Ayman Hyder 1, Sabrina Ehnert 2, Hebke Hinz 1, Andreas K Nüssler 2, Fred Fändrich 1 and Hendrik Ungefroren 1,3*

Transcription

1 Hyder et l. Cell Communition nd Signling 212, 1:23 RESEARCH Open Aess EGF nd HB-EGF enhne the prolifertion of progrmmble ells of monoyti origin (PCMO) through tivtion of MEK/ERK signling nd improve differentition of PCMO-derived heptoyte-like ells Aymn Hyder 1, Sbrin Ehnert 2, Hebke Hinz 1, Andres K Nüssler 2, Fred Fändrih 1 nd Hendrik Ungefroren 1,3* Abstrt Bkground: Heptoyte-like ells (NeoHeptoytes) generted from peripherl blood monoyte-derived stem ell-like ell (the PCMO) re promising lterntive for primry heptoytes in ell trnsplnttion studies to ure liver diseses. However, to be therpeutilly effetive NeoHeptoytes re needed in lrge quntities. It ws the im of the present study to investigte i) whether the proportion of tively proliferting NeoHeptoytes n be enhned by supplementing the PCMO differentition medium (ontining M-CSF, IL-3, nd humn serum) with either EGF or HB-EGF nd ii) whih signling pthwy underlies the promitoti effet. Results: EGF nd HB-EGF enhned ell prolifertion of PCMOs s demonstrted by inresed expression of yle ontrol genes (ABL, ANAPC2, CDC2, CDK4, CDK6), phosphoryltion of the retinoblstom protein, nd inresed PCMO ell numbers fter stimultion with EGF or HB-EGF. EGF lso rised the number of monoytes expressing the prolifertion mrker Ki67. PCMOs expressed the EGF reeptors EGFR (ERBB1) nd ERBB3, nd expression of both inresed during PCMO genertion. Phosphoimmunoblotting of PCMOs indited tht both EGF nd HB-EGF tivted MEK-1/2 nd ERK1/2 in onentrtion-dependent fshion with the effet of EGF being more prominent. EGF tretment further deresed expression of p47 phox nd inresed tht of Nnog inditing enhned dedifferentition nd pluripoteny, respetively. Tretment with both EGF nd HB-EGF resulted in NeoHeptoytes with improved funtionl prmeters. Conlusions: The results suggested tht the ddition of EGF or HB-EGF to PCMO differentition medium supertivtes MEK/ERK signling whih then inreses both PCMO prolifertion, number, nd funtionl differentition of PCMO-derived NeoHeptoytes. Keywords: EGF, Heptoyte-like ells, MEK, Extrellulr signl-regulted kinse, Prolifertion, Progrmmble ells of monoyti origin * Correspondene: hendrik.ungefroren@uksh.de 1 Clini for Applied Cellulr Mediine, UKSH, Cmpus Kiel, Arnold-Heller Strsse 3, Hs. 18, 2415 Kiel, Germny 3 First Deprtment of Mediine, UKSH, Cmpus Lübek, Rtzeburger Allee 16, Lübek, Germny Full list of uthor informtion is vilble t the end of the rtile 212 Hyder et l.; liensee BioMed Centrl Ltd. This is n Open Aess rtile distributed under the terms of the Cretive Commons Attribution Liense ( whih permits unrestrited use, distribution, nd reprodution in ny medium, provided the originl work is properly ited.

2 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 2 of 1 Bkground Although heptoyte trnsplnttion is therpeuti option for end-stge liver diseses, ell mteril is sre due to ritil shortge of liver tissues nd the lk of protools tht llow mintining the differentited heptoyte phenotype in ulture for more thn week. Thus, genertion of heptoyte-like ells from stem ells or stem ell-like ells my represent promising lterntive [1]. One suh ell type with inherent stem ell-like fetures is the humn peripherl blood monoyte [2-5]. By initilly induing proess of dedifferentition we hve generted from these ells more plsti derivtive termed progrmmble ell of monoyti origin (PCMO). PCMOs re prone to quire funtionl tivities of heptoyte-like ells (NeoHeptoytes) upon stimultion with pproprite differentition medi in vitro [2,3], nd in vivo following trnsplnttion into mie [2]. From the linil point of view, mjor obstle in ell trnsplnttion is the lrge mount of ells required to hieve therpeuti effet in ptients. Despite n lredy lrge number of ells tht n be retrieved from blood produts the overll numbers of NeoHeptoytes obtined fter the two-step dedifferentitiondifferentition protool re still low nd insuffiient. One possibility to inrese NeoHeptoyte ell numbers is by induing the ells to proliferte. This is more likely to be possible t or before the PCMO stge s the NeoHeptoyte differentition from PCMO is mutully exlusive with prolifertion. Indeed, during onversion of peripherl blood monoytes into PCMOs, proess involving dedifferentition, frtion of monoytes resume prolifertion in vitro in response to mrophge-olony stimulting ftor (M-CSF), interleukin-3 (IL-3), nd humn serum [2]. The extent of prolifertion however, ws not suffiient to substntilly inrese the overll ellulr yield of NeoHeptoytes. If the rte of prolifertion nd/or the perentge of mitotilly tive monoytes ould be enhned prior to indution of differentition, then n inresed number of NeoHeptoytes my be obtined, thereby inresing the hne for suessful NeoHeptoyte trnsplnttions. Idelly, modifition of the PCMO genertion proedure, e.g. by ddition of growth-stimultory ftor(s), should not only enhne mitoti tivity but lso the plstiity of PCMOs in suh wy tht the resulting NeoHeptoytes beome more heptoyte-like [6]. Interestingly, subpopultion of humn monoytes tht prolifertes in vitro in response to M-CSF hs been suspeted to be less mture nd hene more stem ell-like thn other monoytes [7]. Therefore, the identifition of growth ftor signling pthwys tht regulte prolifertion of humn monoytes my enhne both the quntity nd qulity of PCMO-derived NeoHeptoytes. Epiderml growth ftor (EGF) is known to indue prolifertion in mny kinds of ells [8-11] nd its reeptor is over-expressed in prolifertive ells [12]. Another member from the EGF fmily, the 2 22 kd glyoprotein Heprin-binding epiderml growth ftor (HB-EGF) [13] ws lso reported to be potent mitogen for mny ell types [14-16]. Humn peripherl blood monoytes were shown reently to express funtionl EGF reeptor (EGFR) [17,18], while the EGF reeptors -ERBB2, 3 nd 4 hve not been studied. However, link between EGF or HB-EGF nd prolifertion in monoytes hs never been investigted. Anlysis of the mehnism of reeptor tyrosine kinse tivtion in monoytes my identify soluble ftors tht ontrol PCMO self renewl. The present study imed to investigte the expression nd the tivity of the epiderml growth ftor reeptor (ERBB) fmily in humn peripherl monoytes nd the role of EGF nd HB-EGF on the outome of PCMO genertion nd the subsequent differentition into NeoHeptoytes. Results Gene expression of EGF reeptor fmily members in PCMOs We first sought to determine whih EGF reeptors re expressed in monoytes. For this purpose, RNA ws isolted from monoyte ultures nd proessed for qpcr using primers for EGFR (lso termed ERBB1), ERBB2, ERBB3, nd ERBB4 s listed in Tble 1. RT-PCR nlysis of the four EGF reeptors yielded strong signl for EGFR nd weker one for ERBB3 (Figure 1A). Sine monoytes my be ontminted with lymphoytes, negtive ontrol smple of highly purified lymphoytes ws nlyzed in prllel nd shown to lk expression of both EGFR nd ERBB3 (dt not shown). This indited tht the mplifition produts for EGFR nd ERBB3 were speifilly derived from monoytes. Sine the expression levels of some genes my differ during the development of PCMOs in ulture, we isolted RNA from the developing PCMOs t different dys of ulture. The qpcr of these smples indited tht expression of both EGFR nd ERBB3 initilly inresed during PCMO genertion rehing pek on the seond dy (ERBB3) nd on the fourth dy (EGFR) of ulture nd deresed therefter (Figure 1B). EGF promotes prolifertion during PCMO prodution Next, we exmined the effet of EGF nd HB-EGF on the prolifertion of PCMOs (Figure 2). For this purpose, ells were ultured for 4 dys in PCMO medium ontining EGF or HB-EGF t different onentrtions. Cells were prepred for immunofluoresene using Ki67 ntibody s prolifertion mrker nd CD14 s monoyte mrker. The results showed higher number of

3 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 3 of 1 Tble 1 Sequenes of PCR primers Gene Aession No. Sense primer Antisense primer Produt size (bp) EGFR NM_ ATGCTCTACAACCCCACCAC GCCCTTCGCACTTCTTACAC 193 -erbb2 NM_ CCCTCATCCACCATAACACC GCCTGGCATTCACATACTCC 279 -erbb3 NM_ TACTTGGAACGGGGTGAGAG ACTCTGCCGTCCACTCTTGT 219 -erbb4 NM_ AGTCAGTGTGTGCAGGAACG CTCCAGAGGCAGGTAACGAA 224 Nnog NM_24865 GATTTGTGGGCCTGAAGAAAACT AGGAGAGACAGTCTCCGTGTGAG 79 GAPDH NM_246 TTGCCATCAATGACCCCTTCA CGCCCCACTTGATTTTGGA 174 β-tin NM_31144 GATATCGCTGCGCTCGTC TCCATATCGTCCCAGTTGG 239 ANAPC2 NM_ CCAGTACAGGCGGTGATCTT GCTCTCGTCGTCACTGTCAA 228 ABL-1 NM_ AACACCCTAACCTGGTGCAG CAAGTGGTTCTCCCCTACCA 248 CDC2 (CDK1) NM_ GGGGTCAGCTCGTTACTCAA GATGCTAGGCTTCCTGGTTTC 225 CDK4 NM_75.2 CTGACCGGGAGATCAAGGTA AGCCAGCTTGACTGTTCCAC 224 CDK6 NM_ TCCCAGGAGAAGAAGACTGG GGTCCTGGAAGTATGGGTGA 198 Ki67/CD14 double-positive ells in both EGF nd HB- EGF-treted ultures (Figure 2). However, quntifition of these ells showed tht the HB-EGF but not the EGF effet losely missed sttistil signifine (Figure 2B). No sttistilly signifint differenes of Ki67/CD14-positive ell ounts were observed mong A B EGFR ERBB2 ERBB3 ERBB4 β-tin Figure 1 Detetion of different EGF reeptor fmily members by RT-PCR in humn blood monoytes. (A) Stndrd endpoint RT-PCR of EGFR (lne 2), ERBB2 (lne 3), ERBB3 (lne 4), ERBB4 (lne 5), nd β-tin s ontrol (lne 6) in PCMOs. RNA ws isolted from dy-4 PCMOs nd reverse-trnsribed. Amplifition produts of the resulting DNA (using the primers listed in Tble 1) were run on n grose gel nd stined with ethidiumbromide. A moleulr weight mrker (lne 1) ws run in prllel to onfirm the predited bnd sizes. (B) QPCR nlysis of the sme EGF reeptors in monoytes during the genertion of PCMOs. Dt shown re the men ± SD of 3 seprte experiments performed in duplites. different onentrtions of the sme tretment. These dt lerly show tht the ddition of EGF enhned the prolifertive tivity of monoytes in PCMO genertion medium. EGF-indued prolifertion temporlly orrelted with ell yle tivtion. In order to investigte whether EGF-indued prolifertion ws ssoited with the expression of speifi ell-yle regultory genes, we treted monoytes with different onentrtions of EGF or HB-EGF nd performed qpcr nlysis s desribed in the Methods setion. As seen in Tble 2, both EGF nd HB-EGF up-regulted the expression of ABL, ANAPC2, CDC2, CDK4, nd CDK6, eh of whih is involved in different stges of the ell yle. RNA ws isolted from PCMOs fter 4-dy ulture with or without EGF or HB-EGF (1, 5, 1 μg/l) nd trnsribed to DNA. QPCR ws pplied using primer pirs listed in Tble 1. Dt re presented s men ± SEM of N = 4 nd represent the fold-hnge in omprison with ontrol PCMOs (ultured without HB-EGF or EGF), the vlues of whih were onsidered s 1. Sttistil nlysis: = signifintly different from the ontrol, b: signifintly different from the orresponding HB-EGF vlue. The retinoblstom protein (prb) plys pivotl role in the negtive ontrol of the ell yle nd prevents the ell from repliting dmged DNA by bloking progression through G1 into S phse. Its inhibitory role on ell yle progression is rried out in the hypophosphorylted stte, while phosphoryltion intivtes prb [19]. We hve nlysed the phosphoryltion stte of prb in PCMOs generted in the presene of either EGF or HB- EGF (Figure 2C). The results show tht tretment with HB-EGF inresed the phosphoryltion of prb, while EGF used its hyperphosphoryltion. In ontrol ells, however, only the tive non-phosphorylted form ws present (Figure 2C). We hve lso investigted ylin A protein in the sme smples. Cylin A defines ontrol points of the ell yle.

4 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 4 of 1 A B C D Figure 2 EGF nd HB-EGF inrese the number of mitotilly tive ells in PCMO ultures. (A) immunofluoresene of Ki67 expression (red) in PCMO ultures treted for 4 dys with the indited onentrtions of either EGF or HB-EGF. PCMOs were immunostined with CD14 (green) s monoyte-speifi mrker. Nulei were stined with DAPI (blue). (B) Quntifition of Ki67 expressing PCMOs fter tretment with EGF or HB-EGF. Dt (N = 3) re expressed s men ± SEM. Sttistil nlysis: denotes signifint differene from the ontrol; b denotes signifint differene from the orresponding vlues of HB-EGF. (C) Immunoblotting of the retinoblstom protein nd ylin A in PCMO ultures treted for 4 dys with the indited onentrtions (in μg/l) of either HB-EGF or EGF. The housekeeping protein β-tin ws deteted s loding ontrol. Densitometri nlysis of ylin A nd β-tin bnds ws performed using NIH ImgeJ softwre (version 1.45). The indited vlues below the blots represent the normlized signl intensities for ylin A reltive to untreted ontrol ells set t 1. (D) PCMO ell ounts fter 4 dys of ulture with 1 μg/l of either EGF or HB-EGF (N = 3). Sttistil nlysis: denotes signifint differene from the ontrol. It binds both CDK2 nd CDC2 giving rise to two distint ylin A kinse tivities, one ppering in S phse nd the other one in G2 phse [2]. Immunoblotting indited n inrese in ylin A expression upon tretment of PCMOs with 5 nd 1 μg/l HB-EGF nd with ll three onentrtions of EGF (Figure 2C). Finlly, we performed ell ounting of PCMOs ultured for 4 dys with either 1 μg/l EGF or HB-EGF Tble 2 Expression of ell yle genes during the development of PCMOs ultured in the presene of HB-EGF or EGF ABL ANAPC2 CDC2 CDK4 CDK6 Hb-EGF ± ± ± ± ± 1.1 Hb-EGF ± ± ± ± ±.8 Hb-EGF ± ± ± ± ± 1.6 EGF ±.18 b 1.78 ± ± 1.5 b 1.57 ± ±.96 EGF ±.2 b 1.7 ± ± ± ±.87 EGF ±.3 b 1.6 ± ± ± ±.93 ANOVA =

5 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 5 of 1 (Figure 2D). The results demonstrted moderte but signifint inrese over the ontrol in totl ell ounts fter both tretments. No differene ws observed between the two tretments. Together, the dt show tht EGF nd HB-EGF re suitble tools to expnd the totl ell number of PCMOs nd tht this lrgely ours through n inrese in the mitoti/ell yle tivity of monoytes. EGF tretment ttenutes expression of p47 phox nd enhnes expression of Nnog in PCMOs During the genertion of PCMOs, monoytes downregulte mrkers of differentition, e.g. p47 phox n essentil subunit of the retive oxygen produing enzyme NAD (P)H oxidse nd upregulte mrkers of pluripoteny, e.g. Nnog [6]. We hve exmined the effet of EGF nd HB-EGF on the expression of p47 phox by immunoblotting (Figure 3A) nd on the expression of Nnog by qpcr (Figure 3B). The p47 phox protein levels were lerly lower on dy 4 of ulture whih ws prtiulrly prominent in EGF-treted ultures (Figure 3A). No A B p47 phox β-tin Nnog mrna onentrtion Fold indution of ontrol Figure 3 Regultion of Nnog nd p47 phox expression by EGF or HB-EGF in PCMOs. (A) Mesurement of Nnog expression by qpcr in PCMOs treted for 4 dys with the indited onentrtions (in μg/l) of HB-EGF or EGF. Dt (men ± SEM, N = 4) were normlized to the expression level of GAPDH. ANOVA: p <.1; = ll vlues of EGF nd HB-EGF re signifintly higher thn tht of the ontrol; b = signifint differene between EGF nd the orresponding HB-EGF vlue. (B) Immunoblot nlysis of p47 phox in dy-4 PCMOs treted with either HB-EGF or EGF t the indited onentrtions. The β-tin protein ws deteted s loding ontrol. b differenes were observed between tretments with different onentrtions of EGF. Both EGF nd HB-EGF used more thn 2-fold inrese in the mrna levels of Nnog (Figure 3B). Sttistilly signifint differenes were observed neither mong EGF nd HB-EGF tretments nor mong different onentrtions of eh growth ftor. The dt suggest tht EGF n enhne both the extent of dedifferentition nd pluripoteny. MEK/ERK signling drives prolifertion in PCMOs nd is supertivted by EGF nd HB-EGF ERK nd MEK tivtion is involved in M-CSF nd EGF-indued prolifertion of PCMOs. We hve previously shown tht during PCMO ulture, subset of monoytes resumes prolifertion. To test whether this is ssoited with tivtion of MEK/ERK signling, we performed immunoblot nlysis of ERK tivtion (Figure 4A). ERK phosphoryltion during PCMO genertion peked on dy 3 4 of ulture nd this inrese oinided with pek mitoti tivity [2]. This suggested tht ERK tivtion is uslly involved in driving prolifertion of monoytes/pcmos. To test this more diretly, we inhibited MEK1 with U126 during PCMO ulture nd ssessed the number of ells on dy 6. The totl number of ells ws low, inditing tht MEK/ERK signling is ruil for PCMO prolifertion (Figure 4B). Sine both EGF nd HB-EGF re known to stimulte ERK tivtion, we resoned tht these gents my enhne prolifertion by supertivting the MEK/ERK pthwy. To test this predition, PCMOs were generted in stndrd PCMO differentition medium in the bsene or presene of either EGF or HB-EGF nd subjeted to immunoblot nlysis of phospho-mek nd phospho-erk. The results indited tht both EGF nd HB-EGF tivted MEK nd ERK nd tht the effet ws onentrtion-dependent nd more prominent in EGFtreted thn in HB-EGF-treted PCMOs (Figure 4C). Effet of EGF nd HB-EGF on NeoHeptoyte funtion Idelly, modifition of the PCMO genertion proedure should not only enhne prolifertion but lso the stem ell fetures of PCMOs in wy tht the resulting NeoHeptoytes beome more heptoyte-like. We therefore tested whether dding EGF nd HB-EGF to the PCMO genertion medium would lter funtionl prmeters of the Neoeptoytes. Control PCMOs nd PCMOs generted in the presene of either EGF or HB- EGF were llowed to differentite into NeoHeptoytes for 2 weeks nd t the end of this period were nlysed for heptoyte-speifi funtions (Figure 5). NeoHeptoytes, regrdless of tretment, inluding the ontrol, formed nd sereted ure in similr mounts s under bsi onditions. Addition of NH 4 Cl inresed ure formtion in ll settings. However, it ws

6 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 6 of 1 A Culture dy p-erk1 C p-mek MEK1 MEK2 ERK1 p-erk ERK1/2 B - U126 + U126 β-tin HB-EGF (µg/l) EGF (µg/l) Figure 4 MEK/ERK signling drives prolifertion in PCMOs nd is supertivted by EGF nd HB-EGF. (A) M-CSF nd Il-3 indue phosphoryltion of ERK (perk). Protein smples were obtined from PCMOs ultured for vrious dys (s indited) in stndrd PCMO differentition medium. (B) Inhibition of ERK ws suffiient to inhibit PCMO prolifertion. Cells were ultured with either solvent (left) or the ERK inhibitor U126 (right) for 6 dys nd imges were tken. Originl mgnifition: 5x. (C) HB-EGF nd EGF indue phosphoryltion of MEK nd ERK. Phospho-MEK (p-mek), MEK1/2, phospho-erk (p-erk), nd ERK1/2 expression ws exmined by immunoblotting in lystes of dy-4 PCMOs tht hve been treted with the indited onentrtions of either HB-EGF or EGF. higher in NeoHeptoytes obtined from PCMOs generted in the presene of HB-EGF. NeoHeptoytes regrdless of tretment, inluding the ontrol, ll sereted gluose t similr rtes. To mesure the bility of the ells to perform gluoneogenesis, the N-pyruvteontining inubtion buffer ws supplemented with N-L-ltte. Stimultion with pyruvte/ltte indued higher gluose seretion ompred to non-stimulted ultures. As for ure, the effet ws higher in NeoHeptoytes obtined from PCMOs generted in the presene of HB-EGF. NeoHeptoytes exhibit phse I nd II enzyme tivities. However, levels were signifintly lower ompred to primry humn heptoytes [21] nd ould be enhned by repling the FCS with utologous serum [21]. We investigted the effet of EGF nd HB-EGF on the tivity of three different ytohrome P 45 isoforms (1A1/2, 2D6, nd 3A4) nd phse II enzyme (UDPgluuronosyl-trnsferse). The tivities mesured in ells vried between the different tretments. CYP1A1/2 tivity ws similr in, NeoHeptoytes obtined from PCMOs treted with either EGF or HB-EGF, nd the effet of both ws onentrtion-dependent. CYP2D6 tivity ws higher in NeoHeptoytes obtined from PCMOs treted with HB-EGF thn those treted with EGF. This sitution ws reversed for the tivity of CYP3A4. The tivity of the phse II enzyme UDPgluuronosyl-trnsferse ws similr for both tretments, but higher thn tht of the ontrol. Disussion Peripherl blood monoytes n be reprogrmmed to generte kind of stem ell-like ell (PCMO), whih is sensitive to differentition into heptoyte-like ells [2,3]. In view of potentil linil use of these ells in regenertive ell therpies suh s tretment of endstge liver diseses, the identifition of ftors pble of inresing the expnsion of PCMOs/NeoHeptoytes is of gret importne. M-CSF nd IL-3 present in the PCMO genertion medium indue prolifertive response in subset of monoytes through tivtion of MEK/ERK1/2 signling (see Figure 4). Sine this signling pthwy is lso tivted by EGF nd HB-EGF nd their reeptors nd is involved in the prolifertion of mny ell types [14-16], we resoned tht EGF should be ble to further stimulte PCMO prolifertion. In greement with this ssumption, we deteted the expression of EGFR nd ERBB3 in monoytes. The expression of both reeptors grdully inresed during monoyte/pcmo ulture, suggesting role for them in the proess of PCMO genertion. Ativtion of EGFR on monoytes hs been reported to be required for monoyte tivtion nd ellulr motility [17]. EGF ws found lso to medite monoyte hemotxis nd mrophge prolifertion [18]. Tking dvntge of the reltive bility of monoyte subpopultions to undergo prolifertion nd generte PCMOs, we showed here tht EGF nd HB-EGF were ble to inrese totl ell ounts nd the ells

7 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 7 of 1 A CYP1A1/2, pmol/min/mg protein 12 B CYP2D6, pmol/min/mg protein2.5 b C CYP3A4, pmol/min/mg protein D UGT, pmol/min/mg protein E Ure, µg/ml/mg Protein bsl NH4Cl b b b F Gluose, nmol/ml/mg Protein bsl Pyruvte+Ltte Figure 5 Effet of EGF nd HB-EGF tretment during PCMO ulture on NeoHeptoyte funtion. PCMOs treted with the indited onentrtions (in μg/l) of EGF or HB-EGF were ultured in heptoyte onditioning medium for 2 weeks before subjeting them to nlysis of ytohrome P45 (CYP) isoforms 1A1/2 (A), 2D6 (B), nd 3A4 (C), the phse II enzyme UDP-gluuronosyl trnsferse (D), ure metbolism (E), nd gluose metbolism (F). Methodologi detils re given in the Methods setion. Dt re presented s men ± SEM of N = 4. Sttistil nlysis: Single-Ftor ANOVA: p <.1 for A, B nd D; ANOVA (2-Ftor with replition) for E: p <.1 between different EGF/HB-EGF tretments; p <.1 between bsl nd NH 4 Cl-tretments; for F: p <.1 between bsl nd pyruvte + ltte tretments; = signifintly different vs. ontrol; b = vs. orresponding HB-EGF vlue; = vs. bsl vlue. prolifertive tivity s ssessed by Ki67 stining. With respet to Ki67 stining the HB-EGF effet did not reh sttistil signifine, whih my be explined by donor-speifi vritions in the monoyte s bility to respond to vrious tretments in ulture (H.U., unpublished observtion). The enhned prolifertion ws ompnied by tivtion of ell yle regultory genes ANAPC2, ABL1, CDK4, CDK6, nd CDC2. ANAPC2 plys n importnt role in the regultion of the G1/S nd G2/M trnsitions while ABL1 regultes the S-phse nd DNA replition. CDK4 nd 6 prtiipte in the G1/ S trnsition nd CDC2 in M-phse regultion. EGF ws lso previously reported to indue inresed ylin D1 expression in other systems [22]. Inhibition of some of the funtionl proteins suh s ANAPC2 nd CDC2 tht form the nphse promoting omplex/ylosome (APC/C) hs been reported to indue ell yle rrest t G2/M [23]. Thus, the indution of ell yle rrest is ssoited with the down-regultion of genes involved in G1/S nd G2/M trnsitions nd n inrese in the expression of these genes n led to tivtion of the ell yle. We onfirmed these results by immunoblotting of prb, whih negtively regultes progression from G through to G1 nd into S phse [24]. The results showed tht tretment with EGF inresed the prb hyperphosphorylted form to greter extent thn HB-EGF whih lso showed higher degree of phosphoryltion thn the ontrol. prb is normlly hypophosphorylted in resting ells t G when prolifertion is repressed. Upon tivtion of the ell yle, pproprite signls led to the subsequent tivtion of the ylin D/CDK4 nd 6, ylin E/CDK2 nd ylin A/CDK2 omplexes, whih inresingly phosphorylte prb during progression through G1. The prb will be kept in hyperphosphorylted (intive) form until lte in mitosis [25]. In ontrst to GM-CSF [26], M-CSF nd IL-3 indued tyrosine phosphoryltion nd tivtion of ERK in monoytes. Moreover, ddition of the MEK inhibitor U126 prevented M-CSF + IL-3-indued prolifertion, strongly suggesting tht MEK/ERK signling drives the prolifertive response of monoytes under stndrd ulture onditions. In the present work, we demonstrted tht ddition of EGF or HB-EGF supertivted the MEK/ ERK pthwy nd further inresed prolifertion. In other systems, the EGFR tyrosine kinse inhibitor Erlotinib, nd U126 ompletely inhibited EGF-indued

8 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 8 of 1 prolifertion [22]. Also, HB-EGF enhned phosphoryltion of Akt nd ERK, implying role for phosphtidylinositol 3-kinse (PI3K)/Akt nd MEK/ERK signling in HB-EGF-stimulted ell prolifertion [16]. The PI3K inhibitors LY2942 nd wortmnnin, nd the MEK/ ERK inhibitors U126 nd PD9859, redued HB-EGFindued BrdU inorportion into ultures [16]. Tken together, it n be onluded tht exposure of PCMOs to EGF or HB-EGF leds to tivtion of their reeptors (ERBB1 nd 3), the expression of whih inreses during PCMO ulture, nd subsequent tivtion of MEK/ERK. This extr input of ERK signling is suffiient to further enhne PCMO prolifertion beyond the level hieved with M-CSF + IL-3-indued ERK tivtion. Our results showed tht both EGF nd HB-EGF tivted ell prolifertion-ssoited hnges in PCMOs during their genertion but tht these effets were generlly stronger for EGF. Nevertheless, tretment with both gents resulted in the sme inrese in totl PCMO ell numbers. This suggests the possibility tht HB-EGF, in ddition to its growth-promoting funtion, exerts nti-poptoti effets on PCMOs tht ontribute to ell expnsion. Interestingly, EGF nd HB-EGF pper to enhne dedifferentition of PCMOs (s ssessed by derese in the expression of p47 phox ) nd to inrese pluripoteny (s ssessed by n indution of Nnog) [6]. We hve previously hrterized stem ell mrker expression in PCMOs nd hve demonstrted similr expression profiles of Nnog nd Ot3/4 during PCMO genertion [6]. Moreover, the expression of Nnog nd Ot3/4 ws prlleled by globl rise in histone H3 methyltion on Lys-4, mrker of tive hromtin, nd oinided with pek sensitivity to heptoyte-speifi differentition [6]. Funtionlly, both EGF nd HB-EGF pplied during PCMO genertion improved the funtion of the resulting NeoHeptoytes when ompred with those derived from ontrol (stndrd) PCMOs. However, the present results demonstrted funtionl similrities of NeoHeptoytes obtined fter PCMO tretment with either EGF or HB-EGF. When EGF nd HB-EGF where ompred for their poteny to enhne the heptoyte-speifi funtions of NeoHeptoytes no mjor differenes were observed, lthough HB-EGF ppers to be superior with respet to ure prodution, gluose metbolism nd CYP2D6 tivity, while EGF ws superior in induing CYP3A4 tivity. Conlusions The present dt revel tht EGF nd HB-EGF improve the prolifertion of PCMOs by supertivting MEK/ ERK signling. Notbly, however, both ftors improve heptoyte-speifi funtions of the resulting NeoHeptoytes whih is n importnt issue when onsidering these ells for trnsplnttion purposes. Bsed on these dt, we suggest modifying the urrent protool of PCMO genertion by dding EGF or HB-EGF to the ulture medium. Methods Genertion of PCMOs Humn peripherl blood monoytes isolted from LRS hmbers or buffy ots from helthy donors were isolted by density grdient entrifugtion nd further purified by dherene seprtion. Cells (1 x 1 5 /m 2 ) were llowed to dhere to tissue ulture plstis for 1 2hin RPMI 164 medium ontining 1% humn AB serum (Lonz, Cologne, Germny), 2 mmol/l glutmine, 1 U/mL peniillin, nd 1 μg/ml streptomyin (ll from Invitrogen, Krlsruhe, Germny). Nondherent ells were removed by spirtion, nd the dherent monoytes were ultured for 4 dys in dedifferentition medium onsisting of RPMI supplemented with 14 μmol/l 2-merptoethnol, 5 μg/l M-CSF, nd.4 μg/l humn IL-3 (both from R&D Systems, Wiesbden, Germny)). In previous experiments these ells hve been tested for purity by flow ytometry nlysis of CD45 nd CD14, typilly yielding purity of 7-8% [2]. Either EGF or HB-EGF (both from R&D Systems) ws dded to the dedifferentition medium t vrious onentrtions (1, 5, or 1 μg/l). The MEK inhibitor U126 ws purhsed from Clbiohem/Merk (Drmstdt, Germny) nd dissolved in dimethyl sulfoxide. Differentition of PCMOs into NeoHeptoytes After 4 dys of ulture in dedifferentition medium PCMOs were ultured for 2 weeks with heptoyte onditioning medium (RPMI 164 medium ontining 3 μg/ L fibroblst growth ftor-4 (FGF-4, R&D Systems) nd 1% FBS) for differentition into NeoHeptoytes [2]. The medium ws hnged every 3 dys. Cells were then subjeted to nlysis of heptoyte funtion. Immunofluoresene PCMOs were wshed with PBS, entrifuged nd diluted with PBS ontining 1% BSA, entrifuged t mximl speed for 3 min using the Cytospin 4 entrifuge (Thermo Sientifi) nd kept in 2 C until needed. For prolifertive ell stining, slides were fixed in 1% prformldehyde, bloked for 1 h nd then inubted with nti-humn CD14 ntibody (BD Biosienes, Heidelberg, Germny) t room temperture for 2 h nd Alexfluor 488 lbeled seondry ntibody (Invitrogen) for 1 h. After wshing, ells were permebilized using.5% triton X-1 nd inubted overnight with the ntihumn Ki67 (BD Phrmingen) t 4 C followed by Alexfluor 555-lbeled seondry ntibody (Invitrogen). Ki67-positive ells were ounted double-blind by two

9 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 9 of 1 investigtors in t lest 4 visul fields per slide, repeted for ll experiments (N = 4) nd relted to the totl ell ount of CD14-positive monoytes in the sme field. RNA isoltion nd quntittive RT-PCR Totl RNA isoltion from PCMOs, humn peripherl blood monoytes nd utologous lymphoytes (purified by elutrition s desribed erlier [6]) ws performed using the GeneJet purifition kit (Ferments, St. Leon- Rot, Germny). To ssure bsene of genomi DNA, ll RNA smples were treted with DNse I, nd primers spnning multiple exon-intron boundries were used. For reverse trnsription, 1 μg of the totl RNA ws reverse trnsribed to first strnd omplementry DNA using the High-Cpity reverse trnsription kit (Applied Biosystems, Drmstdt, Germny). Gene expression ws quntified by stndrd endpoint RT-PCR nd stndrd rel-time RT-PCR (qpcr) on n icyler (Bio- Rd, Munih, Germny) nd nlyzed by grose gel eletrophoresis nd icyler iq Rel-Time Detetion System softwre (Bio-Rd), respetively. The therml yling progrm ws 1 min t 95 C for enzyme tivtion, denturtion for 15 s t 95 C, 6 s nneling t 6 C, nd 6 s extension t 72 C. A dissoition urve ws performed for eh produt to ssure the bsene of primer dimers or unspeifi produts. Primers used in the present study re listed in Tble 1. Reltive quntifition ws performed by ΔΔCt method. To normlize expression dt, mplifition of the housekeeping gene GAPDH ws used s n internl ontrol. Western blotting Following 4 dys of PCMO genertion, ells were thoroughly wshed with PBS to remove non-dherent ells (minly T lymphoytes) nd lysed using PhosphoSfe lysis buffer (Novgen/Merk). Cell lystes were seprted by eletrophoresis prior to trnsfer to PVDF membrnes (Immobilon P). Membrnes were then probed with primry ntibodies nd immunoretive bnds were deteted by hemiluminesene. Primry ntibodies used were MEK1 (C-18), MEK2 (C-16), p-mek1/2 (Ser218/ Ser222), ERK1 (C-16), p-erk (Tyr 24) (ll from Snt Cruz Biotehnology, Heidelberg, Germny), nti-humn prb (BD Phrmingen), nd β-tin (Sigm, Deisenhofen, Germny). Seondry ntibodies were obtined from GE Helthre (Bukinghmshire, UK). Anlysis of NeoHeptoyte funtion Ure mesurement: To remove residul ure from the ulture medium, ells were wshed twie with DPBS. To determine bsl levels of ure formed, ells were inubted with DPBS (1 mm MgCl 2, 1 mm N-pyruvte) for 24 h. To mesure the bility of the ells to metbolize mmonium, the buffer ws supplemented with 5 mm NH 4 Cl ± 1 mm ornithine. Superntnt (8 μl) ws inubted with 6 μl.2% O-phthldehyde solution (.3% Brij-35, 7.4 % H 2 SO 4 ) nd 6 μl NED regent [.6% N-(1-nphthyl)ethylenedimine dihydrohloride,.5% bori id,.3% Brij-35, 22.2% H 2 SO 4 ] for 2 h t 37 C. Absorbne ws mesured t 55 nm nd ompred to stndrd smples [21]. Gluose mesurement: Cells were wshed three times with DPBS before inubtion for 24 h with DPBS (3 mm KCl, 1 mm MgCl 2, 1 mm Npyruvte ± 1 mm N-L-ltte). Superntnt (1 μl) ws inubted with 15 μl GLOX solution (25 mm Tris,.2 mm EDTA,.4% gluose-oxidse,.7% peroxidse,.1% O-dinisidine, ph 8.) for 2 h t 37 C. Absorbne ws mesured t 42 nm nd ompred to stndrd smples. Phse I nd II Enzyme tivity ssys: Fluoresenebsed ytohrome P45 ssys were performed by inubtion of intt ells with seleted substrtes s reported [21]. Briefly, ells ultured on 96-well plte were serum strved (RPMI 164 medium without supplements) overnight prior to mesurement. For mesurement the medium ws repled with 1 μl retion buffer (plin RPMI 164 medium ontining the fluorogeni substrtes: 25 μmol/l 7-ethoxy oumrin for CYP1A1/2, 1 μmol/l AMMC (3-[2-(N,N-diethyl-N-methylmino)ethyl]-7-methoxy-4- methyloumrin) for CYP2D6, 1 μmol/l BFC (7- benzyloxy-4-trifluoromethyloumrin) for CYP3A4 nd 1 μmol/l 4-methylumbelliferon s substrte for UDP- Gluuronosyl-trnsferse). Fluoresene ws mesured every 1 min over period of 2 h with miroplte reder (BMG Lbteh, Offenburg, Germny). Afterwrds ells were fixed for protein quntifition by sulforhodmine B (SRB) stining s previously desribed [27]. Results re given s pmol of fluoresent produt formed (phse I enzyme tivities) or fluoresent substrte redued (for phse II enzyme tivities) per minute normlized to totl protein ontent in mg. Sttistil nlysis All smples were mesured in duplites. Vlues were expressed s men ± SEM. with N = 4 in ll experiments. Group sttistil omprisons were performed by onewy or two-wy nlysis of vrines (ANOVA) followed by Mnn Whitney multi-rnge nlysis s post-ho test. The p vlues were shown in the Results setion A sttistil differene ws onsidered signifint if p <.5. Abbrevitions CDK: Cylin-dependent kinse; EGF: Epiderml growth ftor; ERK: Extrellulr signl-regulted kinse; FBS: Fetl bovine serum; GM-CSF: Grnuloyte mrophge olony-stimulting ftor; h: Hour; HB-EGF: Heprin-binding epiderml growth ftor; IL-3: Interleukin-3; M-CSF: Mrophge olony stimulting ftor; PBS: Phosphte-buffered sline; PCMOs: Progrmmble ell(s) of monoyti origin;

10 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 1 of 1 prb: Retinoblstom protein; s: Seond; SDS-PAGE: Sodium dodeyl sulfte polyrylmide gel eletrophoresis. Competing interests The uthors hve no ompeting interests to delre. Authors ontributions AH, FF, nd HU designed the study nd drfted the mnusript; AH, SE, nd AN oordinted nd onduted the experiments. All uthors red nd pproved the finl mnusript. Aknowledgements We thnk Dr. N. Reiling (Reserh Center Borstel, Borstel, Germny) for the kind dontion of highly pure preprtions of monoytes nd utologous lymphoytes. This work ws supported in prt by grnt from the Bundesministerium für Bildung und Forshung (1 GN 985). Author detils 1 Clini for Applied Cellulr Mediine, UKSH, Cmpus Kiel, Arnold-Heller Strsse 3, Hs. 18, 2415 Kiel, Germny. 2 BG Unfllklinik Tübingen, Eberhrd-Krls Universität Tübingen, Shnrrenbergstr. 95, 7276 Tübingen, Germny. 3 First Deprtment of Mediine, UKSH, Cmpus Lübek, Rtzeburger Allee 16, Lübek, Germny. Reeived: 9 Mrh 212 Aepted: 22 June 212 Published: 8 August 212 Referenes 1. Hengstler JG, Brulport M, Shormnn W, Buer A, Hermes M, Nussler AK, Fndrih F, Ruhnke M, Ungefroren H, Griffin L, Bokmp E, Oesh F, von Mh MA: Genertion of humn heptoytes by stem ell tehnology: definition of the heptoyte. Expert Opin Drug Metb Toxiol 25, 1: Ruhnke M, Ungefroren H, Nussler A, Mrtin F, Brulport M, Shormnn W, Hengstler J, Klpper W, Ulrihs K, Huthinson J, Sori B, Prwrsh R, Heekt P, Kremer B, Fendrih F: Differentition of in vitro-modified humn peripherl blood monoytes into heptoyte-like nd pnreti isletlike ells. Gstroenterology 25, 128: Ruhnke M, Nussler AK, Ungefroren H, Hengstler JG, Kremer B, Hoekh W, Gottwld T, Heekt P, Fndrih F: Humn monoyte-derived neoheptoytes: promising lterntive to primry humn heptoytes for utologous ell therpy. Trnsplnttion 25, 79: Set N, Kuwn M: Derivtion of multipotent progenitors from humn irulting CD14+ monoytes. Exp Hemtol 21, 38: Zho Y, Glensne D, Hubermn E: A humn peripherl blood monoytederived subset ts s pluripotent stem ells. Pro Nt Ad Si USA 23, 1: Ungefroren H, Groth S, Hyder A, Thomsen N, Hinz H, Reiling N, Grge- Griebenow E, Held-Feindt J, Shulze M, Nüssler AK, Fändrih F: The genertion of progrmmble ells of monoyti origin involves prtil repression of monoyte/mrophge mrkers nd retivtion of pluripoteny genes. Stem Cells Dev 21, 19: Clnhy FIL, Hollowy AC, Lri R, Cmeron PU, Hmilton JA: Detetion nd properties of the humn prolifertive monoyte subpopultion. J Leuko Biol 26, 79: Hoelting T, Siperstein AE, Clrk OH, Duh QY: Epiderml growth ftor enhnes prolifertion, migrtion, nd invsion of folliulr nd ppillry thyroid ner in vitro nd in vivo. J Clin Endorinol Metb 1994, 79: Li T, Lu L: Epiderml growth ftor-indued prolifertion requires down-regultion of Px6 in ornel epithelil ells. J Biol Chem 25, 28: Resn C, Le Brs S, Lefebvre V, Frndsen U, Klein T, Foshi M, Pipeleers D, Shrfmnn R, Mdsen O, Heimberg H: EGF-indued prolifertion of dult humn pnreti dut ells is medited by the MEK/ERK sde. Lb Invest 25, 85: Pennok S, Wng Z: Stimultion of ell prolifertion by endosoml epiderml growth ftor reeptor s reveled through two distint phses of signling. Mol Cell Biol 23, 23: Shiff B, MMurphy A, Jsser S, Younes M, Don D, Yigitbsi O, Kim S, Zhou G, Mndl M, Bekele B, Holsinger F, Shermn S, Yeung S, El-Nggr A, Myers J: Epiderml growth ftor reeptor (EGFR) is overexpressed in nplsti thyroid ner, nd the EGFR inhibitor Gefitinib inhibits the growth of nplsti thyroid ner. Clin Cner Res 24, 1: Higshiym S, Lu K, Besner GE, Abrhm JA, Klgsbrun M: Struture of heprin-binding EGF-like growth ftor. Multiple forms, primry struture, nd glyosyltion of the mture protein. J Biol Chem 1992, 267: Hshimoto K, Higshiym S, Asd H, Hshimur E, Kobyshi T, Sudo K, Nkgw T, Dmm D, Yoshikw K, Tniguhi N: Heprin-binding epiderml growth ftor-like growth ftor is n utorine growth ftor for humn kertinoytes. J Biol Chem 1994, 269: Noln T, Girolmo N, Goroneo M, Wkefield D: Prolifertive effets of heprin-binding epiderml growth ftor-like growth ftor on pterygium epithelil ells nd fibroblsts. Investig Opthhlmol Vis Si 24, 45: Jin K, Mo XO, Del Rio Guerr G, Jin L, Greenberg DA: Heprin-binding epiderml growth ftor-like growth ftor stimultes ell prolifertion in erebrl ortil ultures through phosphtidylinositol 3'-kinse nd mitogen-tivted protein kinse. J Neurosi Res 25, 81: Chn G, Noglski MT, Yurohko AD: Ativtion of EGFR on monoytes is required for humn ytomeglovirus entry nd medites ellulr motility. Pro Ntl Ad Si USA 29, 16: Lmb DJ, Modjthedi H, Plnt NJ, Ferns G: EGF medites monoyte hemotxis nd mrophge prolifertion nd EGF reeptor is expressed in therosleroti plques. Atheroslerosis 24, 176: Vietri M, Binhi M, Ludlow JW, Mittnht S, Vill-Moruzzi E: Diret intertion between the tlyti subunit of protein phosphtse 1 nd prb. Cner Cell Int 26, 6: Pgno M, Pepperkok R, Verde F, Ansorge W, Drett G: Cylin A is required t two points in the humn ell yle. EMBO J 1992, 11: Ehnert S, Seeliger C, Vester H, Shmitt A, Sidy-Rd S, Lin J, Neumier M, Gillen S, Kleeff J, Friess H, Burkhrt, Stökle U, Nüssler AK: Autologous serum improves yield nd metboli pity of monoyte-derived heptoytelike ells: Possible implition for ell trnsplnttion. Cell Trnsplnt 211, 2: Lee J, Ryu SH, Kng SM, Chung WC, Gold KA, Kim ES, Hittelmn WN, Ki Hong W, Koo JS: Prevention of bronhil hyperplsi by EGFR pthwy inhibitors in n orgnotypi ulture model. Cner Prev Res (Phil) 211, 4: Heilmn DW, Green MR, Teodoro JG: The nphse promoting omplex: ritil trget for virl proteins nd ntiner drugs. Cell Cyle 25, 4: Sidle A, Plty C, Dirks P, Wiggn O, Kiess M, Gill RM, Wong AK, Hmel PA: Ativity of the retinoblstom fmily proteins, prb, p17, nd p13, during ellulr prolifertion nd differentition. Crit Rev Biohem Mol Biol 1996, 31: De Flo G, Comes F, Simone C: prb: mster of differentition. Coupling irreversible ell yle withdrwl with indution of musle-speifi trnsription. Onogene 26, 25: Ygisw M, Seki K, Okum E, Kitmur T, Kitgw S, Hiri H, Yzki Y, Tkku F, Yuo A: Signl trnsdution pthwys in norml humn monoytes stimulted by ytokines nd meditors: omprtive study with norml humn neutrophils or trnsformed ells nd the puttive roles in funtionlity nd ell biology. Exp Hemtol 1999, 27: Ehnert S, Nussler AK, Lehmnn A, Dooley S: Blood monoyte-derived NeoHeptoytes s in vitro test system for drug metbolism. Drug Metb Dispos 28, 36: doi:1.1186/ x-1-23 Cite this rtile s: Hyder et l.: EGF nd HB-EGF enhne the prolifertion of progrmmble ells of monoyti origin (PCMO) through tivtion of MEK/ERK signling nd improve differentition of PCMO-derived heptoyte-like ells. Cell Communition nd Signling 212 1:23.