Bacterial Pili exploit integrin machinery to promote immune activation and efficient blood-brain barrier penetration

Transcription

1 Reeived Jun Aepted Aug Pulished 6 Sep DOI:.8/nomms7 Bteril Pili exploit integrin mhinery to promote immune tivtion nd effiient lood-rin rrier penetrtion Anirn Bnerjee, Brndon J. Kim,, Ellese M. Crmon,, Andrew S. Cutting, Mihel A. Gurney, Chris Crlos, Rlph Feuer, Nemni V. Prsdro & Kelly S. Dorn, Group B Streptoous (GBS) is the leding use of meningitis in neworn infnts. Bteril ell surfe ppendges, known s pili, hve een reently desried in streptool pthogens, inluding GBS. The pilus tip dhesin, PilA, ontriutes to GBS dherene to lood-rin rrier (BBB) endothelium; however, the host reeptor nd the ontriution of PilA in entrl nervous system (C) disese pthogenesis re unknown. Here we show tht PilA inds ollgen, whih promotes GBS intertion with the α β integrin resulting in tivtion of host hemokine expression nd neutrophil reruitment during infetion. Mie infeted with the PilA-defiient mutnt exhiit delyed mortlity, derese in neutrophil infiltrtion nd teril C dissemintion. We find tht PilA-medited virulene is dependent on neutrophil influx s neutrophil depletion results in derese in BBB permeility nd GBS BBB penetrtion. Our results suggest tht the teril pilus, speifilly the PilA dhesin, hs dul role in immune tivtion nd teril entry into the C. Deprtment of Biology nd Center for Miroil Sienes, Sn Diego Stte University, Cmpnile Drive, Sn Diego, Cliforni 98, USA. Division of Infetious Diseses, Deprtment of Peditris, Childrens Hospitl Los Angeles nd University of Southern Cliforni Kek Shool of Mediine, Los Angeles, Cliforni 97, USA. Deprtment of Peditris, University of Cliforni Sn Diego Shool of Mediine, L Joll, Cliforni 99, USA. These uthors ontriuted eqully to this work. Correspondene nd requests for mterils should e ddressed to K.S.D. (emil: kdorn@sienes.sdsu.edu). nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

2 nture ommunitions DOI:.8/nomms7 Bteril meningitis, serious infetion of the entrl nervous system (C), is mjor use of deth nd disility worldwide. Streptoous gltie (Group B Streptoous, GBS), Grm-positive teril pthogen, is the leding use of meningitis in humn neworns, nd inresingly ssoited with invsive disese in the elderly. Despite the introdution of intrprtum ntiioti prophylxis in pregnnt women to prevent GBS trnsmission, mortlity rtes in neontes remin high (%), nd % of surviving infnts experiene permnent neurologi sequele, inluding ererl plsy, seizure tivity, defness nd/or lindness. Brin dmge following GBS meningitis likely results from the loss of lood-rin rrier (BBB) integrity due to toxiity of teril produts nd/or tivtion of host inflmmtory meditors tht ompromise BBB funtion. The humn BBB, whih is minly omposed of single lyer of speilized humn rin mirovsulr endothelil ells (hbmec), serves s ritil rrier to protet the C ginst miroil invsion. It is postulted tht GBS intertion with hbmec, is the primry step in the pthogenesis of meningitis, whereon omintion of teril trnsytosis, endothelil ell injury, nd inflmmtory mehnisms omine to disrupt the BBB. Cell surfe orgnelles lled pili were reently disovered in GBS nd other streptool pthogens 6. Pili re flexile ppendges on the teril surfe tht hve een shown to prtiipte in essentil events for infetion estlishment, inluding dhesion to the host ells, DNA trnsfer nd iofilm formtion 7. Pili in Grm-positive teri onsist of kone formed y ovlently linked monomers of mjor pilin with ssoited minor pilin proteins tht hve een shown to e essentil for dhesion to vriety of host tissues 8. The genes enoding pili in GBS re loted within two distint loi, designted s pilus islnd nd (PI- nd PI-), with two vrints of PI-: PI- nd PI-. The overll gene orgniztion of the two islnds is similr tht onsists of three genes tht enode LPXTG motif-rrying proteins orresponding to the mjor pilus suunit (PilB), two nillry proteins (PilA nd PilC) long with two genes enoding trnspeptidse enzymes (sortses) involved in pilus ssemly. All linil isoltes of GBS rry t lest one of the two pilus islnds. We hve demonstrted previously tht GBS linil isolte NCTC/8 (serotype V) expresses pili nd tht the pilus dhesin, PilA, ontriutes to GBS dherene to rin endothelium 8. However, the identity of the host ell reeptor nd the ontriution of GBS pili to the pthogenesis of C disese re lrgely unknown. In this study, we exmine the glol gene expression profile of rin endothelium to infetion with GBS isogeni pila mutnt using mirorry, rel-time PCR with reverse trnsription (RT PCR), nd protein nlysis. Our studies suggest tht BBB endothelium responds to the GBS PilA with funtionl gene expression to promote the hrteristi neutrophili inflmmtory response of ute teril meningitis. We lso demonstrte tht PilA interts diretly with ollgen to engge integrins nd integrin signlling mhinery, whih ontriutes to the pthogenesis of meningitis in vivo. Fold hnge (IL-8/GAPDH) Treted versus medi Fold hnge (Trget/GAPDH) Infeted versus medi, IL-8 IL-6 GST I A III V PilA-GST CXCL Endotoxin CXCL CCL IL-8 on. (pg ml ) 8 6 Medi I A III V GBS serotypes d e f Figure PilA promotes hemokine indution in rin endothelium. () Rel-time RT PCR nlysis of hemokines IL-8, IL-6, CXCL, CXCL nd CCL in hbmec h post infetion with WT GBS (lk rs) or isogeni mutnts srr- (grey rs) nd pila (white rs). Trnsript levels were normlized to GAPDH nd fold hnge ws determined s desried in Methods; sttistil nlysis ws performed with two-wy ANOVA (Bonferroni test). () IL-8 seretion y hbmec on infetion with GBS WT strins (lk rs) nd isogeni pila mutnts (white rs). Conentrtions of IL-8 in hbmec superntnts olleted h post infetion were mesured using ELISA, two-wy ANOVA (Bonferroni test); P <.; P <.. () Trnsript levels of IL-8 following tretment ( h) with PilA GST fusion proteins from different GBS serotypes s well s ontrol GST protein (. µm) nd E. oli endotoxin (. ng ml ). Cells were treted with the mount of endotoxin tht were deteted in PilA GST fusion proteins nd GST ontrol protein preprtions with endotoxin detetion kit, s desried in Methods; sttistil nlysis with one-wy ANOVA (Tukey s multiple omprison test). All experiments were performed three times in triplite wells, nd rs represent the stndrd devition of the men of one representtive experiment, P <.; P <.. (d f) Binding of purified PilA GST protein to hbmec. Cells were treted with PilA GST (d) or GST (f) nd then proed with either Anti-PilA ntiserum or Anti-GST A. Nuleus is stined with DAPI. Mgnifition of the oxed re in d is shown in e. Sle r, µm. nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

3 nture ommunitions DOI:.8/nomms7 ARTICLE Results GBS PilA indues hemokine expression in rin endothelium. We hve previously demonstrted tht BBB endothelium hs n tive role in inititing speifi innte immune response to GBS infetion, promoting neutrophil tivtion nd reruitment,. In this study, glol trnsriptionl nlysis of hbmec during infetion with GBS PilA-defiient mutnt reveled mrked redution in the expression of CXC fmily of neutrophil hemokines IL-8, CXCL-, nd CXCL-, s well s CCL- nd IL-6, ompred to infetion with WT GBS (Supplementry Tle S). These results were onfirmed in independent experiments using rel-time RT PCR (Fig. ), further suggesting tht the hbmec trnsriptionl response is influened y PilA-medited intertion. The pila gene enoded in PI- nd is highly homologous etween GBS strins tht hrour this lous (~89% identity). To investigte the role of PilA proteins in other GBS serotypes ommonly ssoited with GBS meningitis, we onstruted pila trgeted mutnts in GBS strins NEM6 (serotype III) nd (serotype ) (Supplementry Fig. S). No differene in the growth kinetis or hemolyti tivity ws oserved etween the respetive WT nd pila mutnt strins (Supplementry Fig. S,). Consistent with our mirorry nlysis, infetion with the PilA-defiient strins resulted in less IL-8 protein seretion ompred with the respetive WT prentl strins (Fig. ). Complementtion of the pila mutnt with the intt pila gene restored hbmec IL-8 seretion to tht oserved during infetion with WT GBS (Supplementry Fig. Sd). PilA promotes IL-8 seretion nd neutrophil hemotxis. We next sought to determine whether GBS PilA is suffiient to indue IL-8 using purified reominnt PilA. PilA proteins, from severl serotype strins, were expressed s mino-terminl GST tgged fusion proteins (Supplementry Fig. S). Following purifition, ll proteins, inluding the GST protein ontrol, ontined low endotoxin levels ( EU ml or. ng ml ). Tretment of hbmec with PilA GST proteins resulted in signifint indution of IL-8 trnsription (Fig. ). We lso oserved diret PilA protein inding to hbmec ompred with tht of the GST ontrol protein (Fig. d f). We further nlysed neutrophil reruitment to the site of infetion using utneous in vivo neutrophil reruitment ssy, s desried previously. Neutrophil enzyme myeloperoxidse (MPO), whih serves s n effetive inditor of neutrophil infiltrtion 6, ws signifintly lower fter infetion with the pila mutnt ompred with the WT strin (Fig. ). This inresed neutrophil reruitment ws independent of the numer of teri present in the tissue, s similr teril olony-forming units (CFU) were reovered from the skin for oth the WT nd pila mutnt under these onditions (Fig. ). Similr results were oserved when ssessing polymorphornuler (PMN) ell reruitment diretly in the C. Mie injeted intrrnilly with the pila mutnt exhiited less PMN infiltrte ompred with nimls inoulted with WT GBS (Fig. h). Tken together, these results indite tht GBS PilA promotes IL-8 seretion nd funtionl neutrophil signlling pthwys in vivo, resulting in neutrophil reruitment during tive GBS infetion. Collgen promotes PilA BBB intertion. Sequene nlysis of GBS PilA s well s omprison to reent rystl struture of GBS PilA orthologue 7 revels severl distint domins inluding two Cn-B-like domins, whih re similr to IgG domins found in S. ureus dhesins 8, nd n Integrin I-like domin tht resemles the A domin of humn von Willernd ftor, moleule shown to intert with ollgens 9. Beuse reent report demonstrted tht the PilA von Willernd ftor region onfers dherent properties to host ells, we further hypothesized tht this my inlude PilA-medited inding to ollgen. We first oserved tht inding MPO tivity (U per g of tissue), 8, 6 d Log (fu per g of tissue) WT pila WT pila f g h Figure PilA indues neutrophil hemotxis. () In vivo neutrophil reruitment ws ssessed y mesuring MPO tivity in mie (CD, mle, n = 8 per group) skin homogentes h post infetion either with WT GBS (lk squres) or pila mutnt (red squres). MPO ssys were performed on mie skin homogentes fter suutneous injetion with 6 CFU of either WT GBS or pila mutnt strin. () Bteril ounts in skin homogentes were ssessed y plting seril-fold dilutions on Todd-Hewitt roth gr pltes. Experiments were performed twie, representtive experiment is shown. Brs represent men MPO levels or teril fu, sttistil nlysis ws performed using Student s t-test; P <.;, non-signifint. ( h) Neutrophil reruitment in the C ws ssessed following diret intrrnil injetion in -dy-old mie (n = per group) 8 h post inoultion with WT GBS or pila mutnt. Representtive imges of rins from two independent experiments re shown for two mie ( e) infeted with WT (sme mouse in,d) nd two mie (f h) infeted with pila mutnt (sme mouse in f,g). Brin setions stined with hemtoxylin nd eosin (H&E) (,f) depit meningel thikening during WT infetion (, rrows) nd PMN infiltrtion y immunohistohemil detetion with FITC nti-ly6g A (d,e,g,h). Sle r, µm. to immoilized ollgen I ws impired in the pila mutnt (Fig. ). Diret inding of purified PilA GST protein to ollgen I ws lso ssessed in n enzyme-linked immunosorent (ELISA)- sed ssy where we oserved dose-dependent inrese in the inding of the PilA protein, nd not the GST ontrol, to ollgen (Fig. ). When GBS ws inuted with inresing mounts of ollgen, we oserved n inrese in oth teril tthment nd internliztion of WT GBS nd not the pila mutnt strin (Fig., d; Supplementry Fig. S,). Further, PilA-oted ltex eds ound hbmec more undntly in the presene of ollgen ompred with BSA or GST-oted eds (Fig. e). These results suggest tht ollgen promotes PilA hbmec intertion. Role of α β integrin nd FAK signlling in BBB tivtion. Extrellulr mtrix proteins like ollgen typilly intert with ell surfe integrins to initite downstrem signlling sdes medited through Fol dhesion kinse (FAK), whih is entrl to integrin-medited signlling. As shown in Figure, onfol mirosopy depited o-loliztion of PilA GST-oted ltex eds with FAK t the fol dhesion sites. This led us to investigte whether integrins, whih re present in fol dhesion sites, might e ting s the host reeptor for PilA. Cells generlly express two e nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

4 nture ommunitions DOI:.8/nomms7 Adherene (%) OD (9 nm) WT pila Invsion (%) OD ( nm) d Collgen (PilA GST) Collgen (GST) BSA (PilA GST) BSA (GST) PilA GST on.(ng) e PilA GST (Bed)-Collgen GST (Bed) Collgen PilA GST (Bed)-BSA GST (Bed) BSA Collgen on. (µg ml ) Collgen on. (µg ml ) Figure PilA inds to ollgen. () Binding of WT GBS nd pila mutnt to immoilized ollgen ws ssessed y rystl violet stining. Stin relesed from tthed teri ws quntified y mesuring sorne t 9 nm. Student s t-test. () Dose-dependent inding of reominnt PilA protein to ollgen I or BSA ompred with GST ontrol protein ws mesured y ELISA s desried in Methods. Adherene () nd invsion (d) of WT GBS (lk rs) nd pila mutnt (white rs) in the presene inresing mount of ollgen I. Bteri were preinuted with indited onentrtion of solule ollgen, wshed extensively nd ssyed for the ility to dhere nd invde the hbmec y ntiioti protetion ssy. Dt re reported s perent dherent or intrellulr teri reltive to the inuput inoulum. All experiments were performed three times in triplite nd rs represent mens nd stndrd devitions of one representtive experiment. Sttistil nlysis ws performed using Student s t-test () or one-wy ANOVA with Tukey s multiple omprison test (ll other experiments) (P <.; P <.; P <.. (e) Phse ontrst imges of PilA GST, GST or BSA-oted ltex eds inding to hbmec in the presene of ollgen or BSA. Cells were extensively wshed with PBS to remove ny unound or loosely ound eds nd visulized using Zeiss Axiovert inverted mirosope (Crl Zeiss). Arrows indite eds on hbmec surfe. Sle r, µm. predominntly ollgen inding integrins: α β nd α β (ref. ). Previous integrin profiling studies reveled tht hbmec only express α nd β integrins. When α β or β integrins were loked using respetive funtion-loking monolonl ntiodies, we oserved signifint redution in WT GBS tthment nd invsion in hbmec ompred with n isotype ontrol ntiody (Fig. ; Supplementry Fig. S,). There ws no noteworthy hnge in the dherene nd invsive pilities of the pila mutnt strin, inditing tht α β integrins re required for PilA-medited GBS penetrtion of BBB endothelium. Interestingly, IL-8 seretion y hbmec on infetion with WT GBS ws lso signifintly redued in presene of oth α β or β integrin funtion-loking monolonl ntiodies (Fig. ; Supplementry Fig. S). Furthermore, s desried in the Methods, we knoked down the expression of β integrin in hbmec y short hirpin RNA (Supplementry Fig. Sd). Bteril invsion, s well s IL-8 seretion on infetion with WT GBS, ws signifintly redued in β integrin knokdown hbmec ells ompred with ells trnsfeted with the srmle shrna ontrol (Fig. d,e). Finlly, we oserved signifint redution in PilA GST inding to β integrin knokdown hbmec ells, s well s in ells treted with nti-α β monolonl A, s ompred with ells trnsfeted with the srmle shrna ontrol (Supplementry Fig. Se g). These results further suggest tht integrin α β ts s reeptor for GBS PilA. The non-reeptor FAK lolizes with β integrins nd eomes tivted in response to integrin initited signlling proesses. Previously, phosphoryltion of FAK ws shown to e ruil for invsion of hbmec y GBS serotype III strin. We similrly show tht FAK, s well s Akt nd Erk/, re phosphorylted during WT GBS infetion, wheres little-to-no phosphoryltion ws oserved during infetion with the pila mutnt over the sme time period (Fig. ). To further exmine the impt of FAK on PilA-medited ellulr invsion nd IL-8 seretion, hbmecs were trnsfeted with the roxy-terminlly trunted FAK-derivtive FRNK (FAK-relted non-kinse), whih does not ontin n tive kinse domin, nd ts s dominnt negtive form when overexpressed in hbmec (FRNK/hBMEC). We did not oserve ny hnge in teril dherene etween different ell lines during infetion with either WT GBS or pila mutnt (Fig ). However, we did oserve redution in ellulr invsion nd IL-8 seretion during WT GBS infetion of FRNK/hBMEC ells ompred with the WT FAK ontrol (Fig.,d). To exmine whether teril invsion itself is required for PilA-medited IL-8 seretion, we used ytohlsin D to lok tin polymeriztion in hbmec during GBS infetion. This tretment inhiited teril internliztion in dose-dependent mnner, ut did not led to redution in teril dherene or PilA-medited IL-8 seretion (Supplementry Fig. S). Tken together, these results onfirm tht GBS invsion of rin endothelium is not prerequisite for IL-8 seretion nd imply tht PilA medited enggement of α β integrins initites FAK signlling events tht led to oth hemokine seretion nd teril penetrtion. We further investigted the role of phosphtidylinositol- kinse (PIK) s well s the MAP kinse Erk/ pthwy, oth of whih signl downstrem of FAK, during PilA-medited immune tivtion nd ellulr invsion. Inhiition of PIK tivity with LY9 resulted in signifint redution in teril invsion without ffeting IL-8 seretion (Fig. e,f). In ontrst, tretment of ells with Erk/ pthwy inhiitor U6, resulted in drsti deline in IL-8 relese (8%) without perturing the ellulr invsion proess (Fig. g,h). We lso nlysed the effet of these inhiitors on hemokine seretion nd neutrophil hemotxis in vivo y mesuring KC (funtionl murine homologue of IL-8) nd MPO levels s desried ove. Signifintly lower levels of KC nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

5 nture ommunitions DOI:.8/nomms7 ARTICLE Anti-FAK Anti-PilA TO-PRO Overly Invsion (%) IL-8 on. (pg ml ), 8 6 ( ) Anti α β Isotype Medi ( ) Anti α β ontrol Isotype ontrol d Invsion (%) e IL-8 on. (pg ml ) 8 6 hbmec hbmec β (srmle shrna) Medi WT pila Medi WT pila hbmec (srmle shrna) hbmec β Figure PilA interts with α β integrins to promote teril penetrtion nd hemokine seretion. () Co-loliztion of PilA-oted ltex eds with FAK visulized y onfol mirosopy. PilA-oted eds re stined with Anti-PilA ntiserum (green), FAK with Anti-FAK monolonl A (red) nd nuleus with To-Pro (lue). Sle r, µm. Inhiition of GBS internliztion () nd IL-8 seretion () y hbmec following pretretment with α β integrin funtion loking monolonl A ompred with isotype ontrol A. GBS penetrtion (d) nd IL-8 relese (e) in β integrin knokdown hbmec ells using shrna trgeting β integrin RNA (hbmec β ) or ontrol shrna (srmle shrna). Bteril invsion ws quntified y ntiioti protetion ssy nd IL-8 seretion ws mesured y ELISA. Blk rs represent WT GBS nd white rs represent pila mutnt. All experiments were performed three times in triplite nd rs represent the stndrd devition of the men of one representtive experiment. Sttistil nlysis ws performed using one-wy ANOVA (Tukey s multiple omprison test); P <.; P <.; P <.;, non-signifint. nd susequent neutrophil reruitment were oserved t the site of WT GBS infetion with prior tretment of U6 (Fig. i,j). No signifint differene ws oserved when similr tretment ws rried out with the PI K inhiitor LY9 or during infetion with pila mutnt. Overll, these studies suggest tht PilA medited teril invsion nd indution of hemokine signlling pthwys diverge downstrem of FAK in possily independent pthwys. PilA ontriutes to pthogenesis of meningitis in vivo. To exmine the ontriution of PilA to the pthogenesis of GBS C infetion in vivo, we employed our mouse model of GBS hemtogenous meningitis, s desried previously,6. Mie (8-week, CD- mle) were intrvenously injeted with either WT GBS or pila mutnt. All the WT GBS-infeted mie died fter h wheres it took 8 h for ll the pila mutnt-infeted mie to suum to infetion. The medin survivl time of the WT GBS-infeted mie ws signifintly lower ompred with pila mutnt-infeted mie (P =.6, Log Rnk test) (Fig. 6). In similr seprte experiment, mie infeted with WT GBS or the pila mutnt, were killed fter h to ssess teril dissemintion to the rin. The levels of GBS deteted in the lood or spleen of eh group of mie were essentilly identil wheres the teril rin lod in pila-infeted mie ws signifintly lower thn in mie infeted with WT (Fig. 6). Also the CFU reovered from the rin versus the loodstrem ws signifintly greter in the mie infeted with WT ompred with the pila mutnt (Fig. 6). RT PCR nlysis reveled tht the mie infeted with pila mutnt exhiited deresed rin trnsript levels of KC, ompred with mie infeted with WT GBS (Fig. 6d). Histopthologil nlysis of the rin tissue setions from ll the nimls infeted with WT GBS exhiited lssil fetures of meningitis suh s meningel thikening; mssive influx of inflmmtory ells, espeilly neutrophils; nd sustntil hemorrhging tht were rre or sent in nimls infeted with pila mutnt strin (Supplementry Fig. S). Imges from representtive mie infeted with WT nd the pila mutnt, or following PBS injetion, re shown in Figure 6e j. Presene of WT GBS ws visulized in meninges y immunohistohemil nlysis, wheres the PilA defiient strin ws rrely oserved (Fig. 6k n). In seprte experiment, we ssessed teril lod nd hemokine expression in multiple tissues, s well s rin pthology during infetion with the WT nd pila mutnt over time. In generl, t ll time nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

6 nture ommunitions DOI:.8/nomms7 d min pfak FAK perk Erk pakt Akt WT pila M.Wt. (kd) 6 6 Adherene (%) 8 6 FAK WT/hBMEC FRNK/ hbmec Invsion (%) FAK WT/hBMEC FRNK/ hbmec IL-8 on. (pg ml ) Medi WT WT Medi pila pila FAK WT/hBMEC FRNK/hBMEC e f g h Invsion (%) 8 6 DMSO IL-8 on.(pg ml ) Invsion (%) µm µm Medi DMSO µm µm DMSO µm µm Medi DMSO µm µm LY9 LY9 U6 U6 IL-8 on. (pg ml ), 8 6 i KC (pg per mg of tissue) j, DMSO U6 LY9 MPO tivity (U per g of tissue),,, DMSO U6 LY9 Figure FAK is entrl to GBS invsion nd hemokine seretion. () Detetion of phosphorylted forms of FAK (Tyr-97), Akt (Ser-7) nd Erk/ (Tyr-) s well s non-phosphorylted forms in hbmec lystes t different stges of infetion with WT GBS nd pila mutnt. Cells were infeted for indited time points, nd ell lystes olleted were proed with respetive ntiodies. Adherene (), Invsion () nd IL-8 seretion from (d) FRNK/hBMEC ompred with FAK WT/hBMEC on infetion with WT GBS (lk rs) or pila mutnt (white rs). hbmecs were trnsfeted with the C-terminlly trunted FAK derivtive FRNK (FAK-relted non-kinse), whih ts s dominnt negtive form when overexpressed (FRNK/hBMEC). Bteril invsion (e,g) nd IL-8 seretion in hbmec (f,h) on infetion with WT GBS (lk rs) or pila mutnt (white rs) in presene of PIK inhiitor LY9 (e,f) or MEK/ inhiitor U6 (g,h). All experiments were performed three times in triplite nd rs represent the stndrd devition of the men. Sttistil nlysis ws performed using one-wy ANOVA (Tukey s multiple omprison test); P <.; P <.; ns: non-signifint. KC levels (i) nd MPO tivity (j) in mie (n = 8 per group) skin homogentes h post suutneous injetion with either WT GBS (lk squres) or pila mutnt (red squres). h efore teril injetion mie were injeted suutneously with mg kg of either U6, LY9 or DMSO s ontrol. Experiments were performed twie nd rs represent mens nd stndrd devitions of one representtive experiment. All experiments were nlysed y one-wy ANOVA (Tukey s multiple omprison test); P <.; P <.; P <.;, non signifint. points tested, even t time of deth, mie infeted with the pila mutnt hd sustntilly less inflmmtory infiltrte nd neroti injury in the rin thn those infeted with WT GBS (Supplementry Fig. S6). Consistent with our previous experiments, signifintly more teril CFU nd KC expression ws oserved in the rin nd lungs of mie infeted with the WT strin (Supplementry Fig. S7). Similr results were otined in vitro using ervil (HeL) nd lung (A9) epithelil ell lines (Supplementry Fig. S8) demonstrting tht PilA ontriutes to oth dherene nd hemokine indution in these different ell types. Role of neutrophils during GBS meningitis. Our oservtion tht WT GBS-infeted mie hd higher level of hemokine KC s well s signifint infiltrtion of leukoytes, espeilly neutrophils, led us to investigte the ontriution of neutrophils to BBB permeility nd the progression of GBS meningitis. Mie were rendered neutropeni using monolonl ntiody RB6 8C (ref. 7) efore intrvenous (i.v.) infetion with GBS; we oserved sustined neutropeni during the ourse of our experiment (Supplementry Fig. S9). Approximtely % of the RB6 8C-treted nimls suumed to deth within the first h of infetion, proly due to septi shok. This ws evidened y drop in ody temperture, higher teril lod in the lood nd lungs, nd higher levels of sepsis-relted ytokines (IL-β nd IL-6) in serum, spleen nd lung in neutropeni mie ompred with those treted with isotype ontrol A (Supplementry Fig. S h). Interestingly, the RB6 8C-treted mie tht survived the initil sepsis lived longer nd lso exhiited lower teril ounts in the rin ompred with ontrol mie (Fig. 7 ). Following survivl of sepsis, the medin survivl time of neutropeni mie ws higher ompred with ontrol A-treted mie (6 versus 6 h). These results suggest tht neutropeni my e onferring survivl dvntge during GBS C disese. We next sought to exmine the permeility of rin endothelium y Evns lue (EB) dye extrvstion 8. Mie were either treted with PBS, RB6 8C or isotype ontrol A followed y i.v. injetion of PBS (for PBS-treted mie) or WT GBS (for A-treted mie). Mie were killed h post infetion following n i.v. injetion with EB ( µl, %, w/v). Brins reovered from mie treted with the nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

7 nture ommunitions DOI:.8/nomms7 ARTICLE Perent survivl (%) 8 6 e g f h Time (h) Log (fu per ml of lood) or Log (fu per g of tissue) 8 6 Blood Spleen Brin i k j l Brin CFU/Blood CFU WT pila d Fold hnge (KC/β-Atin) Infeted versus ontrol, 8, 6,,, WT pila m n Figure 6 Mouse model of GBS meningitis. () Kpln Meier survivl urve of mie following i.v. injetion with WT GBS (lk squres) or pila mutnt (red squres). Groups of CD- mle mie (n = per group) were injeted intrvenously with 7 7 CFU of teri nd survivl ws monitored over time nd nlysed using the Log-rnk test; P <.. Bteril ounts in the lood, spleen, rin (fu per ml or fu per g of tissue) () nd rtio of teril ounts in the rin nd lood () h post i.v. injetion in mie (n = 8 per group) with either WT GBS or pila mutnt. (d) Trnsript undne of murine hemokine KC ws determined y quntittive RT PCR on messenger RNA smples isolted from mie rins, following infetion with WT GBS or pila mutnt for h. Trnsript levels were normlized to β-tin nd expressed s fold hnge ompred with mie injeted with PBS only. Experiments were performed twie nd rs represent stndrd devition of the men of one representtive experiment. Sttistil nlysis ws performed using Student s t-test; P <.;, non signifint. Histopthology of rin tissues of representtive individul mie infeted with WT GBS (e h) ompred with PBS tretment (i), or infeted with pila mutnt (j). Enlrgement of oxed res in e nd g re shown in f nd h respetively, depiting meningel thikening nd neutrophil infiltrtion. (k n). Immunohistohemil detetion of GBS in the rins of mie infeted with either WT GBS (k,m) or pila mutnt (l,n). Bteri were lelled with monolonl nti-gbs A nd deteted with nti-mouse seondry ntiody onjugted to HRP, oupled with hemtoxylin ounterstining (k l). GBS ws lso visulized y immunofluoresene with nti-mouse seondry A onjugted to AlexFluor 88 (green). Blood vessels re stined with Anti-lminin A (red) nd nulei with To-Pro (lue) (m,n). Sle r, µm. isotype ontrol A were visily more lue ompred with either RB6 8C or PBS-treted non-infeted mie (Fig. 7d). Signifintly higher EB lehing into the rin ws quntified in mie treted with ontrol A ompred with neutropeni mie or PBS-treted mie (Fig. 7e). Bteril lod in the rin s well s BBB permeility mesured y EB extrvstion h post infetion with the pila mutnt ws similr in mie treted with oth the neutrophil depleting nd isotype ontrol A (Supplementry Fig. Si,j). In seprte experiment, we lso ssessed BBB permeility using FITC-lumin s trer 9. We similrly oserved generlized lekge from lood vessels within the rin prenhym during GBS infetion in mie tht were treted with isotype ontrol A ompred with nimls treted with RB6 8C A or PBS lone (Fig. 7f i). Disussion The pthogenesis of GBS meningitis involves hemtogenous spred nd entry into the C y invding the BBB; however, the preise mehnism(s) wherey the terium leves the loodstrem nd gins ess to the C is still eing eluidted. In this study, we report tht the pilus tip protein, PilA, whih medites GBS tthment to the rin endothelium, ontriutes to virulene y promoting hrteristi neutrophili infiltrte during ute teril meningitis. We further demonstrte tht PilA inds the extrellulr mtrix omponent ollgen, whih then engges α β integrins on rin endothelium to dully promote teril tthment nd proinflmmtory hemokine relese. Inresed neutrophili infiltrte ws orrelted with inresed BBB permeility nd higher levels of teril C penetrtion in vivo (Fig. 8). Thus, it is likely nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

8 nture ommunitions DOI:.8/nomms7 Perent survivl (%) 8 6 Time (h) Log (fu per ml of lood) or Log (fu per g of tissue) 8 6 Brin CFU/Blood CFU Blood Brin RB6 8C Control IgG d RB6 8C Control IgG PBS f g e EB extrvstion (µg of EB per g of rin tissue) 6 PBS RB6 8C Control IgG GBS Infeted h i Figure 7 Influene of neutropeni on the ourse of GBS meningitis. () Kpln Meier survivl urve of mie following i.v. injetion with 7 7 CFU of WT GBS. h efore teril hllenge groups of CD- mle mie (n = per group) were treted intrperitonelly with µg of either neutrophildepleting A, RB6 8C (lk squres) or isotype ontrol A (red squres). Survivl ws monitored t lest twie dy over one-week period nd dt nlysed using Log-rnk test; P =.7. Bteril ounts in the lood, rin () nd rtio of teril ounts in the rin versus the lood () h post i.v. injetion with WT GBS. (d) Pitures of mie rins following i.v. injetion of EB dye h efore killing. (e) BBB permeility s refleted y mount of EB dye extrvstion to the C. EB ws extrted from rin tissue y tretment with 6% TCA nd sorne ws mesured t 6 nm. Vsulr permeility of the EB dye is expressed s µg of EB per g of rin tissue using stndrd urve. Experiments were performed twie nd rs represent the stndrd devition of the men of one representtive experiment. Sttistil nlysis ws performed using Student s t-test; P <.; P <.; P <.;, non signifint. (f i) Permeility of the BBB s demonstrted y extrvstion of FITC Alumin ( ml kg ) tht ws injeted i.v. min efore killing. Brins from representtive mie re shown following tretment with PBS only (f), infetion with WT GBS following tretment with either RB6 8C A (g) or ontrol IgG (h,i). Arrows indite res of dye lekge in the rin. Sle r, µm. tht the PilA BBB intertion represents one of the erly moleulr events tht ontriute to disese progression resulting in detrimentl outome for the host. The BBB tht is primrily omposed of speilized lyer of rin mirovsulr endothelil ells seprtes the rin nd its surrounding tissues mintining the proper iohemil onditions for norml rin funtion. Intertion of teril omponents with the BBB is the entrl event in the pthogenesis of BBB penetrtion nd prerequisite for development of severe meningel inflmmtion, the hllmrk of meningitis. GBS ftors shown to promote n intertion of the terium with rin endothelium inlude lipoteihoi id, β-hemolysin/ytolysin (β-h/), pili 8, serine-rih repet glyoprotein (Srr-) 6, firinogen-inding protein, lminininding protein nd reently hypervirulent GBS dhesin. The mjority of these ell surfe ssoited ftors diretly promote tthment nd/or invsion of GBS in different host ell types inluding hbmec. We hve shown previously tht GBS mutnt lking nhored lipoteihoi id indued similr levels of IL-8 expression during hbmec infetion s ompred with the WT GBS strin. Here we similrly demonstrte tht GBS surfe dhesin/ invsin Srr- does not ontriute to ytokine/hemokine indution (Supplementry Tle S), suggesting tht redution in teril dherene/invsion is not solely responsile for generl dereses in gene trnsription oserved during infetion. We hve previously demonstrted tht GBS infetion of hbmec results in the upregultion of proinflmmtory ytokines nd hemokines funtioning to orhestrte neutrophil reruitment nd tivtion, nd tht this effet ws lrgely due to the mjor ell ssoited virulene ftor β-h/,. Compred with WT GBS, infetion with PilA-defiient mutnt resulted in signifintly less gene indution nd seretion of key neutrophil CXC hemokines s well s funtionl neutrophil hemotxis to the site of infetion. We speulte tht s pili re long filmentous orgnelles protruding wy from the teril surfe, pili-medited ontt my represent ruil first step in GBS BBB enggement, fter whih other virulene ftors suh s the β-h/ toxin will proly ontriute to disese progression. Our results tht GBS pilin omponent ontriutes to the host proinflmmtory response re onsistent with reent studies on other pilited pthogens. It ws oserved tht pilited strins of pneumoous evoked higher TNFα response thn non-pilited nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

9 nture ommunitions DOI:.8/nomms7 ARTICLE PIK P Pili FAK P Collgen α β MEK/ P Erk/ P Figure 8 Model of GBS PilA-medited C infetion. () PilA inds the extrellulr mtrix omponent ollgen, whih then engges α β integrins on rin endothelium. () This leds to FAK tivtion nd susequent intrellulr signlling. () Signlling pthwy involving PIK results in tin rerrngement nd teril uptke. () A prllel signlling pthwy involving MEK/ nd Erk/ tivtion leds to IL-8 seretion. () This further results in funtionl neutrophil hemotxis nd tivtion. (6) Inresed neutrophili infiltrte dmges the BBB resulting in inresed BBB permeility, whih likely filittes further teril pssge from the lood strem to the C. strins during systemi infetion. Similrly, type I pili (P pili) of uropthogeni Esherihi oli hve een shown to stimulte IL-8 relese in the urinry trt muos. PilA-medited inding of ollgen enhned GBS tthment s well s uptke into hbmec in dose-dependent mnner. Our results re onsistent with other studies showing tht RrgA, the pneumool homologue of GBS PilA, inds to vrious ECM proteins inluding the ollgen 6, nd tht minor pilin protein Cp of Group A Streptoous (GAS) possess ollgen-inding pilities 7. The high sequene similrity etween RrgA nd pilus dhesins from GAS nd GBS (identity level of ~% with similrity levels eyond 7%) points to the possiility tht the three-dimensionl fold of these proteins ould e highly similr, suggesting tht pili omponents my ontriute to generl mehnism of pthogen entry nd inflmmtory indution. Mny pthogeni teri exploit integrin-medited signlling for entry into the host ells 8,9. Here we demonstrte tht the intertion etween PilA nd α β integrin in BBB endothelium proly results in FAK tivtion to initite signlling pthwys leding to oth teril internliztion nd proinflmmtory ytokine relese, whih results in funtionl neutrophil hemotxis nd disese progression. There re only few reports tht suggest other teril pthogens elorte ftors tht employ similr strtegies. These inlude the orl streptool protein I/IIf tht interts with α β integrins, nd the YdA invsin of Yersini pseudotuerulosis nd the outer memrne protein, Op of Nesseri meningitidis, oth of whih ind fironetin to nhor to β integrins resulting in teril uptke s well s IL-8 seretion. Given tht integrins preferentilly lolize to the solterl surfe of polrized endothelium, we propose tht these erly moleulr intertions of GBS with the BBB my lter ellulr polrity s hs een desried for Helioter pylori. It hs lso een demonstrted tht GBS is ple of prellulr trnsit ross n epithelil ell rrier where the terium o-lolized with juntionl protein omplexes 6. Whether these intertions t to disrupt tight juntionl proteins nd result in non-polrized distriution of proteins on the BBB plsm memrne remins to e investigted. IL-8 IL-8 IL-8 IL-8 6 Our in vitro results were orroorted in vivo in murine model of GBS hemtogenous meningitis. Infetion with the PilA-defiient mutnt strin resulted in delyed mortlity, deresed neutrophil infiltrtion nd teril C dissemintion nd less expression of murine CXC hemokine KC. Histopthologil nlysis of the mie rins infeted with WT GBS exhiited lssil fetures of meningitis, suh s thikening of the meninges, mssive influx of inflmmtory ells, speilly neutrophils, nd rin tissue dmge. Also during the ourse of disese progression, signifint differenes in the teril lod nd KC levels etween WT nd pila mutntinfeted nimls were oserved only in tissues tht re typil sites of GBS infetion suh s rin nd lung, wheres no differene ws oserved in other tissues inluding liver, kidney nd spleen (Supplementry Fig. S7). Thus, it is likely tht other ftors ontriute to GBS C tropism. PilA-medited virulene ws lso found to e dependent on neutrophil influx. Our results suggest tht depletion of peripherl neutrophils onferred survivl enefit t lter time points in GBS infetion. Neutropeni ws lso ompnied y deresed teril rin lod nd BBB permeility during infetion. While some studies hve demonstrted tht the depletion of neutrophils ws detrimentl to the host during teril infetion 7, others hve oserved tht PMN depletion prolonged host survivl fter infetion. Our findings demonstrte n ssoition etween leukoyte trffiking nd BBB permeility nd inresed GBS penetrtion of the C, suggesting tht PMN-medited dmge of the BBB hs signifint role in the pthogenesis of GBS meningitis. Overll, our findings suggest tht GBS pili hijk host integrin mhinery for inflmmtory tivtion of rin endothelium nd susequent teril C entry. The resulting lolized inflmmtion initited y these erly moleulr events results in inresed permeility of the BBB nd filittes teril pssge from the lood strem to the immune privileged site of the C. To the est of our knowledge, this is the first report tht desries the mehnisti nd dul role of pili during C disese pthogenesis, s well the deleterious role of neutrophil infiltrte during GBS meningitis. Although urrently there is no vine ville for GBS infetion, reent reports hve identified GBS pili omponents, nd PilA in prtiulr s it is highly onserved etween strins, s potentil vine ndidtes. Thus, our studies provide further mehnisti insight into the ontriution of pili omponents to GBS disese pthogenesis. Methods Bteril strins. Streptoous gltie (GBS) serotype V strin NCTC /8 nd its isogeni pila mutnt tht ws reted y in-frme lleli replement with hlormpheniol resistne ssette 8 were primrily used for the experiments. Muttions in the pila gene in other GBS serotypes (serotype IA strin nd serotype III strin NEM6) were reted y insertionl duplition mutgenesis. Briefly, prt of the pila gene ws mplified y PCR using the following set of primers; PilA(F): GTTTGTCGCAAATACCGCTTA nd PilA(R): CATTACTCTC AACCTTAACTTG nd loned in phy. After trnsformtion with respetive reominnt plsmids insertionl mutnts were seleted on Erythromyin seletive pltes. pila gene deletion ws onfirmed y western lotting whole teril lystes using nti-pila A. For omplementtion studies, full length pila gene ws mplified using the following sets of primers, KpnI PilA(F): -AGTCGGTACCATGAG AAAATA- ; BglII PilA(R): -ATCGAGATCTTTAATCTTTTTC- nd loned in pdcerm. pila mutnt strin ws trnsformed with the reominnt plsmid for genertion of omplemented strin. WT, pila mutnts nd omplemented GBS strins were grown in Todd-Hewitt roth THB t 7 C. Erythromyin t onentrtion of µg ml ws inorported in the growth medium when required. Cell lines nd infetion ssys. The humn rin mirovsulr endothelil ell line ws kindly provided y Kwng Sik Kim (Johns Hopkins University) nd ultured in RPMI6 ontining % FBS, % Nuserum nd % nonessentil mino ids,. hbmecs stly expressing shrna trgeting β integrin (hbmec β ) or ells expressing ontrol shrna were generted y trnsfetion (Snt Cruz Biotehnology). Knokdown of integrin β ws verified using stndrd flow ytometry ssy (FACS; BD Biosienes). FAK WT/hBMEC nd FRNK/ nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

10 nture ommunitions DOI:.8/nomms7 hbmec ells re grown s reported. Infetion ssys for mirorry nlysis, ytokine seretion, teril dherene nd invsion were previously desried,. Bteril dherene nd invsion ws lulted s (reovered CFU/initil inoulum CFU) %. For inhiition studies, ells were pretreted for min with indited mounts of ytohlsin D, LY9 nd U6, or µg ml of nti-integrin β or nti-α β integrin A efore inution with teri. RT PCR nd ELISA. RNA isoltion, DNA preprtion nd quntittive PCR ws performed ording to stndrd protools. Primer sequenes for IL-6, IL-8, CXCL, CXCL, CCL, KC nd β-tin nd primer effiienies re reported erlier,. Reltive gene expression ws lulted using the following eqution: Reltive gene expression = trget gene effiieny (CT ontrol CT smple)/ effiieny for β-tin or GAPDH (CT ontrol CT smple). Conentrtions of IL-8, KC (R&D systems) or IL-β nd IL-6 (ebiosienes) in hbmec superntnts or in mie tissue homogentes were determined y ELISA. Mirorry nlysis. Mirorry experiments were performed using Sentrix Humn-8 Expression BedChips (Illumin). Dt were nlysed using sttistil lgorithm developed for high-density oligonuleotide rrys 6. The mirorry dt hs een deposited in the EMBL-EBI under ession ode E-MTAB-76. PilA GST purifition nd genertion of ntiserum. pila gene from the genomi DNA of different GBS strins (serotype IA, III nd V) ws mplified using the following primers, SlI-PilA-F ( -ATGCAGGTCGACAAGTACCGTACCGGA AAAT- ), NotI-PilA-R ( -ATGCAGCGGCCGCTTATCCTTTTGGTGGAAT AT- ) nd loned in pgext- (GE HelthSienes). E. oli BL(DE) ells rrying pgex PilA were grown t C nd protein expression ws indued with mm IPTG for 8 h. GST PilA proteins were purified from the rude extrts using Glutthione Sephrose (GE Helthsienes) olumn hromtogrphy. Frtions olleted were onentrted using Amion Ultr entrifugl devies (Millipore) nd uffer exhnged in PBS using PD olumns (GE Helthsienes). Similrly purified GST served s ontrol protein. The proteins were mde endotoxin-free using ToxinErser Endotoxin Removl Kit (Gensript) nd mount of endotoxin ws quntitted using ToxinSensor Chromogeni LAL Endotoxin Assy Kit (Gensript). Anti-serum ginst PilA ws generted y immunizing New Zelnd white rits with PilA (His) 6 protein preprtion mixed with Freund s omplete djuvnt (Pifi Immunology). The speifiity of the nti-serum ws determined y ELISA. Inhiitors nd ntiodies. Following ntiodies nd inhiitors were used: rit nti-fak, monolonl nti-integrin β nd monolonl nti-α β integrin (Millipore); monolonl nti-gbs (Aris); monolonl nti-fak, FITC rt nti-mouse Ly6G nd FITC rt IgG (BD Biosienes); nti-gst nd got polylonl nti-akt (Snt Cruz Biotehnology); monolonl nti-fitc iotin onjugte nd nti-lminin (Sigm); Alex fluor 67 nti-mouse CD (BioLegend); nti-phospho p/ MAPK (py) nd p/ MAPK rit A (Cell Signling); rit polylonl ntiphospho FAK (py97) nd rit polylonl nti-phospho Akt (ps7) (Invitrogen); ytohlsin D, LY9 (PIK inhiitor), nd U6 (MEK/ inhiitor) (Sigm). Bteri nd PilA inding to ollgen. Bteril inding to ollgen ws determined y rystl violet stining 7. Stin ound to teri ws relesed y ddition of mm itrte uffer, ph., nd sorne ws mesured t 9 nm. Binding of PilA GST or GST to ollgen ws determined y ELISA 6. ELISA pltes oted with ollgen I or BSA ( µg per well) were treted with different onentrtion. of either PilA GST or GST protein. After susequent inution with nti-pila or nti-gst A nd HRP-onjugted seondry As, hromophore ws developed using, -,, -tetrmethylenzidine (Sigm) nd the sorne ws mesured t nm. Cellulr tthment of protein-oted ltex eds. Ltex eds (. µm in dimeter, Sigm) were oted with PilA GST or GST 8 proteins ( mg ml ) in oupling uffer ( mm MES ph 6., mm NCl) t C for overnight. After wshing, nonspeifi sites were loked with either % BSA or ollgen. hbmec monolyer ws inuted with protein-oted ltex eds t n pproximte ell: ed rtio of : for h. Confol mirosopy. hbmecs treted with PilA protein or PilA-oted eds were fixed with % PFA nd permeilized with.% triton X-. PilA ws stined with nti-pila (:,) A nd Alex Fluor 88 onjugted got ntirit A (Invitrogen). FAK ws stined with nti-fak A (:,) followed y Cy onjugted rit nti-mouse A (Invitrogen). DNA ws stined with To-Pro- iodide (Invitrogen). Coverslips were mounted on glss slides using Vetshiled (Vetor ls) nd visulized with onfol lser snning mirosope (Lei Mirosystems). Western lotting. hbmec were infeted with WT GBS nd pila mutnt for different time points nd lysed using RIPA uffer (Thermo Sientifi) ontining mm N VO, mm NF, mm sodium pyrophosphte, mm PMSF nd protese inhiitor oktil (Cliohem). Cell lystes ( µg) were proed with ntiodies ginst phosphorylted nd non-phosphorylted forms of FAK, Akt nd Erk/ (ll As t :,). In vivo neutrophil hemotxis. All niml experiments were pproved y the Committee on the use nd re of nimls t Sn Diego Stte University (SDSU) protool APF -8-D nd performed using epted veterinry stndrds. Neutrophil reruitment ws determined using utneous in vivo neutrophil hemotxis ssy,. For determining signlling pthwys resulting in neutrophil hemotxis, h efore teril injetion mie were injeted suutneously with mg kg of U6, LY9 or DMSO. To ssess PMN reruitment diretly in the C, -dy-old pups (C7BL/6, n = per group) were infeted intrrnilly 9 with CFU ( µl) of either WT GBS or pila mutnt. Following srifie, 8 h post infetion, prffin emedded rin setions were immunostined with FITC rt nti-mouse Ly6G (:) or stined with hemtoxylin nd eosin (H&E). Mouse model of hemtogenous meningitis. 8-week-old mle CD- mie were injeted intrvenously with CFU of WT GBS or isogeni pila mutnt. At different time points fter injetion (, 8 nd 7 h), mie were euthnized nd lood, rin nd vrious other tissues suh s lungs, spleen, liver nd kidney were olleted. One hlf of rin ws fixed in % PFA for histopthologil nlysis. Of remining rin tissue, ~ mg ws proessed for RNA extrtion. The remining rin tissues s well s other tissues were homogenized in PBS nd the homogentes were either plted on THA pltes for enumertion of teril olonies or used for quntittion of hemokine KC y ELISA. Peripherl polymorphoneutrophil depletion. PMN depletion ws indued y the intrperitonel dministrtion of µg of RB6 8C monolonl A (BD Biosienes) to 6 8 weeks old CD- mle mie h efore teril injetion. Control mie reeived equivlent mount of isotype ontrol A, rt IgG. The extent of PMN depletion ws determined y stining totl lood leukoytes with with Alex Fluor 67-lelled nti-cd nd FITC-lelled nti-ly6g ntiodies (oth t :) nd performing FACS t nd 8 h following injetion of RB6 8C or IgG. BBB permeility mesurement. BBB permeility ws determined y EB vsulr permeility s well s y lekge of FITC-lumin 8,9. h efore ethuniztion, µl of % EB ws injeted i.v.. After srifie, mie rins were homogenized in PBS, proteins were preipitted y 6% trihloroeti id, nd onentrtion of EB in the superntnts ws determined y mesuring sorne t 6 nm. EB dye permeility is expressed s µg of EB per g of rin tissue ginst stndrd urve. Alterntively, min efore srifie, mie were i.v. injeted with ml kg of FITC-lumin, nd rins were susequently nlysed y immunohistohemistry. Immunohistohemistry. GBS ws deteted in rin setions y stining with nti-gbs A (:) nd visulized using the Mouse on Mouse kit (Vetor ls) ontining iotinylted nti-mouse IgG in onjuntion with streptvidin-hrp. GBS ws lso deteted y stining rin setions with nti-mouse seondry A onjugted to AlexFluor 88. Blood vessels were lelled with Anti-lminin (:), nulei with To-Pro, nd the smples were viewed on onfol mirosope. Extrvstion of FITC lumin in the rins of mie ws deteted using n nti- FITC iotin onjugte (:) nd visulized y streptvidin onjugted to Alex Fluor 88. Sttistil nlysis. Grphpd Prism version. ws used for sttistil nlysis. Sttistil signifine ws epted t P <.. Referenes. Edwrds, M. S. & Bker, C. J. Group B Streptool Infetions (Sunders, ).. Dorn, K. S. & Nizet, V. Moleulr pthogenesis of neontl group B streptool infetion: no longer in its infny. Mol. Miroiol., ().. Dorn, K. S., Liu, G. Y. & Nizet, V. Group B streptool et-hemolysin/ ytolysin tivtes neutrophil signling pthwys in rin endothelium nd ontriutes to development of meningitis. J. Clin. Invest., 76 7 ().. Luer, P. et l. Genome nlysis revels pili in Group B Streptoous. Siene 9, ().. Brohi, M. A. et l. A pneumool pilus influenes virulene nd host inflmmtory responses. Pro. Ntl Ad. Si. USA, (6). 6. Mor, M. et l. Group A Streptoous produe pilus-like strutures ontining protetive ntigens nd Lnefield T ntigens. Pro. Ntl Ad. Si. USA, 6 66 (). 7. Kline, K. A., Dodson, K. W., Cpron, M. G. & Hultgren, S. J. A tle of two pili: ssemly nd funtion of pili in teri. Trends Miroiol. 8, (). 8. Misey, H. C., Hensler, M., Nizet, V. & Dorn, K. S. Group B streptool pilus proteins ontriute to dherene to nd invsion of rin mirovsulr endothelil ells. J. Bteriol. 89, 6 67 (7). 9. Mndlik, A., Swierzynski, A., Ds, A. & Ton-Tht, H. Coryneterium diphtherie employs speifi minor pilins to trget humn phryngel epithelil ells. Mol. Miroiol. 6, (7).. Nelson, A. L. et l. RrgA is pilus-ssoited dhesin in Streptoous pneumonie. Mol. Miroiol. 66, 9 (7). nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.

11 nture ommunitions DOI:.8/nomms7 ARTICLE. Rosini, R. et l. Identifition of novel genomi islnds oding for ntigeni piluslike strutures in Streptoous gltie. Mol. Miroiol. 6, 6 (6).. Nos, A. H. et l. Sortse A utilizes n nillry protein nhor for effiient ell wll nhoring of pili in Streptoous gltie. Infet. Immun. 76, 6 (8).. Mrgrit, I. et l. Preventing teril infetions with pilus-sed vines: the group B streptoous prdigm. J. Infet. Dis. 99, 8 (9).. Lemo, A. et l. Regultion of CovR expression in Group B Streptoous impts lood-rin rrier penetrtion. Mol. Miroiol. 77, ().. Bnerjee, A. et l. Ativtion of rin endothelium y pneumool neurminidse NnA promotes teril internliztion. Cell. Miroiol., (). 6. Brdley, P. P., Priet, D. A., Christensen, R. D. & Rothstein, G. Mesurement of utneous inflmmtion: estimtion of neutrophil ontent with n enzyme mrker. J. Invest. Dermtol. 78, 6 9 (98). 7. Izore, T. et l. Struturl sis of host ell reognition y the pilus dhesin from Streptoous pneumonie. Struture 8, 6 (). 8. Deivnygm, C. C. S. et l. Novel fold nd ssemly of the repetitive B region of the Stphyloous ureus ollgen-inding surfe protein. Struture 8, (). 9. Cruz, M. A., Yun, H., Lee, J. R., Wise, R. J. & Hndin, R. I. Intertion of the von Willernd ftor (vwf) with ollgen. J. Biol. Chem. 7, 8 87 (997).. Konto-Ghiorghi, Y. et l. Dul role for pilus in dherene to epithelil ells nd iofilm formtion in Streptoous gltie. PLoS Pthog., e (9).. Prsons, J. T. Fol dhesion kinse: the first ten yers. J. Cell. Si. 6, 9 6 ().. Merurio, A. M. Lessons from the lph integrin knokout mouse. Am. J. Pthol. 6, 6 ().. Pilorget, A. et l. Leetin, Mroviper leetin venom-derived C-type letin, inhiits ngiogenesis oth in vitro nd in vivo. J. Cell. Physiol., 7 (7).. Shin, S., Pul-Styseel, M., Lee, J. S., Romer, L. H. & Kim, K. S. Fol dhesion kinse is involved in type III group B streptool invsion of humn rin mirovsulr endothelil ells. Miro. Pthog., 68 7 (6).. Reddy, M. A., Wss, C. A., Kim, K. S., Shlepfer, D. D. & Prsdro, N. V. Involvement of fol dhesion kinse in Esherihi oli invsion of humn rin mirovsulr endothelil ells. Infet. Immun. 68, 6 6 (). 6. vn Sorge, N. M. et l. The group B streptool serine-rih repet glyoprotein medites penetrtion of the lood-rin rrier. J. Infet. Dis. 99, (9). 7. Dley, J. M., Thomy, A. A., Connolly, M. D., Reihner, J. S. & Alin, J. E. Use of Ly6G-speifi monolonl ntiody to deplete neutrophils in mie. J. Leuko. Biol. 8, 6 7 (8). 8. Ky, M. et l. Effets of lipopolyshride on the rdition-indued hnges in the lood-rin rrier nd the stroytes. Brin Res. 9, (). 9. Stmtovi, S. M. et l. Monoyte hemottrtnt protein- regultion of loodrin rrier permeility. J. Cere. Blood Flow Met., 9 66 ().. Betz, A. L. An overview of the multiple funtions of the Blood Brin Brrier. NIDA Res. Monogr., 7 (99).. Dorn, K. S. et l. Blood-rin rrier invsion y group B Streptoous depends upon proper ell-surfe nhoring of lipoteihoi id. J. Clin. Invest., 99 7 ().. Gutekunst, H., Eikmnns, B. J. & Reinsheid, D. J. The novel firinogeninding protein FsB promotes Streptoous gltie invsion into epithelil ells. Infet. Immun. 7, 9 ().. Tenenum, T. et l. Streptoous gltie invsion of humn rin mirovsulr endothelil ells is promoted y the lminin-inding protein Lm. Miroes Infet. 9, 7 7 (7).. Tzi, A. et l. The surfe protein HvgA medites group B streptoous hypervirulene nd meningel tropism in neontes. J. Exp. Med. 7, ().. Godly, G., Otto, G., Burdik, M. D., Strieter, R. M. & Svnorg, C. Fimril letins influene the hemokine repertoire in the urinry trt muos. Kidney Int. 7, (7). 6. Hilleringmnn, M. et l. Pneumool pili re omposed of protofilments exposing dhesive lusters of Rrg A. PLoS Pthog., e6 (8). 7. Kreikemeyer, B. et l. Streptoous pyogenes ollgen type I-inding Cp surfe protein. Expression profile, inding hrteristis, iologil funtion, nd potentil linil impt. J. Biol. Chem. 8, 8 9 (). 8. Dehio, M., Gomez-Durte, O. G., Dehio, C. & Meyer, T. F. Vitronetindependent invsion of epithelil ells y Neisseri gonorrhoee involves lph(v) integrin reeptors. FEBS Lett., 8 88 (998). 9. Agerer, F., Mihel, A., Ohlsen, K. & Huk, C. R. Integrin-medited invsion of Stphyloous ureus into humn ells requires Sr fmily protein-tyrosine kinses. J. Biol. Chem. 78, ().. Al-Okl, S., Chteny-Rivudy, C., Klein, J. P. & Whsmnn, D. Involvement of lphet integrins in interleukin 8 prodution indued y orl viridns streptool protein I/IIf in ultured endothelil ells. Cell. Miroiol., 7 68 (999).. Eitel, J., Heise, T., Thiesen, U. & Dersh, P. Cell invsion nd IL-8 prodution pthwys initited y YdA of Yersini pseudotuerulosis require ommon signlling moleules (FAK, -Sr, Rs) nd distint ell ftors. Cell. Miroiol. 7, 6 77 ().. Unkmeir, A. et l. Fironetin medites Op-dependent internliztion of Neisseri meningitidis in humn rin mirovsulr endothelil ells. Mol. Miroiol. 6, 9 96 ().. Sokolov, O. et l. Intertion of Neisseri meningitidis with humn rin mirovsulr endothelil ells: role of MAP- nd tyrosine kinses in invsion nd inflmmtory ytokine relese. Cell. Miroiol. 6, 66 ().. Bosmn, F. T. Integrins: ell dhesives nd modultors of ell funtion. Histohem. J., (99).. Tn, S., Tompkins, L. S. & Amiev, M. R. Helioter pylori usurps ell polrity to turn the ell surfe into replitive nihe. PLoS Pthog., e7 (9). 6. Sorini, M. et l. Group B Streptoous rosses humn epithelil ells y prellulr route. J. Infet. Dis. 9, (6). 7. Eston, A., Hque, A., Chu, K., Lukszewski, R. & Bnroft, G. J. A ritil role for neutrophils in resistne to experimentl infetion with Burkholderi pseudomllei. J. Infet. Dis. 9, 99 7 (7). 8. Leendertse, M. et l. Neutrophils re essentil for rpid lerne of Enteroous feium in mie. Infet. Immun. 77, 8 9 (9). 9. de Bont, E. S. et l. Tumor nerosis ftor-lph, interleukin- et, nd interleukin-6 plsm levels in neontl sepsis. Peditr. Res., 8 8 (99).. vn Fssen, H. et l. Neutrophils ply n importnt role in host resistne to respirtory infetion with Ainetoter umnnii in mie. Infet. Immun. 7, (7).. Mrks, M. et l. Influene of neutropeni on the ourse of serotype 8 pneumool pneumoni in mie. Infet. Immun. 7, (7).. Greshm, H. D. et l. Survivl of Stphyloous ureus inside neutrophils ontriutes to infetion. J. Immunol. 6, 7 7 ().. Mednik, A. J., Feldmesser, M., River, J. & Csdevll, A. Neutropeni lters lung ytokine prodution in mie nd redues their suseptiility to pulmonry ryptooosis. Eur. J. Immunol., 7 7 ().. Mione, D. et l. Identifition of universl Group B streptoous vine y multiple genome sreen. Siene 9, 8 ().. vn Sorge, N. M. et l. Anthrx toxins inhiit neutrophil signling pthwys in rin endothelium nd ontriute to the pthogenesis of meningitis. PLoS One, e96 (8). 6. Ssik, R., Clvo, E. & Coreil, J. Sttistil nlysis of high-density oligonuleotide rrys: multiplitive noise model. Bioinformtis 8, 6 6 (). 7. Vesterlund, S., Pltt, J., Krp, M. & Ouwehnd, A. C. Mesurement of teril dhesion-in vitro evlution of different methods. J. Miroiol. Methods 6, (). 8. Kwok, T. et l. Helioter exploits integrin for type IV seretion nd kinse tivtion. Nture 9, (7). 9. Feuer, R. et l. Coxskievirus B nd the neontl C: the roles of stem ells, developing neurons, nd poptosis in infetion, virl dissemintion, nd disese. Am. J. Pthol. 6, 79 9 (). Aknowledgements We re grteful to Kwng Sik Kim for providing hbmec, Ed Morgn for providing endotoxin, Dvid Shlepfer for providing the FAK onstruts nd Romn Ssik for ssistne with mirorry dt nlysis. We thnk Diretor Gry Hrdimn,for the mirorry nlysis, whih ws performed t the Biogem Core Fility of the University of Cliforni Sn Diego nd Diretor Nissi Vrki for histopthologi nlysis, whih ws performed, in prt, t the UCSD Core Fility. This work ws supported y the NIH/NIGMS SDSU MARC Progrm TGM8 -A, grnt R8 from the NIH/NINDS to R.F., AI67 from the NIH/NIAID to N.V.P. nd R7 from the NIH/NINDS to K.S.D. Author ontriutions A.B. nd K.S.D. designed experiments; B.J.K. nd E.M.C. ontriuted eqully to this work; A.B., B.J.K., E.M.C., A.S.C., M.A.G., nd C.C. performed experiementtion; N.V.P. nd R.F. provided regents nd experimentl dvie; A.B. nd K.S.D. wrote the mnusript; ll uthors disussed results nd provided feedk on the finl mnusript. Additionl informtion Aession odes: The mirorry dt hve een deposited in the EMBL nuleotide sequene dtse under ession ode E-MTAB-76. Supplementry Informtion ompnies this pper t ntureommunitions Competing finnil interests: The uthors delre no ompeting finnil interests. Reprints nd permission informtion is ville online t reprintsndpermissions/ How to ite this rtile: Bnerjee, A. et l. Bteril Pili exploit integrin mhinery to promote immune tivtion nd effiient lood-rin rrier penetrtion. Nt. Commun. :6 doi:.8/nomms7 (). Liense: This work is liensed under Cretive Commons Attriution-NonCommeril- Shre Alike. Unported Liense. To view opy of this liense, visit retiveommons.org/lienses/y-n-s/./ nture ommunitions :6 DOI:.8/nomms7 Mmilln Pulishers Limited. All rights reserved.