|
|
- Zoe Hodge
- 5 years ago
- Views:
Transcription
1 nestin ironetin p75 s1 CNS SKPs Dermo-1 +ve SKPs CNS H2O SCGs Skin Di. SKPs TH SHOX2 GAPDH NCAM D H Figure S1, Immunoytohemil nlysis o SKP spheres ulture rom neontl mouse (nestin, ironetin, S-1) or rt (p75ntr) k skin, n pssge two or three times (top pnels) s ompre to neurospheres ulture rom the emryoni telenephlon n pssge similr numer o times (ottom pnels). In ll pnels, the immunostine ells re re, n the lue is rom Hoehst stining o the nulei to show ll ells. Note tht SKPs express ironetin n S-1 ut not p75ntr, wheres neurospheres o not express ironetin or S-1, ut o express p75ntr., RT-PCR or Dermo-1 n SHOX2, trnsription tors involve in erml n rnioil evelopment, in RNA rom SKPs n CNS neurospheres s esrie in Fig. 1. The positive ontrol (+ve) ws RNA rom E16 orelim., Western lot nlysis or NCAM n opmine-β-hyroxylse in murine SKP spheres versus SKPs ierentite or 14 ys in 10% serum supplemente with neurotrophins. The positive ontrol ws protein isolte rom ulture peripherl symptheti neurons rom the superior ervil gnglion (SCGs)., Immunostining o ierentite SKPs shows tht suset o ierentite ells express tyrosine hyroxylse (TH). 1
2 /ml e nestin /ml /ml III tuulin g nestin / trp1 -kit h SKP Spheres Disso. ells Figure S2, Immunoytohemil nlysis or βiii-tuulin in primry E18 (mile pnel) or ult (right pnel) murine skin ells versus E18 murine CNS telenephli ells (let pnel). All ells were plte in FGF2 n 10% serum or 7 ys n ierentite in meium ontining 5% serum supplemente with neurotrophins., Phse ontrst mirogrphs o primry murine SKP spheres grown or 1 week t vrying onentrtions o strting ells (/ml)., Quntittion o the numer o ells tht give rise to primry SKP spheres in murine k skin isolte t vrious evelopmentl ges rnging rom emryoni y 13 to ulthoo. Cell numers were normlize to the totl numer o ells present in k skin isoltion., Immunoytohemil nlysis or nestin in primry murine SKP lone plte onto poly--lysine/lminin. e, Immunoytohemil nlysis or βiiituulin in primry murine SKPs lone grown in methylellulose n then ierentite., Primry SKP spheres generte y mixing limiting numers o YFP-positive ult virissl ells n E18 primry skin ells n ulturing in the presene o FGF2 n EGF or one week. The let pnel is phse s1/gfap s1/mbp s1/cnpse s1/-kit s1/trp1 s1/dct mirogrph n the right pnel luoresene mirogrph o the sme iel. The rrowhe inites YFP-positive sphere. g, Immunoytohemil nlysis o primry SKP spheres or mrkers o melnolsts n hemtopoieti stem ells. The two let pnels were immunostine or nestin (re, rrows) n or trp1 (green, rrowhes), with the top pnel eing totl issoite skin ells, n the ottom primry SKP sphere. The two right pnels were immunostine or -kit (green), with the top pnel eing ytospin o one mrrow spirte (positive ells re mrke with rrowhes), n the ottom pnel primry SKPs sphere. In ll pnels, the lue erives rom the Hoehst stining o ell nulei. h, Fluoresene mirogrphs o primry issoite orsl skin ells oule-lelle or the preursor ell mrker S-1 (re) n or the Shwnn ell mrkers GFAP, myelin si protein (MBP), n CNPse, or the melnolst/melnoyte mrkers -kit, trp1 n t (ll in green). The lue is Hoehst stining o the nulei. 2
3 s1 e DCT Kertin e III tuulin/cnpse g h III tuulin CEE + FGF Nestin III tuulin/nestin Serum + FGF III tuulin Figure S3, Photomirogrphs o virissl ppill issetion rom n ult pigmente mouse. The let piture shows the intt viriss, while the other pitures show the issetion. The rrowhe inites the ppill.,, Immunoytohemil nlysis o issete whisker ppille or S-1 n t.,e, Fluoresene photomirogrphs o issoite ppill ells tht were immunostine or kertin 18 () or βiii-tuulin n CNPse (e)., Immunoytohemil nlysis or nestin n βiii-tuulin in ult virissl ppill ells iretly ierentite or 7 ys in FGF2, 10% serum n neurotrophins. g, Phse photomirogrphs o issoite ppill ells tht were ulture or one week in the presene o FGF2 plus serum or hik emryo extrt (CEE). Note tht in the presene o CEE, loting spheres o ells were generte. h, Fluoresene photomirogrph o whisker ppill sphere tht ws ierentite on n herent sustrtum or 3 ys n then immunostine or βiii-tuulin. In pnels -e, n h, nulei were stine lue with Hoehst. 3
4 P5 Pigmente Mouse E18 whisker p skin Nexin E18 k skin ells Phse Brightiel o X-gl stining E18 k skin Figure S4, Overlpping expression o β-gltosise n the erml ppill mrker, nexin, in postntl y 5 (P5) Wnt1Cre;Ros26R orsl skin rom pigmente mie. Pigmente melnin grnules re eposite in the eveloping hir sht y neurl rest-erive melnolsts resient n intersperse in the mtrix. A supopultion o ollile ppill ells express mrnas or oth β-gltosise (rrowhe) n nexin (rrowhe). Beyon the outer root sheth, osionl β-gltosise-positive ells n lso e seen in the erml sheth (lower rrow), struture losely ssoite with ollile ppille. Single β-gltosise-positive ells re seen emerging rom the upper portions o the ollile into the interollile epiermis n re likely melnolsts (upper rrow)., Expression o the β-gltosise trnsgene in E18 whisker p versus E18 k skin rom Wnt1Cre;Ros26R emryos, s etete y X-gl stining o ryostt setions. Similr results were otine t vriety o evelopmentl ges using oth X-gl stining n in situ hyriiztion or the β-gltosise trnsgene. Note tht very ew trnsgene-positive ells were etete in orsl skin, in spite o the t tht there re unnt melnolsts n Shwnn ells t this point, s emonstrte or neontl skin in Supplementry Fig. 2h., Photomirogrphs o issoite k skin ells rom neontl Wnt1Cre;R26R mie tht were stine with X-gl one y ter plting. The upper pnel is phse mirogrph while the lower is rightiel mirogrph o the sme iel showing tht neurl rest-erive pigmente melnoytes (oxe in re) were β-gltosise negtive. 4
5 Tle S1 Primer Sequenes Gene Primer Sequene Annel Temp ( C) Prout (BP) Px3 Ggggggttggggg Cggtggtggttg Slug Cgtgggtttt Tttgggggtt Twist Ctttgttttt Gtgggtgttgtttt Snil Cggggtgtttt Ggtggtggttttt Sox9 Cgtgtgt Gttgtgttggtg P75 Gtgggggtgggtggt Cggg SHOX2 Cgggg Tgtt DBH Aggggggttt Cggggggggg Peripherin Gggt Gtggttttt MBP Tggggggtt Ggtgt P0 Ctggtgtgtttttt Cgttgt Dermo-1 Ggggtggt Ctggggggg Nexin Cgggg Gggtgttt Versin Tggggggttt Ttgggtt Wnt-5 Ctgtggg Cgggt GAPDH Gttttgggg Gtgtggtggtgtggt 5
SUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationsupplementary information
DOI:.38/n83 k Mouse Ch8 lous 8 9 Stop CHD8L 75 CHD8L Chromoomins Helise/ATPse omin DNA ining omin 5 kd NIH 3T3 MEF 93T HeL HCT UOS SOS.. CHD8L IB: CHD8 8 5 L S Reltive mrna mount 3... Reltive mrna mount.8.
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1134 CS+ CS- MCH 3 OCT OCT 3 MCH CS- CS+ OCT MCH 3 MCH OCT 3 OCT vs MCH OCT vs MCH ppetitive memory (PI) A 1-1 Unpire onitioning DDC-GAL4/UAS-Trp UAS-Trp/+ -2 MCH OCT OCT MCH sugr OCT MCH
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationEFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN. Research Report to Northarvest Bean Growers, January 19, 2009
EFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN Reserh Report to Northrvest Ben Growers, Jnury 19, 29 Berlin D. Nelson, Susilo Poromrto, n Ruell Goswmi, Dept. Plnt Pthology, NDSU Ojetive: Determine
More informationLETTER. A restricted cell population propagates glioblastoma growth after chemotherapy
oi:1.138/nture11287 A restrite ell popultion propgtes glioblstom growth fter hemotherpy Jin Chen 1, Ynjio Li 1, Tzong-Shiue Yu 1,2 {, Renée M. MKy 1, Dennis K. Burns 3, Steven G. Kernie 1,2 { & Luis F.
More information100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationOPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis
OPGL is key regultor of osteolstogenesis, lymphoyte evelopment n lymph-noe orgnogenesis Young-Yun Kong*, Hiroki Yoshi*, Iliko Srosi², Hong-Lin Tn², Emm Timms³, Csey Cpprelli², Sen Morony², Antonio J. Oliveir-os-Sntos*,
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationregulates stem cells through Wnt/β-catenin signalling
LETTERS O regultes stem ells through Wnt/β-tenin signlling Jolly Mzumdr,,7, W. Timothy O Brien, Rndll S. Johnson, Joseph C. LMnn, Jun C. Chvez 5, Peter S. Klein nd M. Celeste Simon,, Stem ells reside in
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationRoot tip contact with low-phosphate media reprograms plant root architecture
27 Nture Pulishing Group http://www.nture.om/nturegenetis Root tip ontt with low-phosphte mei reprogrms plnt root rhiteture Sergio Svistoonoff,2, urey Creff, Mtthieu Reymon,3,Céile Sigoillot-Clue, Lilin
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationWesternBright Quantum
WesternBright Quntum Quntify hemiluminesent Western lots over wie ynmi rnge WesternBright Quntum is new hemiluminesent regent speilly formulte for CCD imging. This novel Horserish peroxise (HRP) sustrte
More information% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationDGCR8 is essential for microrna biogenesis and silencing of embryonic stem cell self-renewal
7 Nture Pulishing Group http://www.nture.om/nturegenetis DGCR is essentil for mirorna iogenesis n silening of emryoni stem ell self-renewl Yngming Wng, Rostislv Mevi, Collin Melton, Ruolf Jenish & Roert
More informationParathyroid hormone related peptide is a naturally occurring, protein kinase A dependent angiogenesis inhibitor
Prthyroi hormone relte peptie is nturlly ourring, protein kinse A epenent ngiogenesis inhiitor MANJIRI M. BAKRE 1, YUHONG ZHU 1, HONG YIN 1, DOUG W. BURTON 2, ROBERT TERKELTAUB 2, LEONARD J. DEFTOS 2 &
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationPlzf regulates limb and axial skeletal patterning
rtile Plzf regultes lim n xil skeletl ptterning Mri Brn 1, Niol Hwe 1, Lee Niswner 2 & Pier Polo Pnolfi 1 The promyeloyti leukemi zin finger (Plzf) protein (enoe y the gene Zfp145) elongs to the POZ/zin-finger
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationDirectional guidance of neuronal migration in the olfactory system by the protein Slit
rtiles Diretionl guine of neuronl migrtion in the olftory system y the protein Wei Wu*, Kit Wong, Jin-hui Chen*, Zhi-hong Jing, Sophie Dupuis, Jne Y. Wu & Yi Ro * Lortory of Moleulr Neuroiology, Shnghi
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationInsights into bird wing evolution and digit specification from polarizing region fate maps
ARTCLE Reeive 9 Mr 0 Aepte Jul 0 Pulishe 9 Aug 0 DO: 0.08/nomms7 nsights into ir wing evolution n igit speifition from polrizing region fte mps Mtthew Towers,, Json Signolet, Arin Shermn, Helen Sng & Cheryll
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationRestoration of p53 function leads to tumour regression in vivo. p53 locus. Targeting vector DTA LSL. Targeted allele
Vol 445 8 Ferury 27 oi:1.138/nture5541 Restortion of funtion les to tumour regression in vivo Anre Ventur 1, Dvi G. Kirsh 1,2, Mrgret E. MLughlin 1, Dvi A. Tuveson 1, Jn Grimm 3, Lur Lintult 1, Jmie Newmn
More informationNeocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
More informationRegular Paper. Introduction
Regulr Pper Serotonin, Tryptophn-Derive Signl Conserve in Plnts n Animls, Regultes Root System Arhiteture Proly Ating s Nturl Auxin Inhiitor in Ariopsis thlin Rmón Pelgio-Flores, Rny Ortíz-Cstro, Alfonso
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationLETTER. Impaired hydroxylation of 5-methylcytosine in myeloid cancers with mutant TET2
doi:.8/nture98 Impired hydroxyltion of -methylytosine in myeloid ners with mutnt TET Myunggon Ko {, Yun Hung {, Ann M. Jnkowsk, Utz J. Ppe,, Mmt Thilini, Hozef S. Bndukwl, Jungeun An {, Edwrd D. Lmperti,
More informationReprogramming within hours following nuclear transfer into mouse but not human zygotes
Reeive 22 Jun 2011 Aepte 8 Sep 2011 Pulishe 4 Ot 2011 DOI: 10.1038/nomms1503 Reprogrmming within hours following nuler trnsfer into mouse ut not humn zygotes Dieter Egli 1,2,3,4, Alie E. Chen 1,2, Genevieve
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More information... Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. immunology letters to nature
Supplementry informtion is ville in Nture s World-Wide We site (http:// www.nture.om) or s pper opy from the London editoril offie of Nture. Aknowledgements Supported in prt y grnts from the NIH (A.A.,
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationOsteoblasts secrete Cxcl9 to regulate angiogenesis in bone
Reeived 2 De 215 Aepted 9 Nov 216 Pulished 14 De 216 DOI: 1.138/nomms13885 OPEN Osteolsts serete to regulte ngiogenesis in one Bin Hung 1,, Wenho Wng 1,, Qinghu Li 1,, Zhenyu Wng 1,BoYn 1, Zhongmin Zhng
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationGSK-3 is a master regulator of neural progenitor homeostasis
GSK-3 is mster regultor of neurl progenitor homeostsis Woo-Yng Kim 1, Xinshuo Wng 1, Yohong Wu 1, Brdley W Dole 2, Stish Ptel 3, Jmes R Woodgett 3 & Willim D Snider 1 The development of the rin requires
More informationCSE 5311 Notes 2: Binary Search Trees
S Notes : inry Ser Trees (Lst upte /7/ 8:7 M) ROTTIONS Single left rottion t (K rotting ege ) Single rigt rottion t (K rotting ege ) F oule rigt rottion t F G F G Wt two single rottions re equivlent? (OTTOM-UP)
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationSquamous cell carcinoma antigen 1 and 2 expression in cultured normal peripheral blood mononuclear cells and in vulvar squamous cell carcinoma
Tumor Biol. (2010) 31:559 567 DOI 10.1007/s13277-010-0069-x RESEARCH ARTICLE Squmous ell rinom ntigen 1 n 2 expression in ulture norml peripherl loo mononuler ells n in vulvr squmous ell rinom Mglen Chehlinsk
More informationAdenovirus Type 8 Epithelial Keratitis: The Development, Accompanying Signs, and Sequelae
Aenovirus Type 8 Epithelil Kertitis: The Development, Aompnying Signs, n Sequele 2 This hpter shows the evelopment of A8 kertitis in ptients of whom ll ut one (Cse 8) were expose to the virus uring nosoomil
More informationOrigin of Triple hi and Triple lo T reg cells Triple hi and Triple lo T reg cells present in the thymus (Fig. 2a) could represent CD4 + GITR CD4 PD-1
Affinity for self ntigen selets with distint funtionl properties Len Wyss 1,2, Brin D Stdinski 3, Crolyn G King 1, Sonj Shllenerg 4, Nihols I MCrthy, Jun Young Lee 6,7, Krsten Kretshmer 4,8, Luigi M Terrino
More informationControl vector. HA-Elfn2. HA-Elfn1
Control vector c HA-Elfn2 HA- Control vector HA-Elfn2 HA- nti- nti-ha Hippocmpus (CA3) PV DAPI SOM DAPI Hippocmpus (dentte gyrus) PV DAPI SOM DAPI Supplementry Figure 1. Specificity of the nti- ntiody
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationProvider How To. Software Process Service Results
Softwre Proess Servie Results Provier How To Copyright Glenwoo Systems LLC 2010. The informtion herein remins the property of Glenwoo Systems LLC. This informtion my not e reprinte or uplite, n is governe
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationChapter 7. Control and Coordination
Chpter 7 Control n Coorintion 1 Whih of the following sttements is orret out reeptors? Gusttory reeptors etet tste while olftory reeptors etet smell Both gusttory n olftory reeptors etet smell Auitory
More informationDefective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome
correction notice Nt. Med. 17, 726 731 (2011) Defective Wnt-dependent cereellr midline fusion in mouse model of Jouert syndrome Mdeline A Lncster, Dipik J Gopl, Joon Kim, Shr N Sleem, Jennifer L Silhvy,
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture11943 E12.5-CON E12.5-KO b E14.5-CON E14.5-KO Supplementry Figure S1 Loss of Bmpr1 in the Myf5 + linege oes not result in obvious morphologicl chnges prior to E16.5., b, Hemtoxylin & Eosin
More informationCoatomer LPAAT-γ Merge
DI: 1.138/n2273 Cotomr LPAAT-γ Mrg Tuuls (%) 1 5 < 5 nm 5~1nm 1~2nm 2~5nm >5nm 5~1nm < 5 nm 1~2nm 2~5nm >5nm 2 min 5 min 1 min 3 min < 5 nm 5~1nm 1~2nm 2~5nm >5nm < 5 nm 5~1nm 1~2nm 2~5nm >5nm Figur S1
More informationSUPPLEMENTARY INFORMATION
~ 5 % ltion > 99 % ltion 25 2 15 5 Gly yemi (mmol/l) 3 7 15 3 Time fter -ell ltion (dys) Survivl (%) & ~ 5 % ltion 75 > 99% ltion 5 25 25 5 (dys) 7.4 d 1.25 lood ph 73 7.3 7.2 7.1 7. 7d ody weight h nge
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationMERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationAbortion frequency (%) Ovary position on ear Ovary volume (mm 3 )
ortion frequeny (%) 5 1 Ovry position on er 3 1 WW WD pex Bse Ovry volume (mm 3 ) Figure S1. Ovry volume (thik lines) n ortion frequeny (thin lines) s funtion of position long the er, 15 ys fter silk emergene
More informationResident c-kit þ cells in the heart are not cardiac stem cells
Reeived 3 Jul 05 Aepted Sep 05 Pulished 30 Ot 05 DOI: 0.038/nomms970 OPEN Resident -kit þ ells in the hert re not rdi stem ells Nisht Sultn, *, Lu Zhng, *, Jinyun Yn, *, Jiqiu Chen, Weiin Ci, Sheguft Rzzque,
More informationTranscriptional Upregulation of Nrf2-Dependent Phase II Detoxification Genes in the Involved Epidermis of Vitiligo Vulgaris
ORIGIL ARTICLE Trnsriptionl Upregultion of Nrf-Depenent Phse II Detoxifition Genes in the Involve Epiermis of Vitiligo Vulgris Vivek T. Ntrjn 1, Arhn Singh, Avinsh A. Kumr, Pnkj Shrm 3, Hemnt K. Kr 3,
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationCrosstalk between neutrophils, B-1a cells and plasmacytoid dendritic cells initiates autoimmune diabetes
r t i l e s Crosstlk between neutrophils, B-1 ells n plsmytoi enriti ells initites utoimmune ibetes Julien Din 1,2,6, Ynnik Simoni 1,2,6, Letiti Furio 2,3,6, Luie Beuoin 1,2, Birgitt Agerberth 4, Frnk
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationSupplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
More informationSonic Hedgehog promotes proliferation of Notch-dependent monociliated choroid plexus tumour cells
Soni Hedgehog promotes prolifertion of Noth-dependent monoilited horoid plexus tumour ells Li Li, Ktie B. Grusm,2, Jun Wng 3, Melody P. Lun 4,5, Jsmin Ohli 6, Hrt G. W. Lidov 4, Moni L. Clihio 4, Erling
More informationSupplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
More information