T-ell responses in the irwy t the erlier time point. Moleulr Therpy vol. 17 no. 6 june

4 Comprison of nd Adenovirus-sed TB Vines The Amerin Soiety of Gene Therpy Comprison of immune protetion from pulmonry TB y immuniztion with monovlent AdAg85 nd ivlent AdAg85:TB1.4 vines To evlute the immune protetion rendered y ivlent AdAg85:TB1.4 vine in omprison to monovlent AdAg85 vine, mie were immunized i.n. with n identil dose of either vine. As ontrols, group of nive nd suutneously BCG-immunized mie were inluded. At 4 weeks postimmuniztion, these mie were hllenged vi the irwy with virulent M.t nd killed first t 4 weeks posthllenge. Lung nd spleen were exmined for M.t teril urden. As shown in Figure 5, s usul BCG vintion resulted in lose to 1 log redution in teril urden in the lung s ompred to unvinted nimls. In omprison, i.n. immuniztion with monovlent AdAg85 vine rendered level of signifint protetion in the lung tht ws even etter thn BCG (Figure 5), in keeping with our previous oservtion. 8 Of note, immuniztion with ivlent AdAg85:TB1.4 vine resulted in the est level of protetion tht led to further.6 log redution in the level of lung infetion over tht y monovlent AdAg85 immuniztion (Figure 5). To exmine whether the protetion rendered y ivlent AdAg85:TB1.4 vintion ws sustinle, mie were immunized nd hllenged with M.t t 4 weeks postimmuniztion s desried ove nd killed for teril urden ssessment t 8 weeks post-m. t hllenge. By this time point, mie immunized with BCG nd monovlent AdAg85 vine demonstrted omprle levels of protetion in the lung ginst pulmonry TB (Figure 5). In ontrst, the mie immunized with ivlent AdAg85:TB1.4 vine ontinued to e mrkedly etter proteted thn those immunized with monovlent AdAg85 vine or BCG (Figure 5). Compred to unimmunized ontrol mie, lthough the levels of M.t infetion in systemi orgn, the spleen, were signifintly CD8 + Tet Asolute numers per BAL ( 1 3 ) 34.2 CD8 + IFNγ CD4 + IFNγ weeks 8 weeks 4 weeks 8 weeks Figure 3 Ag85-speifi T-ell responses in the irwy lumen following intrnsl immuniztion with monovlent AdAg85 or ivlent AdAg85:TB1.4 vine. Mie were killed either t 4 or 8 weeks postimmuniztion. Mononuler ells isolted from the irwy lumen were sujeted to Ag85 tetrmer () nd ICCS (/) immunostining nd fluoresene-tivted ell sorting nlysis. Dt re expressed s representtive dot plots of perentge of () CD8 + Tet +, () CD8 + IFNγ +, or () CD4 + IFNγ + T ells out of totl CD8 or CD4 T ells nd s the verge solute numers ± s.e.m. of eh T-ell popultion per BAL from three mie/group/time, representtive of two independent experiments. P <.5 or P <.1 ompred to ivlent vine or nother time point. BAL, ronholveolr lvge; ICCS, intrellulr ytokine stining Asolute numers per spleen ( 1 4 ) 2 CD8 + Tet CD8 + IFNγ CD4 + IFNγ weeks 8 weeks 4 weeks 8 weeks Figure 4 Ag85-speifi T-ell responses in the spleen following intrnsl immuniztion with monovlent AdAg85 or ivlent AdAg85:TB1.4 vine. Mie were killed either t 4 or 8 weeks postimmuniztion. Mononuler ells isolted from the spleen were sujeted to Ag85 tetrmer () nd ICCS (/) immunostining nd fluoresene-tivted ell sorting nlysis. Dt re expressed s representtive dot plots of perentge of () CD8 + Tet +, () CD8 + IFNγ +, or () CD4 + IFNγ + T ells out of totl CD8 or CD4 T ells nd s the verge solute numers ± s.e.m. of eh T-ell popultion per spleen from three mie/group, representtive of two independent experiments. ICCS, intrellulr ytokine stining vol. 17 no. 6 june 29

5 The Amerin Soiety of Gene Therpy Comprison of nd Adenovirus-sed TB Vines M.t Chllenge M.t Chllenge 4 weeks 8 weeks 4 weeks 8 weeks /ivlent i.n. M.t CFU/lung (log 1 ) Killed /ivlent i.n. 6.5 M.t CFU/lung (log 1 ) Killed Nive BCG 4.5 Nive BCG M.t CFU/spleen (log 1 ) d M.t CFU/spleen (log 1 ) Nive BCG Nive BCG Figure 5 Immune protetion in the lung nd spleen y i.n. immuniztion with monovlent AdAg85 or ivlent AdAg85:TB1.4 vine. Mie were hllenged vi the irwy with virulent M.t t 4 weeks postimmuniztion nd killed t (,) 4 weeks post-m.t hllenge or (,d) t 8 weeks post-m.t hllenge. As ontrols, group of mie were not immunized (nive) or immunized suutneously with BCG vine. Lungs (,) or spleens (,d) from these mie were sujeted to M.t olony-forming unit (CFU) ssy. Dt re expressed s men vlue ± s.e.m. of 4 6 mie per group, representtive of two independent experiments (4 weeks). P <.5; P <.1; P <.1. i.n., intrnsl. redued y BCG, AdAg85, or AdAg85:TB1.4 immuniztion, they did not differ signifintly etween the three (Figure 5,d). The ove results together suggest tht ivlent AdAg85:TB1.4 vine provides muh etter level of protetion ginst pulmonry TB thn monovlent AdAg85 vine nd its protetive dvntge over the monovlent ounterprt is in the lung. Disussion Adenovirl vetor is promising vine pltform for muosl infetious diseses, s it ould e effetively used vi either the prenterl or muosl route of immuniztion. 15,18,19 Mounting experimentl evidene suggests tht the muosl route of vintion is superior to prenterl vintion in proteting muosl surfes. 9,18,2 26 In this regrd, we hve previously shown tht Ad5 enoding myoteril ntigen Ag85, when delivered vi respirtory muosl route, provided roust protetion ginst pulmonry TB tht ould e even etter thn BCG vintion. 8. In the urrent study, we report tht Ad5 enoding oth myoteril ntigens Ag85 nd TB1.4 s fusion protein n provide further mrkedly enhned nd sustined protetion thn its monovlent AdAg85 ounterprt. The hoie of M.t ntigens for expression y geneti TB vines is ritil determinnt of vine effiy. Ag85, high moleulr weight sereted M.t ntigen similr to Ag85, is highly immunogeni nd hs een widely used y us nd others in vrious vine formultions to potently protet ginst TB. 5,6,8,14 16,27 In omprison, TB1.4 is reently identified low moleulr weight sereted M.t protein, memer of the ESAT-6 fmily. 28,29 TB1.4 ntigen n e reognized y the T ells tivted y BCG immuniztion or M.t infetion. 28 However, due to the smll moleulr mss of the ESAT-6 fmily ntigens, vine enoding TB1.4 is understndly less immunogeni nd protetive thn the ones enoding Ag85 ntigens. 1,15,2,3,31 Nevertheless, ESAT-6 or TB1.4 hs een o-expressed s fusion protein with lrge size immunogeni Ag85 ntigen in multivlent suunit vine formultions to suessfully provide dded immunogeniity nd protetion. 1,2,32 Seletion of TB1.4 for expression in geneti TB vines is dvntgeous over ESAT-6 ntigen euse it is now well epted tht the use of vines expressing ESAT-6 my mitigte the vlue of the new ESAT-6 sed dignostis designed to differentite BCG immuniztion sttus from M.t infetion due to tht ESAT-6 is expressed only y M.t nd not y BCG. 1 In this regrd, TB1.4 is expressed y oth M.t nd BCG nd thus the use of vines expressing TB1.4 will not interfere with ESAT-6 sed TB dignostis. Bsed on the ove onsidertions nd tht there hs een lk of explortion of multivlent virl TB vines, in the urrent study we hve developed novel ivlent reominnt Ad5 vine to express fusion protein of oth Ag85 nd TB1.4 ntigens. We investigted nd ompred the immunogeniity nd the protetive potentil of this ivlent vine with its monovlent ounterprt expressing only Ag85. We hve provided ompelling evidene tht suh ivlent virl TB vine vi its pility to Moleulr Therpy vol. 17 no. 6 june

6 Comprison of nd Adenovirus-sed TB Vines The Amerin Soiety of Gene Therpy tivte the nive T-ell popultions of two distint ntigen speifiities n provide muh improved protetion ginst pulmonry TB thn monovlent Ag85-expressing vine prtiulrly in the lung. Furthermore, this ivlent virl vine lso demonstrtes stronger pility to hold off prolonged pulmonry M.t infetion thn the monovlent vine (Figure 5). The ft tht ivlent AdAg85:TB1.4 indued smller numer of Ag85-speifi CD8 T ells thn monovlent AdAg85 in the irwy lumen t 4 weeks postimmuniztion (Figure 3) lends further support to the enefit of tivtion of T-ell lones of multiple ntigen speifiities. This suggests tht when >1 M.t ntigens re expressed y the sme geneti vine pltform, the reltive size of tivted T-ell popultion speifi for one ntigen likely eomes less ritil to pulmonry protetion thn it would e in the se of monovlent vintion. On the other hnd, of interest, the signifintly etter protetion in the lung y the ivlent vine did not trnslte into etter protetion in the spleen, s we hve oserved similrly redued levels of protetion y oth monovlent nd ivlent virl vines. This is likely ttriuted for y smller Ag85-speifi T-ell popultions triggered y ivlent vintion nd would suggest tht perhps the reltive size of Ag85-speifi T-ell popultions in the lung plys n importnt role in restrining systemi M.t dissemintion. At this point, the reson s to why the ivlent vine indued less irwy luminl Ag85 epitope-speifi CD8 T-ell responses t 4 weeks still remins speultive. It is possile tht introdution of nother M.t ntigen to the immune system y the sme vine my downsize Ag85-speifi T-ell responses in order to rete room for T-ell responses to TB1.4. The prominent protetive dvntge of our ivlent Ad vine over the monovlent ounterprt even t lter times postpulmonry M.t infetion is most likely ounted for y the two ftors: first, the TB1.4-speifi T-ell responses within the irwy lumen pper to e greter t 8 weeks thn t 4 weeks postimmuniztion (Figure 2); nd seond, we oserved omprle level of Ag85-speifi T-ell responses within the irwy lumen t 8 weeks etween ivlent nd monovlent immuniztions, ontrst to the higher level of suh responses y monovlent vintion t 4 weeks (Figure 3). We hve previously shown tht it is the presene of irwy luminl, ut not systemi, T ells tht re positively orreltive of the level of immune protetion ginst pulmonry TB following geneti TB immuniztion. 9,17 From our previous oservtion tht monovlent AdAg85 roustly oosted protetion y BCG priming, 5 it is likely tht ivlent AdAg85:TB1.4 will possess further enhned oosting power following BCG prime immuniztion. We wish to e le to rry out suh evlutions not only in murine ut in ovine nd guine-pig models in the ner future. Suh prelinil investigtions will provide the needed proof of priniple for humn trils. Furthermore, the findings from our urrent study lso provide the rtionle for developing virus-vetored multivlent vines ginst other intrellulr infetious diseses thn TB. Admittedly, s for humn i.n. pplition, there is need to lne the sfety onsidertion nd vine effiy. In this regrd, the helper-dependent denovirl vetor, whih my e sfer thn the 1st genertion of denovirl vetor used in this urrent study, n e onsidered for pplition of humn i.n. TB vintion. Mterils And Methods Constrution nd hrteriztion of reominnt replition-defiient denovirl 5 sed ivlent vine AdAg85:TB1.4. AdAg85 ws onstruted s desried y Wng et l. 8 fusion protein denovirl vine AdAg85:TB1.4 ws reted similrly s desried previously. 8 Briefly, Ag85 omplementry DNA (DNA) without its own signl sequene gene region (sense primer, GATGTTGTGTCTGTTCGGAG; ntisense primer, GATGAGGGAAGCAAGAATGC) nd TB1.4 DNA (sense primer, GAC GTG GAA GGC GCC GGA GGT GGA GGA ATG TCG CAA ATC ATG TAC AAC; ntisense primer, GTC AAG TCT GTC GAC CTA GCC GCC CCA TTT GGC GGC TTC) were mplified y PCR from M.t genomi DNA (H37Rv). They were ligted in sequene into the plsmid vetor ontining sequenes oding for the humn tpa signl peptide in suh wy tht tpa signl peptide sequenes nd the Ag85 DNA 4 glyine odes TB1.4 DNA were in frme nd the protein trnsltion would strt t tpa N-end strting site. The tpa-ag85 DNA 4 glyine odes TB1.4 DNA segment loted in the position etween murine ytomeglovirus promoter nd SV4 poly(a) signl (Figure 1). This reominnt plsmid (pag85tb1.4) ws o-trnsfeted into 293 ells long with resuing vetor pbhgloxδe1,3cre tht ontined the Cre reominse oding gene region nd the entire type 5 humn Ad genomi DNA sequenes, exept the E1, E3, nd pking region. 33 Reominnt replition-defiient denovirl vetor AdAg85:TB1.4 ws then resued y homologous reomintion. AdAg85:TB1.4 virus ws mplified in 293N3S ells, purified y grdient entrifugtion nd titrted ording to the protool previously desried. 34 The expression nd seretion of Ag85:TB1.4 fusion protein y AdAg85:TB1.4-infeted mmmlin ells A549 were verified y western lot using n ma (lone TD-17) to Ag85 nd n ma to TB1.4 (kindly provided y Dr. Jes Dietrih). Mie. Six- to ten-week-old femle BALB/ mie were purhsed from Hrln Lortory. All mie were housed in speifi pthogen-free, level B fility in MMster University Centrl Animl Fility. All experiments were onduted in ordne with the guidelines of the Animl Reserh Ethis Bord of MMster University. Immuniztion. Mie were immunized one i.n. with PFU of either AdAg85:TB1.4 or AdAg85 in 25 µl s desried previously. 8 For intrmusulr delivery of either AdAg85:TB1.4 or AdAg85, PFU in totl volume of 1 µl ws injeted into the thigh qudrieps musle of oth hind legs in two seprte injetions of 5 µl per leg. A group of mie were not immunized or immunized with BCG suutneously (Connught strin;.1 million olony-forming unit/mouse) s stndrd ontrols for M.t hllenge experiment. M.t hllenge. M.t H37Rv strin (ATCC27294) ws grown in Middlerook 7H9 roth, supplemented with Middlerook olei id lumin dextrose tlse enrihment (Invitrogen Life Tehnologies, Crlsd, CA),.2% glyerol, nd.5% Tween 8 for 1 15 dys, then liquoted nd stored in 7 C until needed. 35 Before eh use, M.t illi were wshed with PBS ontining.5% Tween 8 twie nd pssed through 27-guge needle 1 times to disperse lumps. For M.t H37Rv infetion, immunized nd nonimmunized mie were infeted i.n. with 1, olonyforming unit of M.t t the indited time points following immuniztion s previously desried. 5,8,9,17,35 The level of teril urden ws determined t the desried time points in the lung nd spleen y plting seril dilutions of tissue homogentes in triplites onto Middlerook 7H1 gr pltes ontining olei id lumin dextrose tlse enrihment. Pltes were inuted t 37 C for 17 dys in semiseled plsti gs. Colonies were then ounted, lulted, nd presented s log 1 olony-forming unit per orgn. Cell isoltion nd ulture. Mononuler ells were isolted from ronholveolr lvge, lung nd spleen for ICCS, tetrmer stining nd ytokine prodution following ex vivo ntigen stimultion. Intr-irwy luminl ells were removed from lung y exhustive lvge s desried vol. 17 no. 6 june 29

7 The Amerin Soiety of Gene Therpy Comprison of nd Adenovirus-sed TB Vines pre viously. 17 After lvge, lungs were perfused through the left ventrile with Hnk s uffer to remove intrvsulr leukoytes. The lungs were then ut into smll piees nd digested with ollgense type 1 (Sigm-Aldrih, Okville, Ontrio, Cnd) for 1 hour t 37 C prior to rush them through 1 µm pore size filter. Splenoytes nd lymphoytes from lymph nodes were isolted s desried previously. 8,36 Colleted ells were enumerted on hemoytometer fter pproprite dilution in Turk s ounting uffer. All isolted ells were then resuspended in RPMI 164 medium, supplemented with 5% FBS nd 1 µg/ml peniillin nd streptomyin. ICCS, tetrmer stining, nd fluoresene-tivted ell sorting. Singleell suspension otined y the proedures desried ove were ultured in U-ottom 96-well plte t onentrtion of 2 million ell/ ml for lung, spleen, nd lymph nodes nd t onentrtion of 5 million ell/ ml for ronholveolr lvge. Cells were ultured in the presene of GolgiPlug (5 µg/ml refeldin A; BD Phrmingen, Mississug, Ontrio, Cnd) either with no stimultion, or with eh of the following ntigens: Ag85-speifi CD4 (LTSELPGWLQANRHVKPTGS) or CD8 (MPVGGQSSF) T-ell peptides t onentrtion of.5 µg/well (ref. 5) or TB1.4 CD8 peptide.5 μg/well (GYAGTLQSL) for 5 6 hours (ref. 1), or reominnt TB1.4 protein (kindly provided y Dr. Jes Dietrih) 2 µg/ well (ref. 1,37) for hours to whih GolgiPlug ws dded for the lst 5 hours of stimultion. Cells were then wshed nd loked with CD16/ CD32 in.5% ovine serum lumin/phosphte-uffered sline for 15 minutes on ie nd then stined with the pproprite surfe ntiodies. Cells were then wshed, permeilized, nd stined ording to the mnufturer s instrutions (BD Phrmingen). The following As were used: CD8-APC-Cy7, CD8-PE-Cy7, CD4-FITC, CD4-PE-Cy7, IFN-γ APC, CD3-Pifi lue, nd CD3-CyChrome. Tetrmer flow ytometri nlysis ws onduted using the tetrmers with the immunodominnt CD8 T-ell peptide (MPVGGQSSF) ound to the BALB/ MHC lss I llele H-2L d, whih ws ordered from the MHC Tetrmer Lortory (Bylor College of Mediine, Houston, TX). Cells were plted on U-ottom 96-well pltes in RPMI. Prior to stining, ells were wshed nd loked with CD16/CD32 in.5% ovine serum lumin/phosphte-uffered sline for 15 minutes on ie nd then stined with tetrmer for 1 hour in the drk t room temperture. Cells were then wshed nd stined with surfe As. Stined ells were run on LSR II flow ytometer nd 1, 3, events were olleted per smple. The fluoresene-tivted ell sorting dt were nlyzed with FlowJo Softwre (Tree Str, Ashlnd, OR). ELISPOT ssy. IFN-γ seretion ELISPOT ssy ws rried out s previously desried. 27 Briefly, isolted splenoytes ( /well) were seeded into 96-well PVDF miroplte (Millipore, Burlington, Ontrio, Cnd) preoted overnight with mouse IFN-γ pture ntiody (R&D Systems, Minnepolis, MN). Cells were inuted for 24 hours with or without stimultion y reominnt TB1.4 protein. The plte ws then wshed nd inuted with 1:6 diluted detetion ntiody t 4 C overnight. The plte ws developed y using stndrdized streptvidin-onjugted lkline phosphtse nd hromogen method (R&D Systems). The numer of IFN-γ relesing ells ws determined y using n ELISPOT reder (CTL Cellulr Tehnology, Shker Heights, OH). Sttistil nlysis. The differene omprison ws onduted y using n unpired, two-tiled Student s t-test for immunogeniity studies. Onewy nlysis of vrine with Fisher LSD post ho test ws performed with SPSS Softwre nd SigmStt Softwre for omprison of differenes in multigroup protetion studies. The differene ws onsidered sttistilly signifint when P vlue.5. Aknowledgments The uthors re muh grteful to Ann Zgniz, Kpiln Kugthsn, nd Tony Yng for their tehnil ssistne, to Jes Dietrih for providing TB1.4 protein nd ntitb1.4 monolonl ntiody, nd to Kris Huygen for providing ntiag85 monolonl ntiody. This study is supported y funds from the Cndin Institutes of Helth Reserh. Referenes 1. Dye, C (2). Tuerulosis 2-21: ontrol, ut not elimintion. Int J Tuer Lung Dis 4 (12 suppl. 2): S146 S Awsthi, S nd Moin, S (1999). Effetiveness of BCG vintion ginst tuerulous meningitis. Indin Peditr 36: Izzo, A, Brndt, L, Lso, T, Kipnis, AP nd Orme, I (25). NIH pre-linil sreening progrm: overview nd urrent sttus. Tuerulosis (Edin) 85: Jeynthn, M, Roediger, EK nd Xing, Z (27). Use of geneti vetors for immuniztion ginst intrellulr infetions t muosl surfes. In: Ruiz, PS (ed.). Geneti Vetors Reserh Fous. Nov Siene Pulishers: Huppuge, NY. pp Sntosuosso, M, MCormik, S, Zhng, X, Zgniz, A nd Xing, Z (26). Intrnsl oosting with n denovirus-vetored vine mrkedly enhnes protetion y prenterl Myoterium ovis BCG immuniztion ginst pulmonry tuerulosis. Infet Immun 74: MShne, H, Pthn, AA, Snder, CR, Goonetilleke, NP, Flether, HA nd Hill AV (25). Boosting BCG with MVA85A: the first ndidte suunit vine for tuerulosis in linil trils. Tuerulosis (Edin) 85: Xing, Z (21). The hunt for new tuerulosis vines: nti-tb immunity nd rtionl design of vines. Curr Phrm Des 7: Wng, J, Thorson, L, Stokes, RW, Sntosuosso, M, Huygen, K, Zgniz, A et l. (24). Single muosl, ut not prenterl, immuniztion with reominnt denovirl-sed vine provides potent protetion from pulmonry tuerulosis. J Immunol 173: Sntosuosso, M, Zhng, X, MCormik, S, Wng, J, Hitt, M nd Xing, Z (25). Mehnisms of muosl nd prenterl tuerulosis vintions: denovirl-sed muosl immuniztion preferentilly eliits sustined umultion of immune protetive CD4 nd CD8 T ells within the irwy lumen. J Immunol 174: Dietrih, J, Agrd, C, Leh, R, Olsen, AW, Stryhn, A, Doherty, TM et l. (25). Exhnging ESAT6 with TB1.4 in n Ag85B fusion moleule-sed tuerulosis suunit vine: effiient protetion nd ESAT6-sed sensitive monitoring of vine effiy. J Immunol 174: Lngermns, JA, Doherty, TM, Vervenne, RA, vn der Ln, T, Lyshhenko, K, Greenwld, R et l. (25). Protetion of mques ginst Myoterium tuerulosis infetion y suunit vine sed on fusion protein of ntigen 85B nd ESAT-6. Vine 23: Mue, AC, Wters, WR, Plmer, MV, Nonneke, BJ, Minion, FC, Brown, WC et l. (27). An ESAT-6:CFP1 DNA vine dministered in onjuntion with Myoterium ovis BCG onfers protetion to ttle hllenged with virulent M. ovis. Vine 25: Olsen, AW, Willims, A, Okkels, LM, Hth, G nd Andersen, P (24). Protetive effet of tuerulosis suunit vine sed on fusion of ntigen 85B nd ESAT-6 in the erosol guine pig model. Infet Immun 72: Romno, M, Roupie, V, Wng, XM, Denis, O, Jurion, F, Adnet, PY et l. (26). Immunogeniity nd protetive effiy of tuerulosis DNA vines omining myolyl-trnsferse Ag85A nd phosphte trnsport reeptor PstS-3. Immunology 118: Rdosevi, K, Wielnd, CW, Rodriguez, A, Weverling, GJ, Mintrdjo, R, Gillissen, G et l. (27). Protetive immune responses to reominnt denovirus type 35 tuerulosis vine in two mouse strins: CD4 nd CD8 T-ell epitope mpping nd role of gmm interferon. Infet Immun 75: Roediger, EK, Kugthsn, K, Zhng, X, Lihty, BD nd Xing, Z (28). Heterologous oosting of reominnt denovirl prime immuniztion with novel vesiulr stomtitis virus-vetored tuerulosis vine. Mol Ther 16: Sntosuosso, M, MCormik, S, Roediger, E, Zhng, X, Zgniz, A, Lihty, BD et l. (27). Muosl luminl mnipultion of T ell geogrphy swithes on protetive effiy y otherwise ineffetive prenterl geneti immuniztion. J Immunol 178: Sntosuosso, M, MCormik, S nd Xing, Z (25). Adenovirl vetors for muosl vintion ginst infetious diseses. Virl Immunol 18: Rosenthl, KL nd Gllihn, WS (1997). Chllenges for vintion ginst sexullytrnsmitted diseses: indution nd long-term mintenne of muosl immune responses in the femle genitl trt. Semin Immunol 9: Dietrih, J, Andersen, C, Rppuoli, R, Doherty, TM, Jensen, CG nd Andersen, P (26). Muosl dministrtion of Ag85B-ESAT-6 protets ginst infetion with Myoterium tuerulosis nd oosts prior illus Clmette-Guerin immunity. J Immunol 177: Foxwell, AR, Kyd, JM nd Cripps, AW (23). Muosl immuniztion ginst respirtory teril pthogens. Expert Rev Vines 2: Giri, PK, Sle, SB, Verm, I nd Khuller, GK (25). Comprtive evlution of intrnsl nd suutneous route of immuniztion for development of muosl vine ginst experimentl tuerulosis. FEMS Immunol Med Miroiol 45: Kohm, H, Umemur, M, Okmoto, Y, Yhgi, A, Gog, H, Hrkuni, T et l. (28). Muosl immuniztion with reominnt heprin-inding hemgglutinin dhesin suppresses extrpulmonry dissemintion of Myoterium ovis illus Clmette- Guérin (BCG) in infeted mie. Vine 26: Oliveir, ML, Arês, AP nd Ho, PL (27). Intrnsl vines for protetion ginst respirtory nd systemi teril infetions. Expert Rev Vines 6: Wng, J nd Xing, Z (22). Tuerulosis vines: the pst, present nd future. Expert Rev Vines 1: Xing, Z nd Lihty, BD (26). Use of reominnt virus-vetored tuerulosis vines for respirtory muosl immuniztion. Tuerulosis (Edin) 86: Zhng, X, Divnghi, M, Ngi, P, Sntosuosso, M, Millr, J, Zgniz, A et l. (27). Intrmusulr immuniztion with monogeni plsmid DNA tuerulosis vine: enhned immunogeniity y eletroportion nd o-expression of GM-CSF trnsgene. Vine 25: Moleulr Therpy vol. 17 no. 6 june

8 Comprison of nd Adenovirus-sed TB Vines The Amerin Soiety of Gene Therpy 28. Skjøt, RL, Brok, I, Arend, SM, Munk, ME, Theisen, M, Ottenhoff, TH et l. (22). Epitope mpping of the immunodominnt ntigen TB1.4 nd the two homologous proteins TB1.3 nd TB12.9, whih onstitute sufmily of the est-6 gene fmily. Infet Immun 7: Skjøt, RL, Oettinger, T, Rosenkrnds, I, Rvn, P, Brok, I, Josen, S et l. (2). Comprtive evlution of low-moleulr-mss proteins from Myoterium tuerulosis identifies memers of the ESAT-6 fmily s immunodominnt T-ell ntigens. Infet Immun 68: Sle, SB, Verm, I, Beher, D nd Khuller, GK (25). Humn immune reognitionsed multiomponent suunit vines ginst tuerulosis. Eur Respir J 25: Kmth, AT, Feng, CG, Mdonld, M, Brisoe, H nd Britton WJ (1999). Differentil protetive effiy of DNA vines expressing sereted proteins of Myoterium tuerulosis. Infet Immun 67: Weinrih Olsen, A, vn Pinxteren, LA, Meng Okkels, L, Birk Rsmussen, P nd Andersen, P (21). Protetion of mie with tuerulosis suunit vine sed on fusion protein of ntigen 85 nd est-6. Infet Immun 69: Ng, P, Prks, RJ, Cummings, DT, Evelegh, CM nd Grhm, FL (2). An enhned system for onstrution of denovirl vetors y the two-plsmid resue method. Hum Gene Ther 11: Xing, Z, Ohkwr, Y, Jordn, M, Grhm, FL nd Guldie, J (1997). Adenovirl vetor-medited interleukin-1 expression in vivo: intrmusulr gene trnsfer inhiits ytokine responses in endotoxemi. Gene Ther 4: Wng, J, Sntosuosso, M, Ngi, P, Zgniz, A nd Xing, Z (24). Ativtion of CD8 T ells y myoteril vintion protets ginst pulmonry tuerulosis in the sene of CD4 T ells. J Immunol 173: Wng, J, Zgniz, A nd Xing, Z (22). Enhned immunogeniity of BCG vine y using virl-sed GM-CSF trnsgene djuvnt formultion. Vine 2: Kmth, AB, Woodworth, J, Xiong, X, Tylor, C, Weng, Y nd Behr, SM (24). Cytolyti CD8+ T ells reognizing CFP1 re reruited to the lung fter Myoterium tuerulosis infetion. J Exp Med 2: vol. 17 no. 6 june 29