In vivo imaging using fluorescent antibodies to TNF predicts therapeutic response in Crohn s disease
|
|
- Allen Ralf Logan
- 5 years ago
- Views:
Transcription
1 In vivo imaging using fluorescent antibodies to TNF predicts therapeutic response in Crohn s disease Raja Atreya, Helmut Neumann, Clemens Neufert, Maximilian J. Waldner, Ulrike Billmeier, Yurdagül Zopf, Marcus Willma, Christine App, Tino Münster, Hermann Kessler, Stefanie Maas, Bernd Gebhardt, Ralph Heimke-Brinck, Eva Reuter, Frank Dörje, Tilman T. Rau, Wolfgang Uter, Thomas D. Wang, Ralf Kiesslich, Michael Vieth, Ewald Hannappel & Markus F. Neurath Supplementary Figure 1 Supplementary Figure 1 Analysis of fluorescent adalimumab (a) SDS-PAGE gel electrophoresis of fluorescein isothiocyanate-adalimumab, which was labeled with a 14-fold excess of fluorescein isothiocyanate (HF1) and adalimumab (H) and fluorescein isothiocyanate-adalimumab after removing the excess fluorescent dye with a dye removal column according to the study protocol (HF2). The left panel depicts the fluorescence when the gel was exposed to UV light. The right panel shows the gel after Coomassie staining. All lanes contained 1 µg of the protein. (b) Hypothetical model of fluorescent adalimumab based on the above analysis. 1
2 Supplementary Figure 2 Supplementary Figure 2 In vivo staining with labeled adalimumab. (a) In vivo molecular imaging with fluorescent adalimumab led to the identification of mtnfexpressing mucosal immune cells. Scale bar represents 25 µm. (b) The same confocal image was contrast-enhanced by Fiji imaging technique to augment the contrast between mtnf-positive mucosal cells and the background. Scale bar represents 25 µm. (c) Autofluorescence background of the mucosa in a patient with Crohn s disease before staining was performed with fluorescent adalimumab. Scale bar represents 25 µm. (d) Receiver operator characteristics (ROC) analysis of the mean number of in vivo mtnf expressing cells patient -1 during the molecular imaging procedure. The ROC analysis identified values of , rounded to 20, as an optimum cut-point (arrow) to differentiate between patients in the high and low mtnf groups, with a sensitivity of 84.6% and a specificity of 91.7% for the prediction of response to adalimumab therapy. 2
3 Supplementary Figure 3 Supplementary Figure 3 Ex vivo staining of histological gut sections from the mucosal area adjacent to the site where molecular imaging was performed using fluorescent adalimumab. (a b) Patients with low and high numbers of mtnf expressing mucosal immune cells could be differentiated by ex vivo staining. Scale bar represents 25 µm. (c) Quantitative analysis demonstrated that patients with Crohn s disease and clinical response to adalimumab therapy after 12 weeks had a significantly higher number of mtnf expressing immune cells than patients lacking clinical response to adalimumab therapy. Data represent mean values ±s.e.m.; *P = 0.02 (t-test; two-sided). (d) Representative immunofluorescence staining for mtnf with FITC labeled adalimumab (green) and antibodies against CD4 or CD14 (all red) in gut cryosections from patients with Crohn s disease. Nuclei were counterstained with DAPI (blue). Double positive cells are shown in yellow (enlarged image). Representative images of one out of 11 patients are shown. Scale bars represent 10 µm. (e) Higher percentage of mtnf positive cells among intestinal CD14+ macrophages compared to CD4+ T-cells in patients with Crohn s disease (n = 11). Data represent mean values ±s.e.m.; ***P = (ttest; two-sided). 3
4 Supplementary Figure 4 * * Supplementary Figure 4 Clinical findings upon adalimumab therapy. (a) Clinical outcome analysis showed that patients with a higher number of mtnf positive intestinal cells had a statistically significant reduction of their CDAI levels after 4 and 12 weeks of adalimumab treatment in comparison to the baseline CDAI before initiation of adalimumab therapy. Patients were subsequently followed over a period of 52 weeks. In the follow up of the patients with high mtnf expression it could be shown that this group has a sustained significant reduction of the CDAI score even one year after the initiation of the adalimumab treatment. In contrast, patients with low numbers of mtnf positive cells did not show any significant reduction in CDAI scores. Data represent mean values ±s.e.m.; *P = 0.04; **P = ***P = (t-test; two-sided). (b) Patients with high numbers of mtnf expressing cells had a statistically significant reduction of their corticosteroid use after 4 and 12 weeks of adalimumab treatment in comparison to patients with low numbers of mtnf expressing cells. Data represent mean values ±s.e.m.; *P = 0.04 (t-test; two-sided). 4
5 Supplementary Figure 5 Supplementary Figure 5 Ulcerations and mucosal healing rate during follow-up endoscopy in the high mtnf group. Endoscopic analysis at the beginning of the study showed that 100% of the patients in the low and high mtnf groups had mucosal ulcerations prior to the induction of the treatment with the antibody to TNF adalimumab. In 11 out of 12 patients with high mtnf expression, a follow up white light endoscopic examination could be performed at a mean of 17 months (range months) after initiation of adalimumab therapy. 27% of these patients still had mucosal ulcerations during the follow-up indicating that 73% of the patients with high mtnf expression had mucosal healing. Mucosal healing was defined as the absence of mucosal ulcerations during the follow-up endoscopy. 5
6 Supplementary Table 1 Clinical characteristics of responders and nonresponders Characteristic Responder Nonresponder P value Female, n (%) 5 (38.5) 4 (33.3) 1 Age in years, mean (s.d.) 43.5 (17.3) 39.3 (11.3) 0.57 Body weight at V1 in kilograms, mean (s.d.) Disease duration in years, mean (s.d.) Involved intestinal area, n (%): Colonic Ileal Gastroduodenal 75.5 (10.3) 72.4 (13.4) (10.2) 11.3 (5.8) (53.8) 8 (61.5) 3 (23.1) 8 (66.7) 9 (75) 1 (7.7) Previous anti-tnf exposure, n (%) 1 (7.7) 1 (8.3) 1 Concomitant medication, n (%): Aminosalicylates Corticosteroids Azathioprine Antibiotics 6 (46.2) 6 (46.2) 5 (38.5) 0 (0) 1 (8.3) 7 (58.3) 4 (33.3) 1 (8.3) Current smoker, n (%) 4 (30.8) 0 (0) 0.10 CRP at V3, mean ( s.d.) 8.8 (16.9) 18.1 (22.3) 0.19 Stenosis, n (%) 4 (30.8) 8 (66.7) 0.16 Comparison of patient characteristics between responders and nonresponders to adalimumab therapy. Results of statistical tests yielded no evidence of significant differences between the two groups. V1, visit 1; V3, visit 3.
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationMucosal healing: does it really matter?
Oxford Inflammatory Bowel Disease MasterClass Mucosal healing: does it really matter? Professor Jean-Frédéric Colombel, New York, USA Oxford Inflammatory Bowel Disease MasterClass Mucosal healing: does
More informationChromoendoscopy and Endomicroscopy for detecting colonic dysplasia
Chromoendoscopy and Endomicroscopy for detecting colonic dysplasia Ralf Kiesslich I. Medical Department Johannes Gutenberg University Mainz, Germany Cumulative cancer risk in ulcerative colitis 0.5-1.0%
More informationMucosal Healing in Crohn s Disease. Geert D Haens MD, PhD University Hospital Gasthuisberg University of Leuven Leuven, Belgium
Mucosal Healing in Crohn s Disease Geert D Haens MD, PhD University Hospital Gasthuisberg University of Leuven Leuven, Belgium Mucosal Lesions in CD: General Features CD can affect the entire GI tract
More informationSupplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent
Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy
More informationThere are several severe disorders that may affect the. Imaging and Advanced Technology
Imaging and Advanced Technology Ralf Kiesslich and Pankaj Jay Pasricha, Section Editors Assessment of Tumor Development and Wound Healing Using Endoscopic Techniques in Mice MARKUS F. NEURATH,* NADINE
More informationDefinitions. Clinical remission: Resolution of symptoms (stool frequency 3/day, no bleeding and no urgency)
CROHN S DISEASE Definitions Clinical remission: Resolution of symptoms (stool frequency 3/day, no bleeding and no urgency) Recurrence: The reappearance of lesions after surgical resection Endoscopic remission:
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationCrohn s Disease: A New Approach to an Old Problem
Management of Postoperative Crohn s Disease: A New Approach to an Old Problem Miguel Regueiro, M.D. Associate Professor of Medicine Associate Chief for Education Clinical Head and Co-Director, IBD Center
More informationConfocal Laser Endomicroscopy of the Colon
clinical imaging Confocal Laser Endomicroscopy of the Colon Dan Ionut Gheonea, Adrian Saftoiu, Tudorel Ciurea, Carmen Popescu, Claudia Valentina Georgescu, Anca Malos Research Center of Gastroenterology
More informationIL-12 family members in experimental colitis. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany
IL-12 family members in experimental colitis Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany IBD - Pathogenesis Genetic Predisposition Bacterial Antigens Activation of
More informationAnne Griffiths MD, FRCPC. SickKids Hospital, University of Toronto. Buenos Aires, August 16, 2014
Management and Medical Therapies for Crohn disease: strategies to enhance mucosal healing Anne Griffiths MD, FRCPC SickKids Hospital, University of Toronto Buenos Aires, August 16, 2014 New onset Crohn
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationDisclosures. What Do I Do When Anti-TNF Therapy Is Not Working Anymore? Fadi Hamid, M.D. Saint Luke s GI Specialists
What Do I Do When Anti-TNF Therapy Is Not Working Anymore? Fadi Hamid, M.D. Saint Luke s GI Specialists Disclosures No financial relationships to disclose. 1 Learning Objectives Case 24M with ileocolonic
More informationINFLIXIMAB FOR PREVENTION OF POST-OPERATIVE CROHN S DISEASE RECURRENCE: THE PREVENT TRIAL
INFLIXIMAB FOR PREVENTION OF POST-OPERATIVE CROHN S DISEASE RECURRENCE: THE PREVENT TRIAL A. Hillary Steinhart, MD MSc FRCP(C) Medical Lead, Mount Sinai Hospital IBD Centre Professor of Medicine University
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationThe legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 3 October 2012
The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION 3 October 2012 REMICADE 100 mg, powder for concentrate for solution for infusion B/1 vial (CIP code: 562 070-1) Applicant:
More informationHDF Case Whipple s disease
HDF Case 952556 Whipple s disease 63 yo female complaining of a diarrhea for 2 months, weigth loss (12 Kg in 3 months), and joint pains. Duodenal biopsy performed. Scanning view, enlarged intestinal villi,
More informationOriginalarbeiten: Tino Münster Muenster T Tino Muenster Tino Münster Muenster Tino Münster Tino Münster Tino Münster
Originalarbeiten: Heike Schmitt, Ulrike Billmeier, Walburga Dieterich, Timo Rath, Sophia Sonnewald, Stephen Reid, Simon Hirschmann, Kai Hildner, Maximilian J Waldner, Jonas Mudter, Arndt Hartmann, Robert
More informationConfocal laser endomicroscopy for the differential diagnosis of ulcerative colitis and Crohn s disease: a pilot study
Confocal laser endomicroscopy for the differential diagnosis of ulcerative colitis and Crohn s disease: a pilot study Authors Gian Eugenio Tontini 1, 2, Jonas Mudter 1, Michael Vieth 3, Raja Atreya 1,
More informationTrough level of infliximab is useful for assessing mucosal healing in Crohn s disease: a prospective cohort study
ORIGINAL ARTICLE pissn 1598-91 eissn 2288-1956 https://doi.org/1.5217/ir.218.16.2.223 Intest Res 218;16(2):223-232 Trough level of infliximab is useful for assessing mucosal healing in Crohn s disease:
More informationSantulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
More informationAnti-TNF antibodies do not induce the apoptosis of lamina propria mononuclear cells in uninflamed intestinal tissue in patients with Crohn s disease
FOLIA HISTOCHEMICA ET CYTOBIOLOGICA Vol. 51, No. 3, 2013 pp. 239 243 ORIGINAL STUDY Anti-TNF antibodies do not induce the apoptosis of lamina propria mononuclear cells in uninflamed intestinal tissue in
More informationPrevention and Management of Postoperative Crohn s disease
Prevention and Management of Postoperative Crohn s disease Miguel Regueiro, M.D. Associate Professor of Medicine Associate Chief for Education Clinical Head and Co-Director, IBD Center Director, Gastroenterology,
More informationGhrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus)
Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus) Ayelén Melisa Blanco 1,2, Juan Ignacio Bertucci 2,3, Naresh Ramesh 2, María Jesús Delgado
More information2.0 Synopsis. Adalimumab M Clinical Study Report Final R&D/15/1054. (For National Authority Use Only)
2.0 Synopsis AbbVie Inc. Name of Study Drug: Adalimumab Name of Active Ingredient: Adalimumab Individual Study Table Referring to Part of Dossier: Volume: Page: (For National Authority Use Only) Title
More informationBiologic Therapy for Inflammatory. Is Top-Down Too Top-Heavy? S. Devi Rampertab, MD, FACG, AGAF Associate Professor of Medicine University of Florida
Biologic Therapy for Inflammatory Bowel Disease: Is Top-Down Too Top-Heavy? S. Devi Rampertab, MD, FACG, AGAF Associate Professor of Medicine University of Florida Learning Objectives Evaluate evidence
More informationPerianal Fistula of Crohn s Disease
Case 3 Perianal Fistula of Crohn s Disease A 16 year-old boy referred by surgeon due to perianal fistula since 6mo ago CC=perianal pain History of intermittent non-bloody diarrhea and mild abdominal pain
More informationTreatment Goals. Current Therapeutic Pyramids Crohn s Disease Ulcerative Colitis 11/14/10
Current Management of IBD: From Conventional Agents to Biologics Stephen B. Hanauer, M.D. University of Chicago Treatment Goals Induce and maintain response/ remission Prevent complications Improve quality
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationTitle: Author: Journal:
IMPORTANT COPYRIGHT NOTICE: This electronic article is provided to you by courtesy of Ferring Pharmaceuticals. The document is provided for personal usage only. Further reproduction and/or distribution
More informationIndications for use of Infliximab
Indications for use of Infliximab Moscow, June 10 th 2006 Prof. Dr. Dr. Gerhard Rogler Klinik und Poliklinik für Innere Medizin I Universität Regensburg Case report 1989: Diagnosis of Crohn s disease of
More informationClinical guideline Published: 10 October 2012 nice.org.uk/guidance/cg152
Crohn's disease: management Clinical guideline Published: 10 October 2012 nice.org.uk/guidance/cg152 NICE 2018. All rights reserved. Subject to Notice of rights (https://www.nice.org.uk/terms-and-conditions#notice-ofrights).
More informationThe transcription factor IFN regulatory factor 4 controls experimental colitis in mice via T cell derived IL-6
Research article The transcription factor IFN regulatory factor 4 controls experimental colitis in mice via T cell derived IL-6 Jonas Mudter, 1 Lioubov Amoussina, 1,2 Mirjam Schenk, 3 Jingling Yu, 1,2
More informationI nflammatory bowel diseases (IBD) are chronic intestinal
364 INFLAMMATORY BOWEL DISEASE Calprotectin is a stronger predictive marker of relapse in ulcerative colitis than in Crohn s disease F Costa, M G Mumolo, L Ceccarelli, M Bellini, M R Romano, C Sterpi,
More informationSignal Transduction in Inflammatory Bowel Disease
E v e n t s 0 6 4 Signal Transduction in Inflammatory Bowel Disease 0 1 2 3 4 1 0 1 0 1 0 1 0 1 0 F L 2 - H e ig h t Vineeta Khare Ph.D Overview Inflammatory Bowel Diseases 1. Epidemiology, Symptoms and
More informationLatest Treatment Updates for Ulcerative Colitis: Evolving Treatment Goals
Latest Treatment Updates for Ulcerative Colitis: Evolving Treatment Goals Stephen Hanauer, MD Professor of Medicine Medical Director, Digestive Disease Center Northwestern Medicine Chicago, Illinois Speaker
More informationBalancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
More informationAli Keshavarzian MD Rush University Medical Center
Treatment: Step Up or Top Down? Ali Keshavarzian MD Rush University Medical Center Questions What medication should IBD be treated with? Can we predict which patients with IBD are high risk? Is starting
More informationCase Report. Introduction. Case report
Case Report Endomicroscopy with Fluorescent CD105 Antibodies for In Vivo Imaging of Colorectal Cancer Angiogenesis ADRIANA CIOCÂLTEU 1, D. PIRICI 2, CLAUDIA VALENTINA GEORGESCU 3, V. ŞURLIN 4, A. SĂFTOIU
More informationDavid Y. Graham, MD Baylor College of Medicine, Houston TX, USA
Phase III Randomized, Double Blind, Placebo- Controlled, Multicenter, Parallel Group Study to Assess the Efficacy and Safety of Add-On Fixed-Dose Anti- Mycobacterial Therapy (RHB-104) in Moderately to
More informationEndoscopic monitoring of IBD patients for healing and dysplasia in 2018
Endoscopic monitoring of IBD patients for healing and dysplasia in 2018 Marietta Iacucci, MD, PhD, FASGE Senior Associate Professor(Reader) University of Birmingham, UK Adjunct Associate Professor of Medicine
More informationBeyond Anti TNFs: positioning of other biologics for Crohn s disease. Christina Ha, MD Cedars Sinai Inflammatory Bowel Disease Center
Beyond Anti TNFs: positioning of other biologics for Crohn s disease Christina Ha, MD Cedars Sinai Inflammatory Bowel Disease Center Objectives: To define high and low risk patient and disease features
More informationOp#mizing)Management)in)IBD:) Mucosal)Healing)
Op#mizing)Management)in)IBD:) Mucosal)Healing) Vipul&Jairath&MD&PhD& Associate&Professor&of&Medicine,&Epidemiology&and& Biosta=s=cs& Western&University&&& Division&of&Gastroenterology,&& London&Health&Sciences&Network&
More informationSupplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
More informationnature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
More informationExtrapolation & Pediatric Development: A case study from pediatric Ulcerative Colitis Richard Strauss, MD
Extrapolation & Pediatric Development: A case study from pediatric Ulcerative Colitis Richard Strauss, MD Immunology Clinical Development Janssen Research and Development Agenda Rationale for extrapolation
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationDownregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department
More informationSupplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
More informationPEDIATRIC INFLAMMATORY BOWEL DISEASE
PEDIATRIC INFLAMMATORY BOWEL DISEASE Alexis Rodriguez, MD Pediatric Gastroenterology Advocate Children s Hospital Disclosers Abbott Nutrition - Speaker Inflammatory Bowel Disease Chronic inflammatory disease
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSeptember 12, 2015 Millie D. Long MD, MPH, FACG
Update on Biologic Therapy in 2015 September 12, 2015 Millie D. Long MD, MPH, FACG Assistant Professor of Medicine Inflammatory Bowel Disease Center University of North Carolina-Chapel Hill Outline Crohn
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationPersonalized Medicine in IBD
Personalized Medicine in IBD Anita Afzali MD, MPH Assistant Professor of Medicine Director, Inflammatory Bowel Diseases Program University of Washington Harborview Medical Center CCFA April 2 nd, 2016
More informationModerately to severely active ulcerative colitis
Adalimumab in the Treatment of Moderate-to-Severe Ulcerative Colitis: ULTRA 2 Trial Results Sandborn WJ, van Assche G, Reinisch W, et al. Adalimumab induces and maintains clinical remission in patients
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationSupplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module
Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca
More informationAgenda. Predictive markers in IBD. Management of ulcerative colitis. Management of Crohn s disease
Agenda Predictive markers in IBD Management of ulcerative colitis Management of Crohn s disease 2 Patients With UC (%) Distribution of UC Disease Severity at Presentation 1 Fulminant disease (9%) 8 6 4
More informationSupplementary legends
Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:
More informationCrohn's Disease. The What, When, and Why of Treatment
Crohn's Disease The What, When, and Why of Treatment Brian Feagan, MD, FACG Professor of Medicine and Epidemiology and Biostatistics Director, Robarts Clinical Trials Robarts Research Institute University
More informationSUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
More informationPerianal and Fistulizing Crohn s Disease: Tough Management Decisions. Jean-Paul Achkar, M.D. Kenneth Rainin Chair for IBD Research Cleveland Clinic
Perianal and Fistulizing Crohn s Disease: Tough Management Decisions Jean-Paul Achkar, M.D. Kenneth Rainin Chair for IBD Research Cleveland Clinic Talk Overview Background Assessment and Classification
More informationSelby Inflamm Bowel Dis. 2008:14:
Medical Management of Inflammatory Bowel Disease Freddy Caldera D.O. Assistant Professor Division of Gastroenterology Objectives Discuss Crohn s disease and Ulcerative Colitis Discuss Medications for Inflammatory
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationCitation for published version (APA): Brandse, J. F. (2015). Optimizing anti-tnf therapy in inflammatory bowel disease
UvA-DARE (Digital Academic Repository) Optimizing anti-tnf therapy in inflammatory bowel disease Brandse, J.F. Link to publication Citation for published version (APA): Brandse, J. F. (2015). Optimizing
More informationAnimal models of IBD. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany
Animal models of IBD Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany Murine models of IBD 2006 1. Spontaneous Models Cotton top tamarin, C3HBir Maus, SAMP/Yit 2. Inducible
More informationIBDsmart REMIND for 6 monthly Crohn s disease activity indices for adalimumab renewal. Dr Andrew McCombie University of Otago
IBDsmart REMIND for 6 monthly Crohn s disease activity indices for adalimumab renewal Dr Andrew McCombie University of Otago Overview Background regarding adalimumab and CDAI How IBDsmart REMIND works
More informationSupplementary Material to Manuscript SREP A
Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationSerafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
More informationsfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL
sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL LTL staining Negative control Fluorescence microscopy of normal (CL-11 +/+ ) mouse renal tissue after staining with
More informationClinical Study Clinical Study of the Relation between Mucosal Healing and Long-Term Outcomes in Ulcerative Colitis
Hindawi Publishing Corporation Gastroenterology Research and Practice Volume 2013, Article ID 192794, 6 pages http://dx.doi.org/10.1155/2013/192794 Clinical Study Clinical Study of the Relation between
More informationΑπό τη θεωρία στη πράξη: Συζήτηση κλινικών περιστατικών. Κωνσταντίνος Κατσάνος Επίκουρος Καθηγητής Γαστρεντερολογίας Πανεπιστήμιο Ιωαννίνων
Από τη θεωρία στη πράξη: Συζήτηση κλινικών περιστατικών Κωνσταντίνος Κατσάνος Επίκουρος Καθηγητής Γαστρεντερολογίας Πανεπιστήμιο Ιωαννίνων Conflict of interest By means of this, the speaker confirms that
More informationA Case of Crohn s Disease with Mesalazine Allergy that was Difficult to Differentiate from Comorbid Ulcerative Colitis
doi: 10.2169/internalmedicine.1607-18 http://internmed.jp CASE REPORT A Case of Crohn s Disease with Mesalazine Allergy that was Difficult to Differentiate from Comorbid Ulcerative Colitis Rumiko Tsuboi,
More informationSupplementary materials
Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds
More informationPosition of Biologics in IBD Circa 2006: Top Down vs. Step Up Therapy
Position of Biologics in IBD Circa 2006: Top Down vs. Step Up Therapy Stephen B. Hanauer, MD University of Chicago Potential Conflicts: Centocor/Schering, Abbott, UCB, Elan, Berlex, PDL Goals of Treatment
More informationEfficacy and Safety of Treatment for Pediatric IBD
Efficacy and Safety of Treatment for Pediatric IBD Andrew B. Grossman MD Co-Director, Center for Pediatric Inflammatory Bowel Disease Assistant Professor of Clinical Pediatrics Division of Gastroenterology,
More informationSupplementary Figure 1
Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or
More informationAfrican Trypanosomes
African Trypanosomes Giemsa-stained blood smear of African trypanosomes viewed under the 100X objective lens. The block arrows denote trypomastigote forms of the African trypanosomes found within the blood
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationDr. Elmer Schabel, MD. Bundesinstitut für Arzneimittel und Medizinprodukte, Bonn, Germany (No conflicts of interest)
EMA workshop on the development of new medicinal products for the treatment of ulcerative colitis and Crohn s disease Overview of authorised medicines for IBD in Europe - previous regulatory positions
More informationAn Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease. David A. Schwartz, MD
An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease David A. Schwartz, MD Director, Inflammatory Bowel Disease Center Associate Professor of Medicine Vanderbilt University
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationPersonalized Medicine in IBD: Where Are We in 2013
Personalized Medicine in IBD: Where Are We in 2013 David A. Schwartz, MD Director, Inflammatory Bowel Disease Center Associate Professor of Medicine Vanderbilt University Medical Center What is Personalized
More informationSupplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
More informationFaecal Calprotectin. Reliable Non-Invasive Discrimination Between Inflammatory Bowel Disease (IBD) & Irritable Bowel Syndrome (IBS)
Faecal Calprotectin Reliable Non-Invasive Discrimination Between Inflammatory Bowel Disease (IBD) & Irritable Bowel Syndrome (IBS) Reliable, Non Invasive Identification of IBD vs IBS Available from Eurofins
More informationSupplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationNaltrexone for the treatment of Crohn s disease
Naltrexone for the treatment of Crohn s disease DR. NILESH CHANDE COORDINATING EDITOR, IBD REVIEW GROUP; UNIVERSITY OF WESTERN ONTARIO, LONDON, ON CANADA Opioid receptors 3 major types kappa κ delta δ
More informationSupplementary Figures for
mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,
More informationFructo-oligosaccharides in Crohn s disease: a prospective randomised double blind controlled trial
Fructo-oligosaccharides in Crohn s disease: a prospective randomised double blind controlled trial Principal investigator: Dr James Lindsay St Bartholomew's Hospital and The Royal London Hospital Queen
More informationTreating Crohn s and Colitis in the ASC
Treating Crohn s and Colitis in the ASC Kimberly M Persley, MD Texas Digestive Disease consultants TASC Meeting Outline IBD 101 Diagnosis Treatment Burden of Disease Role of ASC Inflammatory Bowel Disease
More informationPredicting response to anti - integrin therapy: long term efficacy and roles for optimisation with vedolizumab.
Predicting response to anti - integrin therapy: long term efficacy and roles for optimisation with vedolizumab. Dr Peter Irving Guy s and St Thomas Hospital, London King s College London Response to vedolizumab
More informationNature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
More information