Ayman Hyder 1, Sabrina Ehnert 2, Hebke Hinz 1, Andreas K Nüssler 2, Fred Fändrich 1 and Hendrik Ungefroren 1,3*
|
|
- Bridget Reeves
- 5 years ago
- Views:
Transcription
1 Hyder et l. Cell Communition nd Signling 212, 1:23 RESEARCH Open Aess EGF nd HB-EGF enhne the prolifertion of progrmmble ells of monoyti origin (PCMO) through tivtion of MEK/ERK signling nd improve differentition of PCMO-derived heptoyte-like ells Aymn Hyder 1, Sbrin Ehnert 2, Hebke Hinz 1, Andres K Nüssler 2, Fred Fändrih 1 nd Hendrik Ungefroren 1,3* Abstrt Bkground: Heptoyte-like ells (NeoHeptoytes) generted from peripherl blood monoyte-derived stem ell-like ell (the PCMO) re promising lterntive for primry heptoytes in ell trnsplnttion studies to ure liver diseses. However, to be therpeutilly effetive NeoHeptoytes re needed in lrge quntities. It ws the im of the present study to investigte i) whether the proportion of tively proliferting NeoHeptoytes n be enhned by supplementing the PCMO differentition medium (ontining M-CSF, IL-3, nd humn serum) with either EGF or HB-EGF nd ii) whih signling pthwy underlies the promitoti effet. Results: EGF nd HB-EGF enhned ell prolifertion of PCMOs s demonstrted by inresed expression of yle ontrol genes (ABL, ANAPC2, CDC2, CDK4, CDK6), phosphoryltion of the retinoblstom protein, nd inresed PCMO ell numbers fter stimultion with EGF or HB-EGF. EGF lso rised the number of monoytes expressing the prolifertion mrker Ki67. PCMOs expressed the EGF reeptors EGFR (ERBB1) nd ERBB3, nd expression of both inresed during PCMO genertion. Phosphoimmunoblotting of PCMOs indited tht both EGF nd HB-EGF tivted MEK-1/2 nd ERK1/2 in onentrtion-dependent fshion with the effet of EGF being more prominent. EGF tretment further deresed expression of p47 phox nd inresed tht of Nnog inditing enhned dedifferentition nd pluripoteny, respetively. Tretment with both EGF nd HB-EGF resulted in NeoHeptoytes with improved funtionl prmeters. Conlusions: The results suggested tht the ddition of EGF or HB-EGF to PCMO differentition medium supertivtes MEK/ERK signling whih then inreses both PCMO prolifertion, number, nd funtionl differentition of PCMO-derived NeoHeptoytes. Keywords: EGF, Heptoyte-like ells, MEK, Extrellulr signl-regulted kinse, Prolifertion, Progrmmble ells of monoyti origin * Correspondene: hendrik.ungefroren@uksh.de 1 Clini for Applied Cellulr Mediine, UKSH, Cmpus Kiel, Arnold-Heller Strsse 3, Hs. 18, 2415 Kiel, Germny 3 First Deprtment of Mediine, UKSH, Cmpus Lübek, Rtzeburger Allee 16, Lübek, Germny Full list of uthor informtion is vilble t the end of the rtile 212 Hyder et l.; liensee BioMed Centrl Ltd. This is n Open Aess rtile distributed under the terms of the Cretive Commons Attribution Liense ( whih permits unrestrited use, distribution, nd reprodution in ny medium, provided the originl work is properly ited.
2 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 2 of 1 Bkground Although heptoyte trnsplnttion is therpeuti option for end-stge liver diseses, ell mteril is sre due to ritil shortge of liver tissues nd the lk of protools tht llow mintining the differentited heptoyte phenotype in ulture for more thn week. Thus, genertion of heptoyte-like ells from stem ells or stem ell-like ells my represent promising lterntive [1]. One suh ell type with inherent stem ell-like fetures is the humn peripherl blood monoyte [2-5]. By initilly induing proess of dedifferentition we hve generted from these ells more plsti derivtive termed progrmmble ell of monoyti origin (PCMO). PCMOs re prone to quire funtionl tivities of heptoyte-like ells (NeoHeptoytes) upon stimultion with pproprite differentition medi in vitro [2,3], nd in vivo following trnsplnttion into mie [2]. From the linil point of view, mjor obstle in ell trnsplnttion is the lrge mount of ells required to hieve therpeuti effet in ptients. Despite n lredy lrge number of ells tht n be retrieved from blood produts the overll numbers of NeoHeptoytes obtined fter the two-step dedifferentitiondifferentition protool re still low nd insuffiient. One possibility to inrese NeoHeptoyte ell numbers is by induing the ells to proliferte. This is more likely to be possible t or before the PCMO stge s the NeoHeptoyte differentition from PCMO is mutully exlusive with prolifertion. Indeed, during onversion of peripherl blood monoytes into PCMOs, proess involving dedifferentition, frtion of monoytes resume prolifertion in vitro in response to mrophge-olony stimulting ftor (M-CSF), interleukin-3 (IL-3), nd humn serum [2]. The extent of prolifertion however, ws not suffiient to substntilly inrese the overll ellulr yield of NeoHeptoytes. If the rte of prolifertion nd/or the perentge of mitotilly tive monoytes ould be enhned prior to indution of differentition, then n inresed number of NeoHeptoytes my be obtined, thereby inresing the hne for suessful NeoHeptoyte trnsplnttions. Idelly, modifition of the PCMO genertion proedure, e.g. by ddition of growth-stimultory ftor(s), should not only enhne mitoti tivity but lso the plstiity of PCMOs in suh wy tht the resulting NeoHeptoytes beome more heptoyte-like [6]. Interestingly, subpopultion of humn monoytes tht prolifertes in vitro in response to M-CSF hs been suspeted to be less mture nd hene more stem ell-like thn other monoytes [7]. Therefore, the identifition of growth ftor signling pthwys tht regulte prolifertion of humn monoytes my enhne both the quntity nd qulity of PCMO-derived NeoHeptoytes. Epiderml growth ftor (EGF) is known to indue prolifertion in mny kinds of ells [8-11] nd its reeptor is over-expressed in prolifertive ells [12]. Another member from the EGF fmily, the 2 22 kd glyoprotein Heprin-binding epiderml growth ftor (HB-EGF) [13] ws lso reported to be potent mitogen for mny ell types [14-16]. Humn peripherl blood monoytes were shown reently to express funtionl EGF reeptor (EGFR) [17,18], while the EGF reeptors -ERBB2, 3 nd 4 hve not been studied. However, link between EGF or HB-EGF nd prolifertion in monoytes hs never been investigted. Anlysis of the mehnism of reeptor tyrosine kinse tivtion in monoytes my identify soluble ftors tht ontrol PCMO self renewl. The present study imed to investigte the expression nd the tivity of the epiderml growth ftor reeptor (ERBB) fmily in humn peripherl monoytes nd the role of EGF nd HB-EGF on the outome of PCMO genertion nd the subsequent differentition into NeoHeptoytes. Results Gene expression of EGF reeptor fmily members in PCMOs We first sought to determine whih EGF reeptors re expressed in monoytes. For this purpose, RNA ws isolted from monoyte ultures nd proessed for qpcr using primers for EGFR (lso termed ERBB1), ERBB2, ERBB3, nd ERBB4 s listed in Tble 1. RT-PCR nlysis of the four EGF reeptors yielded strong signl for EGFR nd weker one for ERBB3 (Figure 1A). Sine monoytes my be ontminted with lymphoytes, negtive ontrol smple of highly purified lymphoytes ws nlyzed in prllel nd shown to lk expression of both EGFR nd ERBB3 (dt not shown). This indited tht the mplifition produts for EGFR nd ERBB3 were speifilly derived from monoytes. Sine the expression levels of some genes my differ during the development of PCMOs in ulture, we isolted RNA from the developing PCMOs t different dys of ulture. The qpcr of these smples indited tht expression of both EGFR nd ERBB3 initilly inresed during PCMO genertion rehing pek on the seond dy (ERBB3) nd on the fourth dy (EGFR) of ulture nd deresed therefter (Figure 1B). EGF promotes prolifertion during PCMO prodution Next, we exmined the effet of EGF nd HB-EGF on the prolifertion of PCMOs (Figure 2). For this purpose, ells were ultured for 4 dys in PCMO medium ontining EGF or HB-EGF t different onentrtions. Cells were prepred for immunofluoresene using Ki67 ntibody s prolifertion mrker nd CD14 s monoyte mrker. The results showed higher number of
3 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 3 of 1 Tble 1 Sequenes of PCR primers Gene Aession No. Sense primer Antisense primer Produt size (bp) EGFR NM_ ATGCTCTACAACCCCACCAC GCCCTTCGCACTTCTTACAC 193 -erbb2 NM_ CCCTCATCCACCATAACACC GCCTGGCATTCACATACTCC 279 -erbb3 NM_ TACTTGGAACGGGGTGAGAG ACTCTGCCGTCCACTCTTGT 219 -erbb4 NM_ AGTCAGTGTGTGCAGGAACG CTCCAGAGGCAGGTAACGAA 224 Nnog NM_24865 GATTTGTGGGCCTGAAGAAAACT AGGAGAGACAGTCTCCGTGTGAG 79 GAPDH NM_246 TTGCCATCAATGACCCCTTCA CGCCCCACTTGATTTTGGA 174 β-tin NM_31144 GATATCGCTGCGCTCGTC TCCATATCGTCCCAGTTGG 239 ANAPC2 NM_ CCAGTACAGGCGGTGATCTT GCTCTCGTCGTCACTGTCAA 228 ABL-1 NM_ AACACCCTAACCTGGTGCAG CAAGTGGTTCTCCCCTACCA 248 CDC2 (CDK1) NM_ GGGGTCAGCTCGTTACTCAA GATGCTAGGCTTCCTGGTTTC 225 CDK4 NM_75.2 CTGACCGGGAGATCAAGGTA AGCCAGCTTGACTGTTCCAC 224 CDK6 NM_ TCCCAGGAGAAGAAGACTGG GGTCCTGGAAGTATGGGTGA 198 Ki67/CD14 double-positive ells in both EGF nd HB- EGF-treted ultures (Figure 2). However, quntifition of these ells showed tht the HB-EGF but not the EGF effet losely missed sttistil signifine (Figure 2B). No sttistilly signifint differenes of Ki67/CD14-positive ell ounts were observed mong A B EGFR ERBB2 ERBB3 ERBB4 β-tin Figure 1 Detetion of different EGF reeptor fmily members by RT-PCR in humn blood monoytes. (A) Stndrd endpoint RT-PCR of EGFR (lne 2), ERBB2 (lne 3), ERBB3 (lne 4), ERBB4 (lne 5), nd β-tin s ontrol (lne 6) in PCMOs. RNA ws isolted from dy-4 PCMOs nd reverse-trnsribed. Amplifition produts of the resulting DNA (using the primers listed in Tble 1) were run on n grose gel nd stined with ethidiumbromide. A moleulr weight mrker (lne 1) ws run in prllel to onfirm the predited bnd sizes. (B) QPCR nlysis of the sme EGF reeptors in monoytes during the genertion of PCMOs. Dt shown re the men ± SD of 3 seprte experiments performed in duplites. different onentrtions of the sme tretment. These dt lerly show tht the ddition of EGF enhned the prolifertive tivity of monoytes in PCMO genertion medium. EGF-indued prolifertion temporlly orrelted with ell yle tivtion. In order to investigte whether EGF-indued prolifertion ws ssoited with the expression of speifi ell-yle regultory genes, we treted monoytes with different onentrtions of EGF or HB-EGF nd performed qpcr nlysis s desribed in the Methods setion. As seen in Tble 2, both EGF nd HB-EGF up-regulted the expression of ABL, ANAPC2, CDC2, CDK4, nd CDK6, eh of whih is involved in different stges of the ell yle. RNA ws isolted from PCMOs fter 4-dy ulture with or without EGF or HB-EGF (1, 5, 1 μg/l) nd trnsribed to DNA. QPCR ws pplied using primer pirs listed in Tble 1. Dt re presented s men ± SEM of N = 4 nd represent the fold-hnge in omprison with ontrol PCMOs (ultured without HB-EGF or EGF), the vlues of whih were onsidered s 1. Sttistil nlysis: = signifintly different from the ontrol, b: signifintly different from the orresponding HB-EGF vlue. The retinoblstom protein (prb) plys pivotl role in the negtive ontrol of the ell yle nd prevents the ell from repliting dmged DNA by bloking progression through G1 into S phse. Its inhibitory role on ell yle progression is rried out in the hypophosphorylted stte, while phosphoryltion intivtes prb [19]. We hve nlysed the phosphoryltion stte of prb in PCMOs generted in the presene of either EGF or HB- EGF (Figure 2C). The results show tht tretment with HB-EGF inresed the phosphoryltion of prb, while EGF used its hyperphosphoryltion. In ontrol ells, however, only the tive non-phosphorylted form ws present (Figure 2C). We hve lso investigted ylin A protein in the sme smples. Cylin A defines ontrol points of the ell yle.
4 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 4 of 1 A B C D Figure 2 EGF nd HB-EGF inrese the number of mitotilly tive ells in PCMO ultures. (A) immunofluoresene of Ki67 expression (red) in PCMO ultures treted for 4 dys with the indited onentrtions of either EGF or HB-EGF. PCMOs were immunostined with CD14 (green) s monoyte-speifi mrker. Nulei were stined with DAPI (blue). (B) Quntifition of Ki67 expressing PCMOs fter tretment with EGF or HB-EGF. Dt (N = 3) re expressed s men ± SEM. Sttistil nlysis: denotes signifint differene from the ontrol; b denotes signifint differene from the orresponding vlues of HB-EGF. (C) Immunoblotting of the retinoblstom protein nd ylin A in PCMO ultures treted for 4 dys with the indited onentrtions (in μg/l) of either HB-EGF or EGF. The housekeeping protein β-tin ws deteted s loding ontrol. Densitometri nlysis of ylin A nd β-tin bnds ws performed using NIH ImgeJ softwre (version 1.45). The indited vlues below the blots represent the normlized signl intensities for ylin A reltive to untreted ontrol ells set t 1. (D) PCMO ell ounts fter 4 dys of ulture with 1 μg/l of either EGF or HB-EGF (N = 3). Sttistil nlysis: denotes signifint differene from the ontrol. It binds both CDK2 nd CDC2 giving rise to two distint ylin A kinse tivities, one ppering in S phse nd the other one in G2 phse [2]. Immunoblotting indited n inrese in ylin A expression upon tretment of PCMOs with 5 nd 1 μg/l HB-EGF nd with ll three onentrtions of EGF (Figure 2C). Finlly, we performed ell ounting of PCMOs ultured for 4 dys with either 1 μg/l EGF or HB-EGF Tble 2 Expression of ell yle genes during the development of PCMOs ultured in the presene of HB-EGF or EGF ABL ANAPC2 CDC2 CDK4 CDK6 Hb-EGF ± ± ± ± ± 1.1 Hb-EGF ± ± ± ± ±.8 Hb-EGF ± ± ± ± ± 1.6 EGF ±.18 b 1.78 ± ± 1.5 b 1.57 ± ±.96 EGF ±.2 b 1.7 ± ± ± ±.87 EGF ±.3 b 1.6 ± ± ± ±.93 ANOVA =
5 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 5 of 1 (Figure 2D). The results demonstrted moderte but signifint inrese over the ontrol in totl ell ounts fter both tretments. No differene ws observed between the two tretments. Together, the dt show tht EGF nd HB-EGF re suitble tools to expnd the totl ell number of PCMOs nd tht this lrgely ours through n inrese in the mitoti/ell yle tivity of monoytes. EGF tretment ttenutes expression of p47 phox nd enhnes expression of Nnog in PCMOs During the genertion of PCMOs, monoytes downregulte mrkers of differentition, e.g. p47 phox n essentil subunit of the retive oxygen produing enzyme NAD (P)H oxidse nd upregulte mrkers of pluripoteny, e.g. Nnog [6]. We hve exmined the effet of EGF nd HB-EGF on the expression of p47 phox by immunoblotting (Figure 3A) nd on the expression of Nnog by qpcr (Figure 3B). The p47 phox protein levels were lerly lower on dy 4 of ulture whih ws prtiulrly prominent in EGF-treted ultures (Figure 3A). No A B p47 phox β-tin Nnog mrna onentrtion Fold indution of ontrol Figure 3 Regultion of Nnog nd p47 phox expression by EGF or HB-EGF in PCMOs. (A) Mesurement of Nnog expression by qpcr in PCMOs treted for 4 dys with the indited onentrtions (in μg/l) of HB-EGF or EGF. Dt (men ± SEM, N = 4) were normlized to the expression level of GAPDH. ANOVA: p <.1; = ll vlues of EGF nd HB-EGF re signifintly higher thn tht of the ontrol; b = signifint differene between EGF nd the orresponding HB-EGF vlue. (B) Immunoblot nlysis of p47 phox in dy-4 PCMOs treted with either HB-EGF or EGF t the indited onentrtions. The β-tin protein ws deteted s loding ontrol. b differenes were observed between tretments with different onentrtions of EGF. Both EGF nd HB-EGF used more thn 2-fold inrese in the mrna levels of Nnog (Figure 3B). Sttistilly signifint differenes were observed neither mong EGF nd HB-EGF tretments nor mong different onentrtions of eh growth ftor. The dt suggest tht EGF n enhne both the extent of dedifferentition nd pluripoteny. MEK/ERK signling drives prolifertion in PCMOs nd is supertivted by EGF nd HB-EGF ERK nd MEK tivtion is involved in M-CSF nd EGF-indued prolifertion of PCMOs. We hve previously shown tht during PCMO ulture, subset of monoytes resumes prolifertion. To test whether this is ssoited with tivtion of MEK/ERK signling, we performed immunoblot nlysis of ERK tivtion (Figure 4A). ERK phosphoryltion during PCMO genertion peked on dy 3 4 of ulture nd this inrese oinided with pek mitoti tivity [2]. This suggested tht ERK tivtion is uslly involved in driving prolifertion of monoytes/pcmos. To test this more diretly, we inhibited MEK1 with U126 during PCMO ulture nd ssessed the number of ells on dy 6. The totl number of ells ws low, inditing tht MEK/ERK signling is ruil for PCMO prolifertion (Figure 4B). Sine both EGF nd HB-EGF re known to stimulte ERK tivtion, we resoned tht these gents my enhne prolifertion by supertivting the MEK/ERK pthwy. To test this predition, PCMOs were generted in stndrd PCMO differentition medium in the bsene or presene of either EGF or HB-EGF nd subjeted to immunoblot nlysis of phospho-mek nd phospho-erk. The results indited tht both EGF nd HB-EGF tivted MEK nd ERK nd tht the effet ws onentrtion-dependent nd more prominent in EGFtreted thn in HB-EGF-treted PCMOs (Figure 4C). Effet of EGF nd HB-EGF on NeoHeptoyte funtion Idelly, modifition of the PCMO genertion proedure should not only enhne prolifertion but lso the stem ell fetures of PCMOs in wy tht the resulting NeoHeptoytes beome more heptoyte-like. We therefore tested whether dding EGF nd HB-EGF to the PCMO genertion medium would lter funtionl prmeters of the Neoeptoytes. Control PCMOs nd PCMOs generted in the presene of either EGF or HB- EGF were llowed to differentite into NeoHeptoytes for 2 weeks nd t the end of this period were nlysed for heptoyte-speifi funtions (Figure 5). NeoHeptoytes, regrdless of tretment, inluding the ontrol, formed nd sereted ure in similr mounts s under bsi onditions. Addition of NH 4 Cl inresed ure formtion in ll settings. However, it ws
6 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 6 of 1 A Culture dy p-erk1 C p-mek MEK1 MEK2 ERK1 p-erk ERK1/2 B - U126 + U126 β-tin HB-EGF (µg/l) EGF (µg/l) Figure 4 MEK/ERK signling drives prolifertion in PCMOs nd is supertivted by EGF nd HB-EGF. (A) M-CSF nd Il-3 indue phosphoryltion of ERK (perk). Protein smples were obtined from PCMOs ultured for vrious dys (s indited) in stndrd PCMO differentition medium. (B) Inhibition of ERK ws suffiient to inhibit PCMO prolifertion. Cells were ultured with either solvent (left) or the ERK inhibitor U126 (right) for 6 dys nd imges were tken. Originl mgnifition: 5x. (C) HB-EGF nd EGF indue phosphoryltion of MEK nd ERK. Phospho-MEK (p-mek), MEK1/2, phospho-erk (p-erk), nd ERK1/2 expression ws exmined by immunoblotting in lystes of dy-4 PCMOs tht hve been treted with the indited onentrtions of either HB-EGF or EGF. higher in NeoHeptoytes obtined from PCMOs generted in the presene of HB-EGF. NeoHeptoytes regrdless of tretment, inluding the ontrol, ll sereted gluose t similr rtes. To mesure the bility of the ells to perform gluoneogenesis, the N-pyruvteontining inubtion buffer ws supplemented with N-L-ltte. Stimultion with pyruvte/ltte indued higher gluose seretion ompred to non-stimulted ultures. As for ure, the effet ws higher in NeoHeptoytes obtined from PCMOs generted in the presene of HB-EGF. NeoHeptoytes exhibit phse I nd II enzyme tivities. However, levels were signifintly lower ompred to primry humn heptoytes [21] nd ould be enhned by repling the FCS with utologous serum [21]. We investigted the effet of EGF nd HB-EGF on the tivity of three different ytohrome P 45 isoforms (1A1/2, 2D6, nd 3A4) nd phse II enzyme (UDPgluuronosyl-trnsferse). The tivities mesured in ells vried between the different tretments. CYP1A1/2 tivity ws similr in, NeoHeptoytes obtined from PCMOs treted with either EGF or HB-EGF, nd the effet of both ws onentrtion-dependent. CYP2D6 tivity ws higher in NeoHeptoytes obtined from PCMOs treted with HB-EGF thn those treted with EGF. This sitution ws reversed for the tivity of CYP3A4. The tivity of the phse II enzyme UDPgluuronosyl-trnsferse ws similr for both tretments, but higher thn tht of the ontrol. Disussion Peripherl blood monoytes n be reprogrmmed to generte kind of stem ell-like ell (PCMO), whih is sensitive to differentition into heptoyte-like ells [2,3]. In view of potentil linil use of these ells in regenertive ell therpies suh s tretment of endstge liver diseses, the identifition of ftors pble of inresing the expnsion of PCMOs/NeoHeptoytes is of gret importne. M-CSF nd IL-3 present in the PCMO genertion medium indue prolifertive response in subset of monoytes through tivtion of MEK/ERK1/2 signling (see Figure 4). Sine this signling pthwy is lso tivted by EGF nd HB-EGF nd their reeptors nd is involved in the prolifertion of mny ell types [14-16], we resoned tht EGF should be ble to further stimulte PCMO prolifertion. In greement with this ssumption, we deteted the expression of EGFR nd ERBB3 in monoytes. The expression of both reeptors grdully inresed during monoyte/pcmo ulture, suggesting role for them in the proess of PCMO genertion. Ativtion of EGFR on monoytes hs been reported to be required for monoyte tivtion nd ellulr motility [17]. EGF ws found lso to medite monoyte hemotxis nd mrophge prolifertion [18]. Tking dvntge of the reltive bility of monoyte subpopultions to undergo prolifertion nd generte PCMOs, we showed here tht EGF nd HB-EGF were ble to inrese totl ell ounts nd the ells
7 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 7 of 1 A CYP1A1/2, pmol/min/mg protein 12 B CYP2D6, pmol/min/mg protein2.5 b C CYP3A4, pmol/min/mg protein D UGT, pmol/min/mg protein E Ure, µg/ml/mg Protein bsl NH4Cl b b b F Gluose, nmol/ml/mg Protein bsl Pyruvte+Ltte Figure 5 Effet of EGF nd HB-EGF tretment during PCMO ulture on NeoHeptoyte funtion. PCMOs treted with the indited onentrtions (in μg/l) of EGF or HB-EGF were ultured in heptoyte onditioning medium for 2 weeks before subjeting them to nlysis of ytohrome P45 (CYP) isoforms 1A1/2 (A), 2D6 (B), nd 3A4 (C), the phse II enzyme UDP-gluuronosyl trnsferse (D), ure metbolism (E), nd gluose metbolism (F). Methodologi detils re given in the Methods setion. Dt re presented s men ± SEM of N = 4. Sttistil nlysis: Single-Ftor ANOVA: p <.1 for A, B nd D; ANOVA (2-Ftor with replition) for E: p <.1 between different EGF/HB-EGF tretments; p <.1 between bsl nd NH 4 Cl-tretments; for F: p <.1 between bsl nd pyruvte + ltte tretments; = signifintly different vs. ontrol; b = vs. orresponding HB-EGF vlue; = vs. bsl vlue. prolifertive tivity s ssessed by Ki67 stining. With respet to Ki67 stining the HB-EGF effet did not reh sttistil signifine, whih my be explined by donor-speifi vritions in the monoyte s bility to respond to vrious tretments in ulture (H.U., unpublished observtion). The enhned prolifertion ws ompnied by tivtion of ell yle regultory genes ANAPC2, ABL1, CDK4, CDK6, nd CDC2. ANAPC2 plys n importnt role in the regultion of the G1/S nd G2/M trnsitions while ABL1 regultes the S-phse nd DNA replition. CDK4 nd 6 prtiipte in the G1/ S trnsition nd CDC2 in M-phse regultion. EGF ws lso previously reported to indue inresed ylin D1 expression in other systems [22]. Inhibition of some of the funtionl proteins suh s ANAPC2 nd CDC2 tht form the nphse promoting omplex/ylosome (APC/C) hs been reported to indue ell yle rrest t G2/M [23]. Thus, the indution of ell yle rrest is ssoited with the down-regultion of genes involved in G1/S nd G2/M trnsitions nd n inrese in the expression of these genes n led to tivtion of the ell yle. We onfirmed these results by immunoblotting of prb, whih negtively regultes progression from G through to G1 nd into S phse [24]. The results showed tht tretment with EGF inresed the prb hyperphosphorylted form to greter extent thn HB-EGF whih lso showed higher degree of phosphoryltion thn the ontrol. prb is normlly hypophosphorylted in resting ells t G when prolifertion is repressed. Upon tivtion of the ell yle, pproprite signls led to the subsequent tivtion of the ylin D/CDK4 nd 6, ylin E/CDK2 nd ylin A/CDK2 omplexes, whih inresingly phosphorylte prb during progression through G1. The prb will be kept in hyperphosphorylted (intive) form until lte in mitosis [25]. In ontrst to GM-CSF [26], M-CSF nd IL-3 indued tyrosine phosphoryltion nd tivtion of ERK in monoytes. Moreover, ddition of the MEK inhibitor U126 prevented M-CSF + IL-3-indued prolifertion, strongly suggesting tht MEK/ERK signling drives the prolifertive response of monoytes under stndrd ulture onditions. In the present work, we demonstrted tht ddition of EGF or HB-EGF supertivted the MEK/ ERK pthwy nd further inresed prolifertion. In other systems, the EGFR tyrosine kinse inhibitor Erlotinib, nd U126 ompletely inhibited EGF-indued
8 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 8 of 1 prolifertion [22]. Also, HB-EGF enhned phosphoryltion of Akt nd ERK, implying role for phosphtidylinositol 3-kinse (PI3K)/Akt nd MEK/ERK signling in HB-EGF-stimulted ell prolifertion [16]. The PI3K inhibitors LY2942 nd wortmnnin, nd the MEK/ ERK inhibitors U126 nd PD9859, redued HB-EGFindued BrdU inorportion into ultures [16]. Tken together, it n be onluded tht exposure of PCMOs to EGF or HB-EGF leds to tivtion of their reeptors (ERBB1 nd 3), the expression of whih inreses during PCMO ulture, nd subsequent tivtion of MEK/ERK. This extr input of ERK signling is suffiient to further enhne PCMO prolifertion beyond the level hieved with M-CSF + IL-3-indued ERK tivtion. Our results showed tht both EGF nd HB-EGF tivted ell prolifertion-ssoited hnges in PCMOs during their genertion but tht these effets were generlly stronger for EGF. Nevertheless, tretment with both gents resulted in the sme inrese in totl PCMO ell numbers. This suggests the possibility tht HB-EGF, in ddition to its growth-promoting funtion, exerts nti-poptoti effets on PCMOs tht ontribute to ell expnsion. Interestingly, EGF nd HB-EGF pper to enhne dedifferentition of PCMOs (s ssessed by derese in the expression of p47 phox ) nd to inrese pluripoteny (s ssessed by n indution of Nnog) [6]. We hve previously hrterized stem ell mrker expression in PCMOs nd hve demonstrted similr expression profiles of Nnog nd Ot3/4 during PCMO genertion [6]. Moreover, the expression of Nnog nd Ot3/4 ws prlleled by globl rise in histone H3 methyltion on Lys-4, mrker of tive hromtin, nd oinided with pek sensitivity to heptoyte-speifi differentition [6]. Funtionlly, both EGF nd HB-EGF pplied during PCMO genertion improved the funtion of the resulting NeoHeptoytes when ompred with those derived from ontrol (stndrd) PCMOs. However, the present results demonstrted funtionl similrities of NeoHeptoytes obtined fter PCMO tretment with either EGF or HB-EGF. When EGF nd HB-EGF where ompred for their poteny to enhne the heptoyte-speifi funtions of NeoHeptoytes no mjor differenes were observed, lthough HB-EGF ppers to be superior with respet to ure prodution, gluose metbolism nd CYP2D6 tivity, while EGF ws superior in induing CYP3A4 tivity. Conlusions The present dt revel tht EGF nd HB-EGF improve the prolifertion of PCMOs by supertivting MEK/ ERK signling. Notbly, however, both ftors improve heptoyte-speifi funtions of the resulting NeoHeptoytes whih is n importnt issue when onsidering these ells for trnsplnttion purposes. Bsed on these dt, we suggest modifying the urrent protool of PCMO genertion by dding EGF or HB-EGF to the ulture medium. Methods Genertion of PCMOs Humn peripherl blood monoytes isolted from LRS hmbers or buffy ots from helthy donors were isolted by density grdient entrifugtion nd further purified by dherene seprtion. Cells (1 x 1 5 /m 2 ) were llowed to dhere to tissue ulture plstis for 1 2hin RPMI 164 medium ontining 1% humn AB serum (Lonz, Cologne, Germny), 2 mmol/l glutmine, 1 U/mL peniillin, nd 1 μg/ml streptomyin (ll from Invitrogen, Krlsruhe, Germny). Nondherent ells were removed by spirtion, nd the dherent monoytes were ultured for 4 dys in dedifferentition medium onsisting of RPMI supplemented with 14 μmol/l 2-merptoethnol, 5 μg/l M-CSF, nd.4 μg/l humn IL-3 (both from R&D Systems, Wiesbden, Germny)). In previous experiments these ells hve been tested for purity by flow ytometry nlysis of CD45 nd CD14, typilly yielding purity of 7-8% [2]. Either EGF or HB-EGF (both from R&D Systems) ws dded to the dedifferentition medium t vrious onentrtions (1, 5, or 1 μg/l). The MEK inhibitor U126 ws purhsed from Clbiohem/Merk (Drmstdt, Germny) nd dissolved in dimethyl sulfoxide. Differentition of PCMOs into NeoHeptoytes After 4 dys of ulture in dedifferentition medium PCMOs were ultured for 2 weeks with heptoyte onditioning medium (RPMI 164 medium ontining 3 μg/ L fibroblst growth ftor-4 (FGF-4, R&D Systems) nd 1% FBS) for differentition into NeoHeptoytes [2]. The medium ws hnged every 3 dys. Cells were then subjeted to nlysis of heptoyte funtion. Immunofluoresene PCMOs were wshed with PBS, entrifuged nd diluted with PBS ontining 1% BSA, entrifuged t mximl speed for 3 min using the Cytospin 4 entrifuge (Thermo Sientifi) nd kept in 2 C until needed. For prolifertive ell stining, slides were fixed in 1% prformldehyde, bloked for 1 h nd then inubted with nti-humn CD14 ntibody (BD Biosienes, Heidelberg, Germny) t room temperture for 2 h nd Alexfluor 488 lbeled seondry ntibody (Invitrogen) for 1 h. After wshing, ells were permebilized using.5% triton X-1 nd inubted overnight with the ntihumn Ki67 (BD Phrmingen) t 4 C followed by Alexfluor 555-lbeled seondry ntibody (Invitrogen). Ki67-positive ells were ounted double-blind by two
9 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 9 of 1 investigtors in t lest 4 visul fields per slide, repeted for ll experiments (N = 4) nd relted to the totl ell ount of CD14-positive monoytes in the sme field. RNA isoltion nd quntittive RT-PCR Totl RNA isoltion from PCMOs, humn peripherl blood monoytes nd utologous lymphoytes (purified by elutrition s desribed erlier [6]) ws performed using the GeneJet purifition kit (Ferments, St. Leon- Rot, Germny). To ssure bsene of genomi DNA, ll RNA smples were treted with DNse I, nd primers spnning multiple exon-intron boundries were used. For reverse trnsription, 1 μg of the totl RNA ws reverse trnsribed to first strnd omplementry DNA using the High-Cpity reverse trnsription kit (Applied Biosystems, Drmstdt, Germny). Gene expression ws quntified by stndrd endpoint RT-PCR nd stndrd rel-time RT-PCR (qpcr) on n icyler (Bio- Rd, Munih, Germny) nd nlyzed by grose gel eletrophoresis nd icyler iq Rel-Time Detetion System softwre (Bio-Rd), respetively. The therml yling progrm ws 1 min t 95 C for enzyme tivtion, denturtion for 15 s t 95 C, 6 s nneling t 6 C, nd 6 s extension t 72 C. A dissoition urve ws performed for eh produt to ssure the bsene of primer dimers or unspeifi produts. Primers used in the present study re listed in Tble 1. Reltive quntifition ws performed by ΔΔCt method. To normlize expression dt, mplifition of the housekeeping gene GAPDH ws used s n internl ontrol. Western blotting Following 4 dys of PCMO genertion, ells were thoroughly wshed with PBS to remove non-dherent ells (minly T lymphoytes) nd lysed using PhosphoSfe lysis buffer (Novgen/Merk). Cell lystes were seprted by eletrophoresis prior to trnsfer to PVDF membrnes (Immobilon P). Membrnes were then probed with primry ntibodies nd immunoretive bnds were deteted by hemiluminesene. Primry ntibodies used were MEK1 (C-18), MEK2 (C-16), p-mek1/2 (Ser218/ Ser222), ERK1 (C-16), p-erk (Tyr 24) (ll from Snt Cruz Biotehnology, Heidelberg, Germny), nti-humn prb (BD Phrmingen), nd β-tin (Sigm, Deisenhofen, Germny). Seondry ntibodies were obtined from GE Helthre (Bukinghmshire, UK). Anlysis of NeoHeptoyte funtion Ure mesurement: To remove residul ure from the ulture medium, ells were wshed twie with DPBS. To determine bsl levels of ure formed, ells were inubted with DPBS (1 mm MgCl 2, 1 mm N-pyruvte) for 24 h. To mesure the bility of the ells to metbolize mmonium, the buffer ws supplemented with 5 mm NH 4 Cl ± 1 mm ornithine. Superntnt (8 μl) ws inubted with 6 μl.2% O-phthldehyde solution (.3% Brij-35, 7.4 % H 2 SO 4 ) nd 6 μl NED regent [.6% N-(1-nphthyl)ethylenedimine dihydrohloride,.5% bori id,.3% Brij-35, 22.2% H 2 SO 4 ] for 2 h t 37 C. Absorbne ws mesured t 55 nm nd ompred to stndrd smples [21]. Gluose mesurement: Cells were wshed three times with DPBS before inubtion for 24 h with DPBS (3 mm KCl, 1 mm MgCl 2, 1 mm Npyruvte ± 1 mm N-L-ltte). Superntnt (1 μl) ws inubted with 15 μl GLOX solution (25 mm Tris,.2 mm EDTA,.4% gluose-oxidse,.7% peroxidse,.1% O-dinisidine, ph 8.) for 2 h t 37 C. Absorbne ws mesured t 42 nm nd ompred to stndrd smples. Phse I nd II Enzyme tivity ssys: Fluoresenebsed ytohrome P45 ssys were performed by inubtion of intt ells with seleted substrtes s reported [21]. Briefly, ells ultured on 96-well plte were serum strved (RPMI 164 medium without supplements) overnight prior to mesurement. For mesurement the medium ws repled with 1 μl retion buffer (plin RPMI 164 medium ontining the fluorogeni substrtes: 25 μmol/l 7-ethoxy oumrin for CYP1A1/2, 1 μmol/l AMMC (3-[2-(N,N-diethyl-N-methylmino)ethyl]-7-methoxy-4- methyloumrin) for CYP2D6, 1 μmol/l BFC (7- benzyloxy-4-trifluoromethyloumrin) for CYP3A4 nd 1 μmol/l 4-methylumbelliferon s substrte for UDP- Gluuronosyl-trnsferse). Fluoresene ws mesured every 1 min over period of 2 h with miroplte reder (BMG Lbteh, Offenburg, Germny). Afterwrds ells were fixed for protein quntifition by sulforhodmine B (SRB) stining s previously desribed [27]. Results re given s pmol of fluoresent produt formed (phse I enzyme tivities) or fluoresent substrte redued (for phse II enzyme tivities) per minute normlized to totl protein ontent in mg. Sttistil nlysis All smples were mesured in duplites. Vlues were expressed s men ± SEM. with N = 4 in ll experiments. Group sttistil omprisons were performed by onewy or two-wy nlysis of vrines (ANOVA) followed by Mnn Whitney multi-rnge nlysis s post-ho test. The p vlues were shown in the Results setion A sttistil differene ws onsidered signifint if p <.5. Abbrevitions CDK: Cylin-dependent kinse; EGF: Epiderml growth ftor; ERK: Extrellulr signl-regulted kinse; FBS: Fetl bovine serum; GM-CSF: Grnuloyte mrophge olony-stimulting ftor; h: Hour; HB-EGF: Heprin-binding epiderml growth ftor; IL-3: Interleukin-3; M-CSF: Mrophge olony stimulting ftor; PBS: Phosphte-buffered sline; PCMOs: Progrmmble ell(s) of monoyti origin;
10 Hyder et l. Cell Communition nd Signling 212, 1:23 Pge 1 of 1 prb: Retinoblstom protein; s: Seond; SDS-PAGE: Sodium dodeyl sulfte polyrylmide gel eletrophoresis. Competing interests The uthors hve no ompeting interests to delre. Authors ontributions AH, FF, nd HU designed the study nd drfted the mnusript; AH, SE, nd AN oordinted nd onduted the experiments. All uthors red nd pproved the finl mnusript. Aknowledgements We thnk Dr. N. Reiling (Reserh Center Borstel, Borstel, Germny) for the kind dontion of highly pure preprtions of monoytes nd utologous lymphoytes. This work ws supported in prt by grnt from the Bundesministerium für Bildung und Forshung (1 GN 985). Author detils 1 Clini for Applied Cellulr Mediine, UKSH, Cmpus Kiel, Arnold-Heller Strsse 3, Hs. 18, 2415 Kiel, Germny. 2 BG Unfllklinik Tübingen, Eberhrd-Krls Universität Tübingen, Shnrrenbergstr. 95, 7276 Tübingen, Germny. 3 First Deprtment of Mediine, UKSH, Cmpus Lübek, Rtzeburger Allee 16, Lübek, Germny. Reeived: 9 Mrh 212 Aepted: 22 June 212 Published: 8 August 212 Referenes 1. Hengstler JG, Brulport M, Shormnn W, Buer A, Hermes M, Nussler AK, Fndrih F, Ruhnke M, Ungefroren H, Griffin L, Bokmp E, Oesh F, von Mh MA: Genertion of humn heptoytes by stem ell tehnology: definition of the heptoyte. Expert Opin Drug Metb Toxiol 25, 1: Ruhnke M, Ungefroren H, Nussler A, Mrtin F, Brulport M, Shormnn W, Hengstler J, Klpper W, Ulrihs K, Huthinson J, Sori B, Prwrsh R, Heekt P, Kremer B, Fendrih F: Differentition of in vitro-modified humn peripherl blood monoytes into heptoyte-like nd pnreti isletlike ells. Gstroenterology 25, 128: Ruhnke M, Nussler AK, Ungefroren H, Hengstler JG, Kremer B, Hoekh W, Gottwld T, Heekt P, Fndrih F: Humn monoyte-derived neoheptoytes: promising lterntive to primry humn heptoytes for utologous ell therpy. Trnsplnttion 25, 79: Set N, Kuwn M: Derivtion of multipotent progenitors from humn irulting CD14+ monoytes. Exp Hemtol 21, 38: Zho Y, Glensne D, Hubermn E: A humn peripherl blood monoytederived subset ts s pluripotent stem ells. Pro Nt Ad Si USA 23, 1: Ungefroren H, Groth S, Hyder A, Thomsen N, Hinz H, Reiling N, Grge- Griebenow E, Held-Feindt J, Shulze M, Nüssler AK, Fändrih F: The genertion of progrmmble ells of monoyti origin involves prtil repression of monoyte/mrophge mrkers nd retivtion of pluripoteny genes. Stem Cells Dev 21, 19: Clnhy FIL, Hollowy AC, Lri R, Cmeron PU, Hmilton JA: Detetion nd properties of the humn prolifertive monoyte subpopultion. J Leuko Biol 26, 79: Hoelting T, Siperstein AE, Clrk OH, Duh QY: Epiderml growth ftor enhnes prolifertion, migrtion, nd invsion of folliulr nd ppillry thyroid ner in vitro nd in vivo. J Clin Endorinol Metb 1994, 79: Li T, Lu L: Epiderml growth ftor-indued prolifertion requires down-regultion of Px6 in ornel epithelil ells. J Biol Chem 25, 28: Resn C, Le Brs S, Lefebvre V, Frndsen U, Klein T, Foshi M, Pipeleers D, Shrfmnn R, Mdsen O, Heimberg H: EGF-indued prolifertion of dult humn pnreti dut ells is medited by the MEK/ERK sde. Lb Invest 25, 85: Pennok S, Wng Z: Stimultion of ell prolifertion by endosoml epiderml growth ftor reeptor s reveled through two distint phses of signling. Mol Cell Biol 23, 23: Shiff B, MMurphy A, Jsser S, Younes M, Don D, Yigitbsi O, Kim S, Zhou G, Mndl M, Bekele B, Holsinger F, Shermn S, Yeung S, El-Nggr A, Myers J: Epiderml growth ftor reeptor (EGFR) is overexpressed in nplsti thyroid ner, nd the EGFR inhibitor Gefitinib inhibits the growth of nplsti thyroid ner. Clin Cner Res 24, 1: Higshiym S, Lu K, Besner GE, Abrhm JA, Klgsbrun M: Struture of heprin-binding EGF-like growth ftor. Multiple forms, primry struture, nd glyosyltion of the mture protein. J Biol Chem 1992, 267: Hshimoto K, Higshiym S, Asd H, Hshimur E, Kobyshi T, Sudo K, Nkgw T, Dmm D, Yoshikw K, Tniguhi N: Heprin-binding epiderml growth ftor-like growth ftor is n utorine growth ftor for humn kertinoytes. J Biol Chem 1994, 269: Noln T, Girolmo N, Goroneo M, Wkefield D: Prolifertive effets of heprin-binding epiderml growth ftor-like growth ftor on pterygium epithelil ells nd fibroblsts. Investig Opthhlmol Vis Si 24, 45: Jin K, Mo XO, Del Rio Guerr G, Jin L, Greenberg DA: Heprin-binding epiderml growth ftor-like growth ftor stimultes ell prolifertion in erebrl ortil ultures through phosphtidylinositol 3'-kinse nd mitogen-tivted protein kinse. J Neurosi Res 25, 81: Chn G, Noglski MT, Yurohko AD: Ativtion of EGFR on monoytes is required for humn ytomeglovirus entry nd medites ellulr motility. Pro Ntl Ad Si USA 29, 16: Lmb DJ, Modjthedi H, Plnt NJ, Ferns G: EGF medites monoyte hemotxis nd mrophge prolifertion nd EGF reeptor is expressed in therosleroti plques. Atheroslerosis 24, 176: Vietri M, Binhi M, Ludlow JW, Mittnht S, Vill-Moruzzi E: Diret intertion between the tlyti subunit of protein phosphtse 1 nd prb. Cner Cell Int 26, 6: Pgno M, Pepperkok R, Verde F, Ansorge W, Drett G: Cylin A is required t two points in the humn ell yle. EMBO J 1992, 11: Ehnert S, Seeliger C, Vester H, Shmitt A, Sidy-Rd S, Lin J, Neumier M, Gillen S, Kleeff J, Friess H, Burkhrt, Stökle U, Nüssler AK: Autologous serum improves yield nd metboli pity of monoyte-derived heptoytelike ells: Possible implition for ell trnsplnttion. Cell Trnsplnt 211, 2: Lee J, Ryu SH, Kng SM, Chung WC, Gold KA, Kim ES, Hittelmn WN, Ki Hong W, Koo JS: Prevention of bronhil hyperplsi by EGFR pthwy inhibitors in n orgnotypi ulture model. Cner Prev Res (Phil) 211, 4: Heilmn DW, Green MR, Teodoro JG: The nphse promoting omplex: ritil trget for virl proteins nd ntiner drugs. Cell Cyle 25, 4: Sidle A, Plty C, Dirks P, Wiggn O, Kiess M, Gill RM, Wong AK, Hmel PA: Ativity of the retinoblstom fmily proteins, prb, p17, nd p13, during ellulr prolifertion nd differentition. Crit Rev Biohem Mol Biol 1996, 31: De Flo G, Comes F, Simone C: prb: mster of differentition. Coupling irreversible ell yle withdrwl with indution of musle-speifi trnsription. Onogene 26, 25: Ygisw M, Seki K, Okum E, Kitmur T, Kitgw S, Hiri H, Yzki Y, Tkku F, Yuo A: Signl trnsdution pthwys in norml humn monoytes stimulted by ytokines nd meditors: omprtive study with norml humn neutrophils or trnsformed ells nd the puttive roles in funtionlity nd ell biology. Exp Hemtol 1999, 27: Ehnert S, Nussler AK, Lehmnn A, Dooley S: Blood monoyte-derived NeoHeptoytes s in vitro test system for drug metbolism. Drug Metb Dispos 28, 36: doi:1.1186/ x-1-23 Cite this rtile s: Hyder et l.: EGF nd HB-EGF enhne the prolifertion of progrmmble ells of monoyti origin (PCMO) through tivtion of MEK/ERK signling nd improve differentition of PCMO-derived heptoyte-like ells. Cell Communition nd Signling 212 1:23.
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationOpen Access RESEARCH ARTICLE. Genetics Selection Evolution
DOI 10.1186/s12711-016-0222-0 Genetis Seletion Evolution RESEARCH ARTICLE Open Aess Comprison of host geneti ftors influening pig response to infetion with two North Amerin isoltes of porine reprodutive
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationAlteration of peripheral blood lymphocyte subsets in acute pancreatitis
PO Box 2345, Beijing 123, Chin World J Gstroenterol 26 September 7; 12(33): 5344-5351 www.wjgnet.om World Journl of Gstroenterology ISSN 17-9327 wjg@wjgnet.om 26 The WJG Press. All rights reserved. CLINICAL
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationRNAi Targeting CXCR4 Inhibits Tumor Growth Through Inducing Cell Cycle Arrest and Apoptosis
originl rtile RNAi Trgeting CXCR4 Inhiits Tumor Growth Through Induing Cell Cyle Arrest nd Apoptosis To Yu 1,2, Yingying Wu 2, Yi Hung 1,2, Chorn Yn 1, Ying Liu 1, Zongsheng Wng 3, Xioyi Wng 1, Yuming
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationIntroduction to Study Designs II
Introdution to Study Designs II Commonly used study designs in publi helth & epidemiologi reserh Benjmin Rihrd H. Muthmbi, DrPH, MPH Stte HIV Epidemiologist HIV Epidemiology Investigtion Setion PA Deprtment
More informationMelatonin, a novel selective ATF-6 inhibitor, induces human hepatoma cell apoptosis through COX-2 downregulation
Submit Mnusript: http://www.wjgnet.om/esps/ Help Desk: http://www.wjgnet.om/esps/helpdesk.spx DOI: 10.3748/wjg.v23.i6.986 World J Gstroenterol 2017 Februry 14; 23(6):986-998 ISSN 1007-9327 (print) ISSN
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationInternational Immunopharmacology
Interntionl Immunophrmology 11 (211) 222 2226 Contents lists vilble t SiVerse SieneDiret Interntionl Immunophrmology journl homepge: www.elsevier.om/lote/intimp Impt of the rotenoid stxnthin on phgoyti
More informationDifferential expression of cyclin G2, cyclin dependent kinase inhibitor 2C and peripheral myelin protein 22 genes during adipogenesis..
The Ohio Stte University From the SeletedWorks of Jiin Zhng Summer My 5, 214 Differentil expression of ylin G2, ylin dependent kinse inhiitor 2C nd peripherl myelin protein 22 genes during dipogenesis..pdf
More information13-cis Retinoic Acid Induces Apoptosis and Cell Cycle Arrest in Human SEB-1 Sebocytes
ORIGINAL ARTILE See relted ommentry on pge 15 13-is Retinoi Aid Indues Apoptosis nd ell yle Arrest in Humn SEB-1 Seoytes Amnd M. Nelson 1, Kthryn L. Gillilnd 1, Zhoyun ong 1 nd Dine M. Thioutot 1, Isotretinoin
More informationgene expression in HepC2 and Caco2 cells by palmitate, oleate, and 25-hydroxycholestero11
Regultion of low density lipoprotein reeptor gene expression in HepG nd Co ells by plmitte, olete, nd 5-hydroxyholestero11 Ri Ajit K. Srivstv,' Hiroo I ~O,~ Mtthis Hess,4 Neelm Srivstv, nd Gustv Shonfeld
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationMinimum effective dose of chenic acid for gallstone patients: reduction with bedtime administration and
Gut, 1982, 23, 28-284 Minimum effetive dose of heni id for gllstone ptients: redution with bedtime dministrtion nd low holesterol diet D P MUDGL, R M KUPFER, ND T C NORTHFIELD* From the Normn Tnner Gstroenterology
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationActivation of Akt as a Mechanism for Tumor Immune Evasion
The Amerin Soiety of Gene Therpy originl rtile Ativtion of Akt s Mehnism for Tumor Immune Evsion Kyung Hee Noh 1, Te Heung Kng 1, Jin Hee Kim 1, Sr I Pi 2, Ken Y Lin 3, Chien-Fu Hung 4, T-C Wu 4 7 nd Te
More informationRoles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells
ritish Journl of Cner (23) 89, 18 191 & 23 Cner Reserh UK All rights reserved 7 92/3 $2. www.jner.om Roles of the PI-3K nd MEK pthwys in Rs-medited hemoresistne in rest ner ells W Jin 1,LWu 1, K Ling 1,
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationLong-pulse gastric electrical stimulation protects interstitial cells of Cajal in diabetic rats via IGF-1 signaling pathway
Submit Mnusript: http://www.wjgnet.om/esps/ Help Desk: http://www.wjgnet.om/esps/helpdesk.spx DOI: 10.3748/wjg.v22.i23.5353 World J Gstroenterol 2016 June 21; 22(23): 5353-5363 ISSN 1007-9327 (print) ISSN
More informationThe soy isoflavone genistein promotes apoptosis in mammary epithelial cells by inducing the tumor suppressor PTEN
Crinogenesis vol. no.1 pp.1793 183, 5 doi:1.193/rin/gi131 dvne ess pulition My 19, 5 The soy isoflvone genistein promotes poptosis in mmmry epithelil ells y induing the tumor suppressor huvnesh Dve 1,,
More informationEffects of Plant Sphingolipids on Inflammatory Stress in Differentiated Caco-2 Cells
Journl of Oleo Siene Copyright 2017 y Jpn Oil Chemists Soiety doi : 10.5650/jos.ess17171 J. Oleo Si. 66, (12) 1337-1342 (2017) NOTE Effets of Plnt Sphingolipids on Inflmmtory Stress in Differentited Co-2
More informationInsulin-like Growth Factor-binding Protein-7 (IGFBP7): A Promising Gene Therapeutic for Hepatocellular Carcinoma (HCC)
originl rtile The Amerin Soiety of Gene & Cell Therpy Insulin-like Growth Ftor-inding Protein-7 (IGFBP7): A Promising Gene Therpeuti for Heptoellulr Crinom (HCC) Dong Chen 1, Ayesh Siddiq 2, Luni Emdd
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationPhytosphingosine-phosphate is a signal for AtMPK6 activation and Arabidopsis response to chilling
Reserh Phytosphingosine-phosphte is signl for AtMPK6 tivtion nd Arbidopsis response to hilling Christelle Dutilleul 1, Ghouziel Benhssine-Kesri 1, Chntl Demndre 1, Nthlie Rézé 1, Albn Luny 1, Sndr Pelletier
More informationThe Tumor Necrosis Factor Receptor and Human Neutrophil Function Deactivation and Cross-deactivation of Tumor Necrosis Factor-induced
The Tumor Nerosis Ftor Reeptor nd Humn Neutrophil Funtion Detivtion nd Cross-detivtion of Tumor Nerosis Ftor-indued Neutrophil Responses by Reeptor Down-regultion oris Shleifenbum nd Jorg Fehr Division
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationProgestin effects on cell proliferation pathways in the postmenopausal mammary gland
Wood et l. Brest Cner Reserh 213, 15:R62 http://rest-ner-reserh.om/ontent/15/4/r62 RESEARCH ARTICLE Open Aess Progestin effets on ell prolifertion pthwys in the postmenopusl mmmry glnd Chrles E Wood 1,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationTargeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma
Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn.216.29 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses
More informationARTICLE. I. Chopra & H. F. Li & H. Wang & K. A. Webster
Dietologi (212) 55:783 794 DOI 1.17/s125-11-247-y ARTICLE Phosphoryltion of the insulin reeptor y AMP-tivted protein kinse (AMPK) promotes lignd-independent tivtion of the insulin signlling pthwy in rodent
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationA1/Bfl-1 expression is restricted to TCR engagement in T lymphocytes
(3) 1, 19 17 & 3 Nture Pulishing Group All rights reserved 13-97/3 $. www.nture.om/dd /Bfl-1 expression is restrited to TCR enggement in T lymphoytes C Vershelde 1, T Wlzer, P Gli 1, M-C Biémont 1, L Quemeneur
More informationARTICLES. Host-reactive CD8 + memory stem cells in graft-versushost. Yi Zhang, Gerard Joe, Elizabeth Hexner, Jiang Zhu & Stephen G Emerson
Host-retive CD8 + memory stem ells in grft-versushost disese Yi Zhng, Gerrd Joe, Elizeth Hexner, Jing Zhu & Stephen G Emerson Grft-versus-host disese (GVHD) is used y lloretive donor T ells tht trigger
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationGSK-3 is a master regulator of neural progenitor homeostasis
GSK-3 is mster regultor of neurl progenitor homeostsis Woo-Yng Kim 1, Xinshuo Wng 1, Yohong Wu 1, Brdley W Dole 2, Stish Ptel 3, Jmes R Woodgett 3 & Willim D Snider 1 The development of the rin requires
More informationT e c h n i c a l R e p o r t s
Enhned detetion of myeloperoxidse tivity in deep tissues through luminesent exittion of ner-infrred nnoprtiles Ning Zhng 1,3, Kevin P Frnis 1, Arun Prksh 2 & Dniel Ansldi 1 npg 213 Nture Ameri, In. All
More informationOvercoming Immune Tolerance Against Multiple Myeloma With Lentiviral Calnexin-engineered Dendritic Cells
The Amerin Soiety of Gene Therpy originl rtile Overoming Immune Tolerne Aginst Multiple Myelom With Lentivirl Clnexin-engineered Dendriti Cells Shuhong Hn 1, Bei Wng 1, Mtthew J Cotter 1, Li-Jun Yng 2,
More information1. Introduction. Universidade de São Paulo, São Paulo, Brazil. Correspondence should be addressed to Ana Claudia Latronico;
BioMed Reserh Interntionl, Artile ID 936031, 7 pges http://dx.doi.org/10.1155/2014/936031 Reserh Artile Amplifition of the Insulin-Like Growth Ftor 1 Reeptor Gene Is Rre Event in Adrenoortil Adenorinoms:
More informationRapamycin toxicity in MIN6 cells and rat and human islets is mediated by the inhibition of mtor complex 2 (mtorc2)
Dietologi (212) 55:1355 1365 DOI 1.17/s125-12-2475-7 ARTICLE myin toxiity in MIN6 ells nd rt nd humn islets is medited y the inhiition of mtor omplex 2 (mtorc2) A. D. Brlow & J. Xie & C. E. Moore & S.
More informationWhangarei District Council Class 4 Gambling Venue Policy
Whngrei Distrit Counil Clss 4 Gmling Venue Poliy April 2013 Whngrei Distrit Counil Clss 4 Gmling Venue Poliy Tle of ontents Introdution... 3 1 Ojetives of the poliy in so fr s promoted y the Gmling At
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationFRAMEstar. 2-Component PCR Plates
FRAMEstr -Component Pltes FrmeStr two-omponent tehnology redues evportion from pltes, improving results nd llowing for volume redutions to sve on expensive regents. FrmeStr pltes mximise therml stility
More informationPathogenesis of NSAID-induced gastric damage: Importance of cyclooxygenase inhibition and gastric hypermotility
Online Submissions: http://www.wjgnet.om/7-9327offie wjg@wjgnet.om doi:.3748/wjg.v18.i18.2147 World J Gstroenterol 12 My 14; 18(18): 2147-21 ISSN 7-9327 (print) ISSN 2219-28 (online) 12 Bishideng. All
More informationOocytes determine cumulus cell lineage in mouse ovarian follicles
133 Reserh tile Ooytes determine umulus ell linege in mouse ovrin folliles Frniso J. Diz, Kren Wigglesworth nd John J. Eppig* The Jkson Lortory, 6 Min Street, Br Hror, ME 469, USA *Author for orrespondene
More informationInfluence of FSH on in vitro growth, steroidogenesis and DNA synthesis of buffalo (Bubalus bubalis) ovarian preantral follicles
Anim. Reprod., v.10, n.1, p.32-40, Jn./Mr. 2013 Influene of FSH on in vitro growth, steroidogenesis nd DNA synthesis of ufflo (Bulus ulis) ovrin prentrl folliles G. Tmilmni, V.P. Vrshney, P.K. Duey, M.C.
More informationMicroRNA 125b promotes tumor metastasis through targeting tumor protein 53 induced nuclear protein 1 in patients with non small cell lung cancer
Li et l. Cner Cell Int (15) 15:8 DOI 1.118/s1935-15-33-x PRIMARY RESEARCH MiroRNA 15 promotes tumor metstsis through trgeting tumor protein 53 indued nuler protein 1 in ptients with non smll ell lung ner
More informationImpaired gp100-specific CD8 + T-Cell Responses in the Presence of Myeloid-Derived Suppressor Cells in a Spontaneous Mouse Melanoma Model
ORIGINAL ARTICLE Impired gp1-speifi CD8 + T-Cell Responses in the Presene of Myeloid-Derived Suppressor Cells in Spontneous Mouse Melnom Model Dvid G. Mirhofer 1, Dniel Ortner 1, Christoph H. Tripp 1,2,
More information... Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. immunology letters to nature
Supplementry informtion is ville in Nture s World-Wide We site (http:// www.nture.om) or s pper opy from the London editoril offie of Nture. Aknowledgements Supported in prt y grnts from the NIH (A.A.,
More informationIranian Food Science and Technology Research Journal Vol. 6, No. 3, Fall, 2010.
Irnin Food Siene nd Tehnology Reserh Journl Vol. 6, No. 3, Fll, 2010. rvghi.mrym@gmil.om C ( AOAC 920.87 AOAC 942.05 AOAC 962.09 AOAC 922.06 AOAC 925.10 AACC 1- Extrusion-Expelling 2- Protein Dispersiility
More informationEffects of Estrogen on Beta-Amyloid-Induced Cholinergic Cell Death in the Nucleus Basalis Magnocellularis
Pgintion Instrutions: This rtile should begin on RIGHT pge! Originl Pper Neuroendorinology DOI: 1.1159/321119 Reeived: August 18, 21 Aepted fter revision: September 8, 21 Published online: Otober 9, 21
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationInvolvement of thioredoxin-interacting protein (TXNIP) in glucocorticoid-mediated beta cell death
Dietologi (12) 55:148 157 DOI 1.7/s125-11-2422-z ARTICLE Involvement of thioredoxin-interting protein (TXNIP) in gluoortioid-medited et ell deth E. Reih & A. Tmry & R. Vogt Sionov & D. Melloul Reeived:
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationAutocrine IL-2 is required for secondary population expansion of CD8 + memory T cells
Autorine IL-2 is required for seondry popultion expnsion of CD8 + memory T ells Soni Feu, Rmon Arens,2, Susn Togher & Stephen P Shoenerger 2 Nture Ameri, In. All rights reserved. Two ompeting theories
More informationTransient Removal of CD46 Is Safe and Increases B-cell Depletion by Rituximab in CD46 Transgenic Mice and Macaques
The Amerin Soiety of Gene & Cell Therpy originl rtile Trnsient Removl of CD46 Is Sfe nd Inreses B-ell Depletion by Rituximb in CD46 Trnsgeni Mie nd Mques Ines Beyer 1,6, Hu Co 1, Jons Persson 1, Hongjie
More informationE2F1 stability is regulated by a novel-pkc/p38b MAP kinase signaling pathway during keratinocyte differentiation
(2006) 25, 430 437 & 2006 Nture Pulishing Group All rights reserved 0950-9232/06 $30.00 www.nture.om/on ORGINAL ARTICLE stility is regulted y novel-pkc/p38 MAP kinse signling pthwy during kertinoyte differentition
More informationWesternBright Quantum
WesternBright Quntum Quntify hemiluminesent Western lots over wie ynmi rnge WesternBright Quntum is new hemiluminesent regent speilly formulte for CCD imging. This novel Horserish peroxise (HRP) sustrte
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationInhibition of hepatocytic autophagy by okadaic acid and other protein phosphatase inhibitors
Eur. J. Biohem. 215, 113122 (1993) FEBS 1993 nhibition of heptoyti utophgy by okdi id nd other protein phosphtse inhibitors ngunn HOLEN, Pul B. GORDON nd Per. SEGLEN Deprtment of Tissue Culture, nstitute
More informationToxicity effects of seven Cu compounds/nps in Lettuce (Lactuca sativa) and Alfalfa (Medicago sativa)
Toxiity effets of seven Cu ompounds/nps in Lettue (Ltu stiv) nd Alflf (Medigo stiv) Jie Hong, Lijun Zho, Cyren Rio, Jose R Perlt-Vide, Jorge Grde-Torresdey The University of Texs t El Pso UC-CEIN Theme
More informationBSC 2094C MOCK EXAM A
BSC 2094C MOCK EXAM A PART A: Multiple Choie True/Flse Items 1. Vriose veins re hrterized by. 1. tortuous nd irregulr diltions in superfiil veins due to inompetent vlves 2. being used by prolonged bk pressure
More informationCombined biotic stresses trigger similar transcriptomic responses but contrasting resistance against a chewing herbivore in Brassica nigra
Bonnet et l. BMC Plnt Biology (217) 17:127 DOI 1.1186/s1287-17-174-7 RESEARCH ARTICLE Open Aess Combined bioti stresses trigger similr trnsriptomi responses but ontrsting resistne ginst hewing herbivore
More informationJeffrey D. Coleman, 1 Jerry T. Thompson, 1 Russell W. Smith III, 1 Bogdan Prokopczyk, 2,3 and John P. Vanden Heuvel 1,3,4. 1.
PPAR Reserh Volume 213, Artile ID 121956, 11 pges http://dx.doi.org/1.1155/213/121956 Reserh Artile Role of Peroxisome Prolifertor-Ativted Reeptor β/δ nd B-Cell Lymphom-6 in Regultion of Genes Involved
More informationIrisin biomarker, TSH, Trygleceriads and High Density Lipoproteins in thyroid diesase patients
Interntionl Journl of ChemTeh Reserh CODEN (USA): IJCRGG, ISSN: 0974-4290, ISSN(Online):2455-9555 Vol.10 No.2, pp 674-678, 2017 Irisin biomrker, TSH, Trygleerids nd High Density Lipoproteins in thyroid
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationEndothelial Cells Promote Pigmentation through Endothelin Receptor B Activation
ORIGINAL ARTICLE Endothelil Cells Promote Pigmenttion through Endothelin Reeptor B Ativtion Clire Regzzetti, Gin Mro De Dontis, Houd Hmmmi Ghorel 2, Nthlie Crdot-Lei 3, Dmien Amrosetti 3, Philippe Bhdorn
More information