Supplementary Materials for
|
|
|
- Kathleen Gilmore
- 5 years ago
- Views:
Transcription
1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis Nathan Beckouche, Marine Bignon, Virginie Lelarge, Thomas Mathivet, Cathy Pichol-Thievend, Sarah Berndt, Julie Hardouin, Marion Garand, Corinne Ardidie-Robouant, Alain Barret, Gerry Melino, Hugues Lortat-Jacob, Laurent Muller, Catherine Monnot,* Stephane Germain The PDF file includes: *Corresponding author. Published 14 July 2015, Sci. Signal. 8, ra70 (2015) DOI: /scisignal.aaa0963 Fig. S1. Analysis of retinas and aortas from tg2 +/+ and tg2 / mice. Fig. S2. TG2 accumulation in ECM and TG2 silencing in endothelial cells. Fig. S3. Proliferation, β 1 integrin mediated sprouting, and fibronectin abundance and deposition in TG2-silenced endothelial cells. Fig. S4. VEGFR2 internalization in response to VEGF 165. Fig. S5. TG2 silencing does not affect VEGF 121 -induced signaling. Fig. S6. HS content and deposition. Fig. S7. Reexpression of wild-type and mutant TG2 in TG2-silenced endothelial cells.
2 Fig. S1. Analysis of retinas and aortas from tg2 +/+ and tg2 -/- mice. (A) Confocal images of retina stained with isolectin-b4 from P7 mice. The confocal images are representative of 22 tg2 +/+ - and 20 tg2 -/- -retinas analyzed in 3 independent experiments. Vascular area was quantified for tg2 +/+ or tg2 -/-. Graphs represent the mean values ± SD (N=3 independent experiments, 20 to 22 retinas analyzed, Mann-Whitney U test). NS: no significant difference. (B) TG2 expression in mouse aorta. TG2 was detected by immunofluorescence in aortic sections of 9-weeks tg2 +/+ and tg2 -/- littermates. Elastic fibers were detected by autofluorescence (A: Adventitia; M: Media; E: Endothelium). The images are representative of 3 slices obtained from 2 tg2 +/+ - or tg2 -/- -aortas. Scale bar, 25 µm. 1
3 Fig. S2. TG2 accumulation in ECM and TG2 silencing in endothelial cells. (A) TG2 accumulation in ECM generated by HUVECs that were co-cultured with NHDFs. The confocal images are representative of 6 images obtained from 2 independent experiments. TG2 deposition in the ECM was analyzed by immunofluorescence of cells co-cultured without (-) or with (+) NHDFs for 3 days. Arrows indicate extracellular TG2 in the ECM. Nuclei were stained with DAPI. Scale bar, 20 µm. (B) TG2 abundance in control (shct) or TG2-silenced (shtg2) HUVECs. TG2 silencing was analyzed by immunofluorescence (upper) and immunoblot (lower) of cell lysate of cells grown for 5 days. Actin was used as a loading control. The confocal images and immunoblots are representative of 20 or more technical replicates obtained from 10 or more independent experiments. Scale bar, 20 µm. 2
4 Fig. S3. Proliferation, 1 integrin-mediated sprouting, and fibronectin abundance and deposition in TG2-silenced endothelial cells. (A) Number of nuclei was quantified in sprouts from HUVECs in fibrin gels containing increasing concentrations of VEGF 165 and calculated as percentage of values from 5 ng/ml VEGF 165. Graph represents the mean of values ± SEM (N=2 independent experiments, 24 to 48 sprouts analyzed, Mann-Whitney U test). (B) 1 integrindependent sprouting. Control (shct) or TG2-silenced (shtg2) HUVECs seeded on Cytodex beads were cultured with either 10 µg/ml control IgM (Control IgM) or 10 µg/ml 1 integrin blocking antibody (Beta1 blocking Ab). Mean of total length of sprouts per bead was normalized 3
5 to the mean of shct treated with control IgM. Graph represents the mean of normalized values ± SEM. The fold values (x2 and x2.1) represent the ratio between control IgM and 1 blocking Ab conditions for shct and shtg2, respectively (N=4 independent experiments, 71 to 97 sprouts analysed, Mann-Whitney U test). (C) Fibronectin protein was detected by immunoblot in total lysates of shct and shtg2 HUVECs cultured for 4 days (top panel). Actin was used as a control (bottom panel). Immunoblot was representative of 3 independent experiments. Relative amount is the ratio of fibronectin on actin normalized to the maximal ratio. Graphs represent the mean of values ± SEM (N=3 independent experiments, Mann-Whitney U test). NS: no significant difference. (D) Fibronectin deposition was analyzed by immunofluorescence on cells cultured in 2D. Nuclei were stained with DAPI. The confocal images are representative of 4 technical replicates obtained from 5 independent experiments. Scale bar, 20 µm. (E) Fibronectin deposition was analyzed by immunofluorescence performed on aortic ring sprouts from tg2 +/+ and tg2 -/- mice. Endothelial cells were stained with isolectin-b4. The images are representative of 2 to 4 technical replicates obtained from 5 tg2 +/+ - or tg2 -/- -rings. Scale bar, 100 µm. 4
6 Fig. S4. VEGFR2 internalization in response to VEGF 165. Confocal images showing colocalization of VEGFR2 (green) and EEA1 (red) in endosomes in control (shct) and TG2- silenced (shtg2) HUVECs after 5 minutes stimulation with 50 ng/ml VEGF 165 (N=3 independent experiments, 141 to 164 cells analyzed, Student s t-test).). NS: no significant difference. Scale bar, 20 µm. 5
7 Fig. S5. TG2 silencing does not affect VEGF 121 -induced signaling. Relative phosphorylation is the ratio of phosphorylated to total protein. Ratios were normalized by calculating them as percentages of the maximal ratio. Graphs represent the mean of values ± SEM. (A) Phosphorylation of VEGFR2 at Tyr 951, Src and Akt. (B) Phosphorylation of VEGFR2 at Tyr 1175 and ERK1/2 (N=4 independent experiments, Welch s t-test). 6
8 Fig. S6. HS content and deposition. (A) Quantification of total sulfated glycosaminoglycans in control (shct) and TG2-silenced (shtg2) HUVECs (N=4 independent experiments, Mann- Whitney U test). NS: no significant difference. (B) Nontreated (-) and heparitinase digested (+) HSPGs from total cell lysates of control and TG2-silenced cells grown for 5 days and analyzed by immunoblotting with 10E4 and 3G10 antibodies. 10E4 recognizes an epitope including N- sulfated glucosamine residues present in many human HS chains. 3G10 recognizes human HS neo-epitope, namely desaturated hexuronate present at the non-reducing end of HSPGs after heparitinase digestion. Immunoblots are representative of 3 independent experiments. (C) Deposition of perlecan and TG2 (TG2) and colocalization (merge) or deposition of HS-bearing components (HS) were analyzed by immunofluorescence in control and TG2-silenced cells grown for 4 days. Nuclei were stained with DAPI. The confocal images are representative of 3 independent experiments. Scale bar, 20 µm. 7
9 Fig. S7. Re-expression of wild-type and mutant TG2 in TG2-silenced endothelial cells. Control (shct) and TG2-silenced (shtg2) HUVECs were shown as controls. Re-expression of wild-type TG2 (TG2) or forms of TG2 with mutations in the heparan sulfate (HS) binding site (TG2 R262S, TG2 R263S, TG2 K265S ) or the catalytic site (TG2 C277S ) in shtg2 HUVECs was analyzed by immunofluorescence. Nuclei were stained with Dapi. The confocal images are representative of 3 independent experiments. Scale bar, 20 µm. 8
Boucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Nature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/358/ra2/dc1 Supplementary Materials for Localized TRPA1 channel Ca 2+ signals stimulated by reactive oxygen species promote cerebral artery dilation Michelle
Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
Supplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module
Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
Target Protein Antibody name Product number Manufacturer Species Epitope Dilution Aggrecan Anti-aggrecan AB1031 EMD Millipore Corp Rabbit
Family history Hypertension/ Maximum Degree of aortic Bicuspid Disease Age/Sex Diagnosed CTD of aortic disease Treated aortic insufficiency/stenosis aortic Aneurysm 63/M No Yes Yes/Yes diameter 59mm 1-2+/None
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science
Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration
Supplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins
Supplemental Material PDGFRb regulates craniofacial development through homodimers and functional heterodimers with PDGFRa Katherine A. Fantauzzo and Philippe Soriano Supplemental materials provided: Supplemental
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
Supplementary. limb. bars
Figure 1. CD163 -/- mice exhibit a similar phenotype ass WT mice in the absence of ischemic injury. a, Laser Doppler analysiss with perfusion quantitation at baseline (n= =10 per group). b, Immunostaining
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplemental Material
Supplemental Material Supplementary Fig. 1. EETs stimulate primary tumor growth. a) Schematic presentation of genetic and pharmacological tools used to manipulate endogenous EET levels. b) Endothelial
Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
Nature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
Supplementary Figure 1
Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Quantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
Supplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Project report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:
Project report October 2012 March 2013 CRF fellow: Gennaro Napolitano Principal Investigator: Sergio Daniel Catz Project title: Small molecule regulators of vesicular trafficking to enhance lysosomal exocytosis
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/487/eaag2476/dc1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
Role of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining