In vivo imaging using fluorescent antibodies to TNF predicts therapeutic response in Crohn s disease

Size: px
Start display at page:

Download "In vivo imaging using fluorescent antibodies to TNF predicts therapeutic response in Crohn s disease"

Transcription

1 In vivo imaging using fluorescent antibodies to TNF predicts therapeutic response in Crohn s disease Raja Atreya, Helmut Neumann, Clemens Neufert, Maximilian J. Waldner, Ulrike Billmeier, Yurdagül Zopf, Marcus Willma, Christine App, Tino Münster, Hermann Kessler, Stefanie Maas, Bernd Gebhardt, Ralph Heimke-Brinck, Eva Reuter, Frank Dörje, Tilman T. Rau, Wolfgang Uter, Thomas D. Wang, Ralf Kiesslich, Michael Vieth, Ewald Hannappel & Markus F. Neurath Supplementary Figure 1 Supplementary Figure 1 Analysis of fluorescent adalimumab (a) SDS-PAGE gel electrophoresis of fluorescein isothiocyanate-adalimumab, which was labeled with a 14-fold excess of fluorescein isothiocyanate (HF1) and adalimumab (H) and fluorescein isothiocyanate-adalimumab after removing the excess fluorescent dye with a dye removal column according to the study protocol (HF2). The left panel depicts the fluorescence when the gel was exposed to UV light. The right panel shows the gel after Coomassie staining. All lanes contained 1 µg of the protein. (b) Hypothetical model of fluorescent adalimumab based on the above analysis. 1

2 Supplementary Figure 2 Supplementary Figure 2 In vivo staining with labeled adalimumab. (a) In vivo molecular imaging with fluorescent adalimumab led to the identification of mtnfexpressing mucosal immune cells. Scale bar represents 25 µm. (b) The same confocal image was contrast-enhanced by Fiji imaging technique to augment the contrast between mtnf-positive mucosal cells and the background. Scale bar represents 25 µm. (c) Autofluorescence background of the mucosa in a patient with Crohn s disease before staining was performed with fluorescent adalimumab. Scale bar represents 25 µm. (d) Receiver operator characteristics (ROC) analysis of the mean number of in vivo mtnf expressing cells patient -1 during the molecular imaging procedure. The ROC analysis identified values of , rounded to 20, as an optimum cut-point (arrow) to differentiate between patients in the high and low mtnf groups, with a sensitivity of 84.6% and a specificity of 91.7% for the prediction of response to adalimumab therapy. 2

3 Supplementary Figure 3 Supplementary Figure 3 Ex vivo staining of histological gut sections from the mucosal area adjacent to the site where molecular imaging was performed using fluorescent adalimumab. (a b) Patients with low and high numbers of mtnf expressing mucosal immune cells could be differentiated by ex vivo staining. Scale bar represents 25 µm. (c) Quantitative analysis demonstrated that patients with Crohn s disease and clinical response to adalimumab therapy after 12 weeks had a significantly higher number of mtnf expressing immune cells than patients lacking clinical response to adalimumab therapy. Data represent mean values ±s.e.m.; *P = 0.02 (t-test; two-sided). (d) Representative immunofluorescence staining for mtnf with FITC labeled adalimumab (green) and antibodies against CD4 or CD14 (all red) in gut cryosections from patients with Crohn s disease. Nuclei were counterstained with DAPI (blue). Double positive cells are shown in yellow (enlarged image). Representative images of one out of 11 patients are shown. Scale bars represent 10 µm. (e) Higher percentage of mtnf positive cells among intestinal CD14+ macrophages compared to CD4+ T-cells in patients with Crohn s disease (n = 11). Data represent mean values ±s.e.m.; ***P = (ttest; two-sided). 3

4 Supplementary Figure 4 * * Supplementary Figure 4 Clinical findings upon adalimumab therapy. (a) Clinical outcome analysis showed that patients with a higher number of mtnf positive intestinal cells had a statistically significant reduction of their CDAI levels after 4 and 12 weeks of adalimumab treatment in comparison to the baseline CDAI before initiation of adalimumab therapy. Patients were subsequently followed over a period of 52 weeks. In the follow up of the patients with high mtnf expression it could be shown that this group has a sustained significant reduction of the CDAI score even one year after the initiation of the adalimumab treatment. In contrast, patients with low numbers of mtnf positive cells did not show any significant reduction in CDAI scores. Data represent mean values ±s.e.m.; *P = 0.04; **P = ***P = (t-test; two-sided). (b) Patients with high numbers of mtnf expressing cells had a statistically significant reduction of their corticosteroid use after 4 and 12 weeks of adalimumab treatment in comparison to patients with low numbers of mtnf expressing cells. Data represent mean values ±s.e.m.; *P = 0.04 (t-test; two-sided). 4

5 Supplementary Figure 5 Supplementary Figure 5 Ulcerations and mucosal healing rate during follow-up endoscopy in the high mtnf group. Endoscopic analysis at the beginning of the study showed that 100% of the patients in the low and high mtnf groups had mucosal ulcerations prior to the induction of the treatment with the antibody to TNF adalimumab. In 11 out of 12 patients with high mtnf expression, a follow up white light endoscopic examination could be performed at a mean of 17 months (range months) after initiation of adalimumab therapy. 27% of these patients still had mucosal ulcerations during the follow-up indicating that 73% of the patients with high mtnf expression had mucosal healing. Mucosal healing was defined as the absence of mucosal ulcerations during the follow-up endoscopy. 5

6 Supplementary Table 1 Clinical characteristics of responders and nonresponders Characteristic Responder Nonresponder P value Female, n (%) 5 (38.5) 4 (33.3) 1 Age in years, mean (s.d.) 43.5 (17.3) 39.3 (11.3) 0.57 Body weight at V1 in kilograms, mean (s.d.) Disease duration in years, mean (s.d.) Involved intestinal area, n (%): Colonic Ileal Gastroduodenal 75.5 (10.3) 72.4 (13.4) (10.2) 11.3 (5.8) (53.8) 8 (61.5) 3 (23.1) 8 (66.7) 9 (75) 1 (7.7) Previous anti-tnf exposure, n (%) 1 (7.7) 1 (8.3) 1 Concomitant medication, n (%): Aminosalicylates Corticosteroids Azathioprine Antibiotics 6 (46.2) 6 (46.2) 5 (38.5) 0 (0) 1 (8.3) 7 (58.3) 4 (33.3) 1 (8.3) Current smoker, n (%) 4 (30.8) 0 (0) 0.10 CRP at V3, mean ( s.d.) 8.8 (16.9) 18.1 (22.3) 0.19 Stenosis, n (%) 4 (30.8) 8 (66.7) 0.16 Comparison of patient characteristics between responders and nonresponders to adalimumab therapy. Results of statistical tests yielded no evidence of significant differences between the two groups. V1, visit 1; V3, visit 3.

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson

More information

Mucosal healing: does it really matter?

Mucosal healing: does it really matter? Oxford Inflammatory Bowel Disease MasterClass Mucosal healing: does it really matter? Professor Jean-Frédéric Colombel, New York, USA Oxford Inflammatory Bowel Disease MasterClass Mucosal healing: does

More information

Chromoendoscopy and Endomicroscopy for detecting colonic dysplasia

Chromoendoscopy and Endomicroscopy for detecting colonic dysplasia Chromoendoscopy and Endomicroscopy for detecting colonic dysplasia Ralf Kiesslich I. Medical Department Johannes Gutenberg University Mainz, Germany Cumulative cancer risk in ulcerative colitis 0.5-1.0%

More information

Mucosal Healing in Crohn s Disease. Geert D Haens MD, PhD University Hospital Gasthuisberg University of Leuven Leuven, Belgium

Mucosal Healing in Crohn s Disease. Geert D Haens MD, PhD University Hospital Gasthuisberg University of Leuven Leuven, Belgium Mucosal Healing in Crohn s Disease Geert D Haens MD, PhD University Hospital Gasthuisberg University of Leuven Leuven, Belgium Mucosal Lesions in CD: General Features CD can affect the entire GI tract

More information

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent

Supplementary Information. Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Supplementary Information Detection and delineation of oral cancer with a PARP1 targeted optical imaging agent Authors: Susanne Kossatz a, Christian Brand a, Stanley Gutiontov b, Jonathan T.C. Liu c, Nancy

More information

There are several severe disorders that may affect the. Imaging and Advanced Technology

There are several severe disorders that may affect the. Imaging and Advanced Technology Imaging and Advanced Technology Ralf Kiesslich and Pankaj Jay Pasricha, Section Editors Assessment of Tumor Development and Wound Healing Using Endoscopic Techniques in Mice MARKUS F. NEURATH,* NADINE

More information

Definitions. Clinical remission: Resolution of symptoms (stool frequency 3/day, no bleeding and no urgency)

Definitions. Clinical remission: Resolution of symptoms (stool frequency 3/day, no bleeding and no urgency) CROHN S DISEASE Definitions Clinical remission: Resolution of symptoms (stool frequency 3/day, no bleeding and no urgency) Recurrence: The reappearance of lesions after surgical resection Endoscopic remission:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

Crohn s Disease: A New Approach to an Old Problem

Crohn s Disease: A New Approach to an Old Problem Management of Postoperative Crohn s Disease: A New Approach to an Old Problem Miguel Regueiro, M.D. Associate Professor of Medicine Associate Chief for Education Clinical Head and Co-Director, IBD Center

More information

Confocal Laser Endomicroscopy of the Colon

Confocal Laser Endomicroscopy of the Colon clinical imaging Confocal Laser Endomicroscopy of the Colon Dan Ionut Gheonea, Adrian Saftoiu, Tudorel Ciurea, Carmen Popescu, Claudia Valentina Georgescu, Anca Malos Research Center of Gastroenterology

More information

IL-12 family members in experimental colitis. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany

IL-12 family members in experimental colitis. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany IL-12 family members in experimental colitis Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany IBD - Pathogenesis Genetic Predisposition Bacterial Antigens Activation of

More information

Anne Griffiths MD, FRCPC. SickKids Hospital, University of Toronto. Buenos Aires, August 16, 2014

Anne Griffiths MD, FRCPC. SickKids Hospital, University of Toronto. Buenos Aires, August 16, 2014 Management and Medical Therapies for Crohn disease: strategies to enhance mucosal healing Anne Griffiths MD, FRCPC SickKids Hospital, University of Toronto Buenos Aires, August 16, 2014 New onset Crohn

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Disclosures. What Do I Do When Anti-TNF Therapy Is Not Working Anymore? Fadi Hamid, M.D. Saint Luke s GI Specialists

Disclosures. What Do I Do When Anti-TNF Therapy Is Not Working Anymore? Fadi Hamid, M.D. Saint Luke s GI Specialists What Do I Do When Anti-TNF Therapy Is Not Working Anymore? Fadi Hamid, M.D. Saint Luke s GI Specialists Disclosures No financial relationships to disclose. 1 Learning Objectives Case 24M with ileocolonic

More information

INFLIXIMAB FOR PREVENTION OF POST-OPERATIVE CROHN S DISEASE RECURRENCE: THE PREVENT TRIAL

INFLIXIMAB FOR PREVENTION OF POST-OPERATIVE CROHN S DISEASE RECURRENCE: THE PREVENT TRIAL INFLIXIMAB FOR PREVENTION OF POST-OPERATIVE CROHN S DISEASE RECURRENCE: THE PREVENT TRIAL A. Hillary Steinhart, MD MSc FRCP(C) Medical Lead, Mount Sinai Hospital IBD Centre Professor of Medicine University

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 3 October 2012

The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION. 3 October 2012 The legally binding text is the original French version TRANSPARENCY COMMITTEE OPINION 3 October 2012 REMICADE 100 mg, powder for concentrate for solution for infusion B/1 vial (CIP code: 562 070-1) Applicant:

More information

HDF Case Whipple s disease

HDF Case Whipple s disease HDF Case 952556 Whipple s disease 63 yo female complaining of a diarrhea for 2 months, weigth loss (12 Kg in 3 months), and joint pains. Duodenal biopsy performed. Scanning view, enlarged intestinal villi,

More information

Originalarbeiten: Tino Münster Muenster T Tino Muenster Tino Münster Muenster Tino Münster Tino Münster Tino Münster

Originalarbeiten: Tino Münster Muenster T Tino Muenster Tino Münster Muenster Tino Münster Tino Münster Tino Münster Originalarbeiten: Heike Schmitt, Ulrike Billmeier, Walburga Dieterich, Timo Rath, Sophia Sonnewald, Stephen Reid, Simon Hirschmann, Kai Hildner, Maximilian J Waldner, Jonas Mudter, Arndt Hartmann, Robert

More information

Confocal laser endomicroscopy for the differential diagnosis of ulcerative colitis and Crohn s disease: a pilot study

Confocal laser endomicroscopy for the differential diagnosis of ulcerative colitis and Crohn s disease: a pilot study Confocal laser endomicroscopy for the differential diagnosis of ulcerative colitis and Crohn s disease: a pilot study Authors Gian Eugenio Tontini 1, 2, Jonas Mudter 1, Michael Vieth 3, Raja Atreya 1,

More information

Trough level of infliximab is useful for assessing mucosal healing in Crohn s disease: a prospective cohort study

Trough level of infliximab is useful for assessing mucosal healing in Crohn s disease: a prospective cohort study ORIGINAL ARTICLE pissn 1598-91 eissn 2288-1956 https://doi.org/1.5217/ir.218.16.2.223 Intest Res 218;16(2):223-232 Trough level of infliximab is useful for assessing mucosal healing in Crohn s disease:

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

Anti-TNF antibodies do not induce the apoptosis of lamina propria mononuclear cells in uninflamed intestinal tissue in patients with Crohn s disease

Anti-TNF antibodies do not induce the apoptosis of lamina propria mononuclear cells in uninflamed intestinal tissue in patients with Crohn s disease FOLIA HISTOCHEMICA ET CYTOBIOLOGICA Vol. 51, No. 3, 2013 pp. 239 243 ORIGINAL STUDY Anti-TNF antibodies do not induce the apoptosis of lamina propria mononuclear cells in uninflamed intestinal tissue in

More information

Prevention and Management of Postoperative Crohn s disease

Prevention and Management of Postoperative Crohn s disease Prevention and Management of Postoperative Crohn s disease Miguel Regueiro, M.D. Associate Professor of Medicine Associate Chief for Education Clinical Head and Co-Director, IBD Center Director, Gastroenterology,

More information

Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus)

Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal. Glucose Transport in Goldfish (Carassius auratus) Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus) Ayelén Melisa Blanco 1,2, Juan Ignacio Bertucci 2,3, Naresh Ramesh 2, María Jesús Delgado

More information

2.0 Synopsis. Adalimumab M Clinical Study Report Final R&D/15/1054. (For National Authority Use Only)

2.0 Synopsis. Adalimumab M Clinical Study Report Final R&D/15/1054. (For National Authority Use Only) 2.0 Synopsis AbbVie Inc. Name of Study Drug: Adalimumab Name of Active Ingredient: Adalimumab Individual Study Table Referring to Part of Dossier: Volume: Page: (For National Authority Use Only) Title

More information

Biologic Therapy for Inflammatory. Is Top-Down Too Top-Heavy? S. Devi Rampertab, MD, FACG, AGAF Associate Professor of Medicine University of Florida

Biologic Therapy for Inflammatory. Is Top-Down Too Top-Heavy? S. Devi Rampertab, MD, FACG, AGAF Associate Professor of Medicine University of Florida Biologic Therapy for Inflammatory Bowel Disease: Is Top-Down Too Top-Heavy? S. Devi Rampertab, MD, FACG, AGAF Associate Professor of Medicine University of Florida Learning Objectives Evaluate evidence

More information

Perianal Fistula of Crohn s Disease

Perianal Fistula of Crohn s Disease Case 3 Perianal Fistula of Crohn s Disease A 16 year-old boy referred by surgeon due to perianal fistula since 6mo ago CC=perianal pain History of intermittent non-bloody diarrhea and mild abdominal pain

More information

Treatment Goals. Current Therapeutic Pyramids Crohn s Disease Ulcerative Colitis 11/14/10

Treatment Goals. Current Therapeutic Pyramids Crohn s Disease Ulcerative Colitis 11/14/10 Current Management of IBD: From Conventional Agents to Biologics Stephen B. Hanauer, M.D. University of Chicago Treatment Goals Induce and maintain response/ remission Prevent complications Improve quality

More information

Supplementary Table 1

Supplementary Table 1 Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,

More information

Title: Author: Journal:

Title: Author: Journal: IMPORTANT COPYRIGHT NOTICE: This electronic article is provided to you by courtesy of Ferring Pharmaceuticals. The document is provided for personal usage only. Further reproduction and/or distribution

More information

Indications for use of Infliximab

Indications for use of Infliximab Indications for use of Infliximab Moscow, June 10 th 2006 Prof. Dr. Dr. Gerhard Rogler Klinik und Poliklinik für Innere Medizin I Universität Regensburg Case report 1989: Diagnosis of Crohn s disease of

More information

Clinical guideline Published: 10 October 2012 nice.org.uk/guidance/cg152

Clinical guideline Published: 10 October 2012 nice.org.uk/guidance/cg152 Crohn's disease: management Clinical guideline Published: 10 October 2012 nice.org.uk/guidance/cg152 NICE 2018. All rights reserved. Subject to Notice of rights (https://www.nice.org.uk/terms-and-conditions#notice-ofrights).

More information

The transcription factor IFN regulatory factor 4 controls experimental colitis in mice via T cell derived IL-6

The transcription factor IFN regulatory factor 4 controls experimental colitis in mice via T cell derived IL-6 Research article The transcription factor IFN regulatory factor 4 controls experimental colitis in mice via T cell derived IL-6 Jonas Mudter, 1 Lioubov Amoussina, 1,2 Mirjam Schenk, 3 Jingling Yu, 1,2

More information

I nflammatory bowel diseases (IBD) are chronic intestinal

I nflammatory bowel diseases (IBD) are chronic intestinal 364 INFLAMMATORY BOWEL DISEASE Calprotectin is a stronger predictive marker of relapse in ulcerative colitis than in Crohn s disease F Costa, M G Mumolo, L Ceccarelli, M Bellini, M R Romano, C Sterpi,

More information

Signal Transduction in Inflammatory Bowel Disease

Signal Transduction in Inflammatory Bowel Disease E v e n t s 0 6 4 Signal Transduction in Inflammatory Bowel Disease 0 1 2 3 4 1 0 1 0 1 0 1 0 1 0 F L 2 - H e ig h t Vineeta Khare Ph.D Overview Inflammatory Bowel Diseases 1. Epidemiology, Symptoms and

More information

Latest Treatment Updates for Ulcerative Colitis: Evolving Treatment Goals

Latest Treatment Updates for Ulcerative Colitis: Evolving Treatment Goals Latest Treatment Updates for Ulcerative Colitis: Evolving Treatment Goals Stephen Hanauer, MD Professor of Medicine Medical Director, Digestive Disease Center Northwestern Medicine Chicago, Illinois Speaker

More information

Balancing intestinal and systemic inflammation through cell type-specific expression of

Balancing intestinal and systemic inflammation through cell type-specific expression of Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia

More information

Ali Keshavarzian MD Rush University Medical Center

Ali Keshavarzian MD Rush University Medical Center Treatment: Step Up or Top Down? Ali Keshavarzian MD Rush University Medical Center Questions What medication should IBD be treated with? Can we predict which patients with IBD are high risk? Is starting

More information

Case Report. Introduction. Case report

Case Report. Introduction. Case report Case Report Endomicroscopy with Fluorescent CD105 Antibodies for In Vivo Imaging of Colorectal Cancer Angiogenesis ADRIANA CIOCÂLTEU 1, D. PIRICI 2, CLAUDIA VALENTINA GEORGESCU 3, V. ŞURLIN 4, A. SĂFTOIU

More information

David Y. Graham, MD Baylor College of Medicine, Houston TX, USA

David Y. Graham, MD Baylor College of Medicine, Houston TX, USA Phase III Randomized, Double Blind, Placebo- Controlled, Multicenter, Parallel Group Study to Assess the Efficacy and Safety of Add-On Fixed-Dose Anti- Mycobacterial Therapy (RHB-104) in Moderately to

More information

Endoscopic monitoring of IBD patients for healing and dysplasia in 2018

Endoscopic monitoring of IBD patients for healing and dysplasia in 2018 Endoscopic monitoring of IBD patients for healing and dysplasia in 2018 Marietta Iacucci, MD, PhD, FASGE Senior Associate Professor(Reader) University of Birmingham, UK Adjunct Associate Professor of Medicine

More information

Beyond Anti TNFs: positioning of other biologics for Crohn s disease. Christina Ha, MD Cedars Sinai Inflammatory Bowel Disease Center

Beyond Anti TNFs: positioning of other biologics for Crohn s disease. Christina Ha, MD Cedars Sinai Inflammatory Bowel Disease Center Beyond Anti TNFs: positioning of other biologics for Crohn s disease Christina Ha, MD Cedars Sinai Inflammatory Bowel Disease Center Objectives: To define high and low risk patient and disease features

More information

Op#mizing)Management)in)IBD:) Mucosal)Healing)

Op#mizing)Management)in)IBD:) Mucosal)Healing) Op#mizing)Management)in)IBD:) Mucosal)Healing) Vipul&Jairath&MD&PhD& Associate&Professor&of&Medicine,&Epidemiology&and& Biosta=s=cs& Western&University&&& Division&of&Gastroenterology,&& London&Health&Sciences&Network&

More information

Supplementary Information

Supplementary Information Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility

More information

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary

More information

Extrapolation & Pediatric Development: A case study from pediatric Ulcerative Colitis Richard Strauss, MD

Extrapolation & Pediatric Development: A case study from pediatric Ulcerative Colitis Richard Strauss, MD Extrapolation & Pediatric Development: A case study from pediatric Ulcerative Colitis Richard Strauss, MD Immunology Clinical Development Janssen Research and Development Agenda Rationale for extrapolation

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

PEDIATRIC INFLAMMATORY BOWEL DISEASE

PEDIATRIC INFLAMMATORY BOWEL DISEASE PEDIATRIC INFLAMMATORY BOWEL DISEASE Alexis Rodriguez, MD Pediatric Gastroenterology Advocate Children s Hospital Disclosers Abbott Nutrition - Speaker Inflammatory Bowel Disease Chronic inflammatory disease

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

September 12, 2015 Millie D. Long MD, MPH, FACG

September 12, 2015 Millie D. Long MD, MPH, FACG Update on Biologic Therapy in 2015 September 12, 2015 Millie D. Long MD, MPH, FACG Assistant Professor of Medicine Inflammatory Bowel Disease Center University of North Carolina-Chapel Hill Outline Crohn

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over

More information

Personalized Medicine in IBD

Personalized Medicine in IBD Personalized Medicine in IBD Anita Afzali MD, MPH Assistant Professor of Medicine Director, Inflammatory Bowel Diseases Program University of Washington Harborview Medical Center CCFA April 2 nd, 2016

More information

Moderately to severely active ulcerative colitis

Moderately to severely active ulcerative colitis Adalimumab in the Treatment of Moderate-to-Severe Ulcerative Colitis: ULTRA 2 Trial Results Sandborn WJ, van Assche G, Reinisch W, et al. Adalimumab induces and maintains clinical remission in patients

More information

islets scored 1 week month months

islets scored 1 week month months Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic

More information

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module

Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca

More information

Agenda. Predictive markers in IBD. Management of ulcerative colitis. Management of Crohn s disease

Agenda. Predictive markers in IBD. Management of ulcerative colitis. Management of Crohn s disease Agenda Predictive markers in IBD Management of ulcerative colitis Management of Crohn s disease 2 Patients With UC (%) Distribution of UC Disease Severity at Presentation 1 Fulminant disease (9%) 8 6 4

More information

Supplementary legends

Supplementary legends Supplementary legends Supplemental figure S1. Apelin-TAMRA is functional and induces apelin receptor internalization. HEK-293T cells transiently expressing YFP tagged APJ were incubated for 1 hour with:

More information

Crohn's Disease. The What, When, and Why of Treatment

Crohn's Disease. The What, When, and Why of Treatment Crohn's Disease The What, When, and Why of Treatment Brian Feagan, MD, FACG Professor of Medicine and Epidemiology and Biostatistics Director, Robarts Clinical Trials Robarts Research Institute University

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

More information

Perianal and Fistulizing Crohn s Disease: Tough Management Decisions. Jean-Paul Achkar, M.D. Kenneth Rainin Chair for IBD Research Cleveland Clinic

Perianal and Fistulizing Crohn s Disease: Tough Management Decisions. Jean-Paul Achkar, M.D. Kenneth Rainin Chair for IBD Research Cleveland Clinic Perianal and Fistulizing Crohn s Disease: Tough Management Decisions Jean-Paul Achkar, M.D. Kenneth Rainin Chair for IBD Research Cleveland Clinic Talk Overview Background Assessment and Classification

More information

Selby Inflamm Bowel Dis. 2008:14:

Selby Inflamm Bowel Dis. 2008:14: Medical Management of Inflammatory Bowel Disease Freddy Caldera D.O. Assistant Professor Division of Gastroenterology Objectives Discuss Crohn s disease and Ulcerative Colitis Discuss Medications for Inflammatory

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis

More information

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Citation for published version (APA): Brandse, J. F. (2015). Optimizing anti-tnf therapy in inflammatory bowel disease

Citation for published version (APA): Brandse, J. F. (2015). Optimizing anti-tnf therapy in inflammatory bowel disease UvA-DARE (Digital Academic Repository) Optimizing anti-tnf therapy in inflammatory bowel disease Brandse, J.F. Link to publication Citation for published version (APA): Brandse, J. F. (2015). Optimizing

More information

Animal models of IBD. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany

Animal models of IBD. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany Animal models of IBD Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany Murine models of IBD 2006 1. Spontaneous Models Cotton top tamarin, C3HBir Maus, SAMP/Yit 2. Inducible

More information

IBDsmart REMIND for 6 monthly Crohn s disease activity indices for adalimumab renewal. Dr Andrew McCombie University of Otago

IBDsmart REMIND for 6 monthly Crohn s disease activity indices for adalimumab renewal. Dr Andrew McCombie University of Otago IBDsmart REMIND for 6 monthly Crohn s disease activity indices for adalimumab renewal Dr Andrew McCombie University of Otago Overview Background regarding adalimumab and CDAI How IBDsmart REMIND works

More information

Supplementary Material to Manuscript SREP A

Supplementary Material to Manuscript SREP A Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL

sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL LTL staining Negative control Fluorescence microscopy of normal (CL-11 +/+ ) mouse renal tissue after staining with

More information

Clinical Study Clinical Study of the Relation between Mucosal Healing and Long-Term Outcomes in Ulcerative Colitis

Clinical Study Clinical Study of the Relation between Mucosal Healing and Long-Term Outcomes in Ulcerative Colitis Hindawi Publishing Corporation Gastroenterology Research and Practice Volume 2013, Article ID 192794, 6 pages http://dx.doi.org/10.1155/2013/192794 Clinical Study Clinical Study of the Relation between

More information

Από τη θεωρία στη πράξη: Συζήτηση κλινικών περιστατικών. Κωνσταντίνος Κατσάνος Επίκουρος Καθηγητής Γαστρεντερολογίας Πανεπιστήμιο Ιωαννίνων

Από τη θεωρία στη πράξη: Συζήτηση κλινικών περιστατικών. Κωνσταντίνος Κατσάνος Επίκουρος Καθηγητής Γαστρεντερολογίας Πανεπιστήμιο Ιωαννίνων Από τη θεωρία στη πράξη: Συζήτηση κλινικών περιστατικών Κωνσταντίνος Κατσάνος Επίκουρος Καθηγητής Γαστρεντερολογίας Πανεπιστήμιο Ιωαννίνων Conflict of interest By means of this, the speaker confirms that

More information

A Case of Crohn s Disease with Mesalazine Allergy that was Difficult to Differentiate from Comorbid Ulcerative Colitis

A Case of Crohn s Disease with Mesalazine Allergy that was Difficult to Differentiate from Comorbid Ulcerative Colitis doi: 10.2169/internalmedicine.1607-18 http://internmed.jp CASE REPORT A Case of Crohn s Disease with Mesalazine Allergy that was Difficult to Differentiate from Comorbid Ulcerative Colitis Rumiko Tsuboi,

More information

Supplementary materials

Supplementary materials Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds

More information

Position of Biologics in IBD Circa 2006: Top Down vs. Step Up Therapy

Position of Biologics in IBD Circa 2006: Top Down vs. Step Up Therapy Position of Biologics in IBD Circa 2006: Top Down vs. Step Up Therapy Stephen B. Hanauer, MD University of Chicago Potential Conflicts: Centocor/Schering, Abbott, UCB, Elan, Berlex, PDL Goals of Treatment

More information

Efficacy and Safety of Treatment for Pediatric IBD

Efficacy and Safety of Treatment for Pediatric IBD Efficacy and Safety of Treatment for Pediatric IBD Andrew B. Grossman MD Co-Director, Center for Pediatric Inflammatory Bowel Disease Assistant Professor of Clinical Pediatrics Division of Gastroenterology,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or

More information

African Trypanosomes

African Trypanosomes African Trypanosomes Giemsa-stained blood smear of African trypanosomes viewed under the 100X objective lens. The block arrows denote trypomastigote forms of the African trypanosomes found within the blood

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Dr. Elmer Schabel, MD. Bundesinstitut für Arzneimittel und Medizinprodukte, Bonn, Germany (No conflicts of interest)

Dr. Elmer Schabel, MD. Bundesinstitut für Arzneimittel und Medizinprodukte, Bonn, Germany (No conflicts of interest) EMA workshop on the development of new medicinal products for the treatment of ulcerative colitis and Crohn s disease Overview of authorised medicines for IBD in Europe - previous regulatory positions

More information

An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease. David A. Schwartz, MD

An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease. David A. Schwartz, MD An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease David A. Schwartz, MD Director, Inflammatory Bowel Disease Center Associate Professor of Medicine Vanderbilt University

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Personalized Medicine in IBD: Where Are We in 2013

Personalized Medicine in IBD: Where Are We in 2013 Personalized Medicine in IBD: Where Are We in 2013 David A. Schwartz, MD Director, Inflammatory Bowel Disease Center Associate Professor of Medicine Vanderbilt University Medical Center What is Personalized

More information

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of

Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI

More information

Faecal Calprotectin. Reliable Non-Invasive Discrimination Between Inflammatory Bowel Disease (IBD) & Irritable Bowel Syndrome (IBS)

Faecal Calprotectin. Reliable Non-Invasive Discrimination Between Inflammatory Bowel Disease (IBD) & Irritable Bowel Syndrome (IBS) Faecal Calprotectin Reliable Non-Invasive Discrimination Between Inflammatory Bowel Disease (IBD) & Irritable Bowel Syndrome (IBS) Reliable, Non Invasive Identification of IBD vs IBS Available from Eurofins

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

Naltrexone for the treatment of Crohn s disease

Naltrexone for the treatment of Crohn s disease Naltrexone for the treatment of Crohn s disease DR. NILESH CHANDE COORDINATING EDITOR, IBD REVIEW GROUP; UNIVERSITY OF WESTERN ONTARIO, LONDON, ON CANADA Opioid receptors 3 major types kappa κ delta δ

More information

Supplementary Figures for

Supplementary Figures for mirns regulate s Supplementary igures for MicroRNs Reprogram Normal ibroblasts into Cancer ssociated ibroblasts in Ovarian Cancer nirban K. Mitra, Marion Zillhardt, Youjia Hua, Payal iwari, ndrea E. Murmann,

More information

Fructo-oligosaccharides in Crohn s disease: a prospective randomised double blind controlled trial

Fructo-oligosaccharides in Crohn s disease: a prospective randomised double blind controlled trial Fructo-oligosaccharides in Crohn s disease: a prospective randomised double blind controlled trial Principal investigator: Dr James Lindsay St Bartholomew's Hospital and The Royal London Hospital Queen

More information

Treating Crohn s and Colitis in the ASC

Treating Crohn s and Colitis in the ASC Treating Crohn s and Colitis in the ASC Kimberly M Persley, MD Texas Digestive Disease consultants TASC Meeting Outline IBD 101 Diagnosis Treatment Burden of Disease Role of ASC Inflammatory Bowel Disease

More information

Predicting response to anti - integrin therapy: long term efficacy and roles for optimisation with vedolizumab.

Predicting response to anti - integrin therapy: long term efficacy and roles for optimisation with vedolizumab. Predicting response to anti - integrin therapy: long term efficacy and roles for optimisation with vedolizumab. Dr Peter Irving Guy s and St Thomas Hospital, London King s College London Response to vedolizumab

More information

Nature Methods: doi: /nmeth.4257

Nature Methods: doi: /nmeth.4257 Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.

More information