Supplementary information
|
|
- Erick Barrett
- 5 years ago
- Views:
Transcription
1 Supplementary information! Recurrent activating mutation in PRKACA in cortisol-producing adrenal tumors Gerald Goh, Ute I. Scholl, James M. Healy, Murim Choi, Manju L. Prasad, Carol Nelson- Williams, John W. Kunstman, Reju Korah, Anna-Carinna Suttorp, Dimo Dietrich, Matthias Haase, Holger S. Willenberg, Peter Stålberg, Per Hellman, Göran Åkerström, Peyman Björklund, Tobias Carling, Richard P. Lifton
2 Contents! Supplementary Table 1: ical features of patients with cortisol-producing adrenal tumors.... 3! Supplementary Table 2: Sequencing metrics for 25 tumor-normal pairs.... 7! Supplementary Table 3: Somatic protein-altering mutations in recurrently mutated genes.... 8! Supplementary Table 4: Somatic protein-altering mutations in PRKACA-mutant tumors ! Supplementary Table 5: Expression of PKA subunit genes in normal human adrenal gland ! Supplementary Table 6: Phosphorylated CREB in PRKACA-mutant and wildtype tumors ! Supplementary Table 7: Primer sequences ! Supplementary Figure 1: Overview of copy number variants in CNV+ tumors ! Supplementary Figure 2: Significant, focal CNVs in tumors ! Supplementary Figure 3: RNA-seq of a PRKACA-mutant tumor ! Supplementary Figure 4: Increased levels of pcreb in PRKACA-mutant tumors ! Supplementary Figure 5: Histology of PRKACA-mutant tumors ! Supplementary Figure 6: Model for cortisol-producing adrenal tumor formation due to gain of function mutation in PRKACA ! References... 20!! 2
3 Supplementary Table 1: ical features of patients with cortisol-producing adrenal tumors. Patient Pathology Cohort Paired WES PRKACA GNAS CTNNB1 CNV Gender Age UFC (ug/day) (pg/ml) CUSH1 ACA Dis Yes Yes L206R WT WT CNV- F * 7* N/A CS CUSH5 ACA Dis Yes Yes L206R WT WT CNV- F * <5* N/A CS CUSH28060 ACA Dis Yes Yes L206R WT WT CNV- F * 0.4* Positive CS CUSH14 ACA Dis Yes Yes WT Q227E WT CNV- F * <5* Positive CS CUSH1045 ACA Dis Yes Yes WT R201H WT CNV- F * <5* N/A CS CUSH20 ACA Dis Yes Yes WT WT WT CNV+ F * <5* N/A CS CUSH11 ACA Dis Yes Yes WT WT WT CNV+ F * <5* Positive CS CUSH12 ACC Dis Yes Yes WT WT WT CNV+ M * <5* Positive CS CUSH1678 ACA Dis Yes Yes WT WT WT CNV+ F * <5* N/A CS CUSH1037 ACC Dis Yes Yes WT WT T41A CNV+ F * <5* N/A CS CUSH22 ACA Dis Yes Yes WT WT D32G CNV- F * <5* N/A CS CUSH15 ACA Dis Yes Yes L206R WT WT CNV- F * <5* Positive SCS ical Diagnosis Associated Signs and Symptoms Typical clinical presentation DM, osteo DM, hir, bh, str, pmw, ecch, F, hair Diagnostic Criteria,,, Size (cm) Weiss score Ki <1% 30 4 <4% # 0-2% CUSH16 ACA Dis Yes Yes L206R WT WT CNV- F 79 N/A N/A Positive SCS 2 1 2% CUSH1735 ACA Dis Yes Yes L206R WT WT CNV- F 61 elevated* N/A Positive SCS 3 0 CUSH18 ACA Dis Yes Yes WT WT WT CNV- F 59 N/A N/A Positive SCS 3 0 CUSH19 ACA Dis Yes Yes WT WT WT CNV- F * N/A Positive SCS 5 1 CUSH24 ACA Dis Yes Yes WT WT WT CNV- F * <5* N/A SCS CUSH10 ACA Dis Yes Yes WT WT WT CNV- F * 6.9* N/A SCS ! 3
4 Patient Pathology Cohort Paired WES PRKACA GNAS CTNNB1 CNV Gender Age UFC (ug/day) (pg/ml) CUSH2 ACA Dis Yes Yes WT WT WT CNV- F * <5* N/A SCS CUSH9 ACA Dis Yes Yes WT WT WT CNV+ F * 6.8* Positive SCS ical Diagnosis Associated Signs and Symptoms CUSH95 ACC Dis Yes Yes WT WT WT CNV+ F 56 N/A N/A N/A SCS Wt, HTN Diagnostic Criteria Outpatient workup not available CUSH6 ACA Dis Yes Yes WT WT S45P CNV- M 77 N/A 11 Positive SCS, Scort 5 1 Size (cm) M Weiss score Ki67 CUSH1464 ACA Dis Yes Yes WT WT S45P CNV- F 66 elevated* N/A Positive SCS HTN, DM 6 1^ <3% CUSH1777 ACA Dis Yes Yes WT WT S45P CNV- F 44 N/A undetectable* Positive SCS HTN, emot CUSH23 ACA Dis Yes Yes WT WT S37C CNV+ F * <5* Normal SCS CUSH205 ACA Val Yes No L206R WT WT N/A F * <1.0* Positive CS CUSH104 ACA Val No No L206R WT WT N/A F * 4* N/A CS CUSH105 ACA Val No No L206R WT WT N/A F 42 elevated* <2* N/A CS CUSH106 ACA Val No No L206R WT WT N/A F * <5* N/A CS CUSH108 ACA Val No No L206R WT WT N/A F * <5* Positive CS CUSH111 ACA Val Yes No L206R WT WT N/A F 31 N/A <5* Positive CS str, mf DM, F DM, mf, pmw, amen, hair Wt, hir, mf, bh, acne Wt, hir, str, hair, F, ecch, skin, infx bh, pmw, F, emot, ecch, osteo CUSH211 ACA Val Yes No L206R WT WT N/A F * 1* N/A CS HTN, osteo CUSH203 ACA Val Yes No WT R201C WT N/A F * Positive CS CUSH206 ACA Val Yes No WT WT WT N/A F <1.0* Positive CS CUSH90854 ACA Val No No WT WT WT N/A F * <5* Positive CS DM, DM, hir, bh, str, pmw, ed Scort,, Scort,,,,, <1% ! 4
5 Patient Pathology Cohort Paired WES PRKACA GNAS CTNNB1 CNV Gender Age UFC (ug/day) (pg/ml) CUSH90856 ACC Val No No WT WT WT N/A F 18 elevated* decreased* N/A CS CUSH90873 ACA Val No No WT WT WT N/A F 54 N/A N/A N/A CS CUSH90876 ACC Val No No WT WT WT N/A M 50 N/A N/A N/A CS CUSH101 ACA Val No No WT WT WT N/A F * 3* Positive CS CUSH103 ACA Val No No WT WT WT N/A F * 2* N/A CS CUSH109 ACA Val Yes No WT WT WT N/A F * 2* Positive CS CUSH112 ACA Val Yes No WT WT WT N/A F * 2* N/A CS CUSH1654 ACC Val No Yes WT WT WT N/A F * 15 N/A CS CUSH1717 ACA Val No Yes WT WT WT N/A F * N/A N/A CS CUSH1754 ACA Val No Yes WT WT WT N/A F * undetectable* Positive CS CUSH47 ACC Val No Yes WT WT WT N/A F * <2* N/A CS CUSH58 ACC Val No Yes WT WT WT N/A F * <5* Positive CS CUSH210 ACA Val Yes No WT WT WT N/A F * <1.0* Positive CS CUSH21515 ACA Val No Yes WT WT S45Y N/A F * 2.6* Positive CS ical Diagnosis Associated Signs and Symptoms Wt, hir, str, amen, hair, acne, emot Wt, DM, hir, mf, hair Wt, DM, bh, ecch, skin DM, mf, bh, str, pmw, F hir, mf, bh, str, ed, amen, hair hir, mf, bh, pmw, F, ecch DM, hir, bh, mf, amen, skin, acne, ecchy mf, bh, emot, ecch Wt, F, emot, ecch hir, mf, bh, ecch, skin, infx hir, bh, hair, F, emot, skin pmw, F, Diagnostic Criteria loss of diurnal variation, Outpatient workup not available, Size (cm) # N/A Weiss score Ki <3% VS,,,, 6.5 0^ <3% ! 5
6 Patient Pathology Cohort Paired WES PRKACA GNAS CTNNB1 CNV Gender Age UFC (ug/day) (pg/ml) CUSH116 ACA Val Yes No WT WT S45P N/A F 49 elevated* decreased* Positive CS CUSH201 ACA Val Yes No WT WT WT N/A F 71 N/A 4* Positive SCS ical Diagnosis Associated Signs and Symptoms F, ecch, infx Diagnostic Criteria, CUSH202 ACA Val Yes No WT WT WT N/A F Positive SCS Wt, HTN CUSH204 ACA Val Yes No WT WT WT N/A F 68 N/A 4.6* Positive SCS CUSH207 ACA Val Yes No WT WT WT N/A F * N/A SCS pmw 2 0 Size (cm) # 4 0 N/A 1 Weiss score Ki67 CUSH209 ACA Val Yes No WT WT WT N/A F N/A Positive SCS Wt CUSH107 ACA Val No No WT WT WT N/A F * N/A N/A SCS DM CUSH113 ACA Val Yes No WT WT WT N/A F 55 N/A N/A N/A SCS Wt, HTN CUSH114 ACA Val Yes No WT WT WT N/A F 45 50* 2* N/A SCS CUSH115 ACA Val Yes No WT WT WT N/A F 58 elevated* 3* Positive SCS Wt, HTN CUSH117 ACA Val Yes No WT WT WT N/A M 44 N/A <2* N/A SCS HTN, emot VS Outpatient workup not available Scort, <1% # <1% CUSH119 ACA Val Yes No WT WT WT N/A M * 62 N/A SCS UFC <1% CUSH208 ACA Val Yes No WT WT S45P N/A F * <1.0* Normal SCS Wt, HTN CUSH1605 ACA Val No Yes WT WT S45P N/A M * 10 Normal SCS Wt UFC Scort, 3 0 WES, whole-exome sequencing; urinary free cortisol; ACA, adenoma; ACC, carcinoma; adrenocorticotropic hormone; Dis, discovery cohort; Val, validation cohort; WT, wildtype; N/A, not available; CS, Cushing Syndrome; SCS, Subclinical Cushing Syndrome; asterisks (*) represent test values outside the laboratory-specific normal range; represents 9 tumors with incomplete documentation in available medical records Associated signs and symptoms: Wt, recent weight gain; HTN, hypertension; DM, diabetes mellitus; hir, hirsutism; mf, moon facies, facial plethora; bh, buffalo hump; str, striae; pmw, proximal muscle weakness; ed, peripheral edema; amen, amenorrhea or menstrual abnormalities; hair, thinning of hair or alopecia; acne, increased acne; F, fatigue or weakness; emot, emotional lability or depression; ecch, Ecchymosis or easy bruisability; skin, thin skin; osteo, osteoporosis or osteopenia; infx, recurrent or difficult-to-treat infections.! 6
7 : Dexamethasone suppression test. Positive denotes failure to suppress serum cortisol following administration of dexamethasone. Patients were administered between a dexamethasone dose of 1 8 mg in the evening followed by AM measurement of serum cortisol; cortisol levels > 2.5ug/dL were considered pathologic ( positive ) 1. Diagnostic criteria: UFC denotes elevated urinary free cortisol; denotes suppressed ; Scort denotes elevated serum cortisol;, denotes positive dexamethasone suppression test; VS, adrenal venous sampling;, documented clinical symptoms suggestive of Cushing syndrome. Weiss score: # denotes a tumor with a preponderance of oncocytic cells. For these tumors, an alternative score based on Lin-Weiss-Bisceglia criteria 2, was used; ^ denotes uncertain malignant potential; M, metastatic.! 7
8 Supplementary Table 2: Sequencing metrics for 25 tumor-normal pairs. Normal Tumor Mean number of reads per sample (M) Median coverage (X) Mean coverage (X) % of reads that map to genome 91.4% 91.7% % of reads that map to target 66.0% 66.4% % of targeted bases with > 8 reads 95.0% 95.2% % of targeted bases with > 20 reads 89.0% 89.6% Mean error rate 0.7% 0.8% % PCR duplicates 5.4% 7.6%! 8
9 Supplementary Table 3: Somatic protein-altering mutations in recurrently mutated genes. Gene Patient Genome change (hg18) Tumor sample Normal sample Protein MutSig MutSig Ref. Non-ref. % Non-ref. Ref. Non-ref change p-value q-value allele allele allele allele allele PRKACA CUSH15 g.chr19: a>c p.l206r % E E-04 CUSH16 g.chr19: a>c p.l206r % 34 0 CUSH1 g.chr19: a>c p.l206r % 25 0 CUSH28060 g.chr19: a>c p.l206r % CUSH5 g.chr19: a>c p.l206r % 49 0 CUSH1735 g.chr19: a>c p.l206r % 68 0 CTNNB1 CUSH6 g.chr3: t>c p.s45p % E E+00 CUSH1464 g.chr3: t>c p.s45p % 61 0 CUSH1777 g.chr3: t>c p.s45p % 63 0 CUSH22 g.chr3: a>g p.d32g % 65 0 CUSH23* g.chr3: c>g p.s37c % 60 0 CUSH1037* g.chr3: a>g p.t41a % TP53 CUSH20* g.chr17: c>a p.r196l % E E+00 CUSH9* g.chr17: t>c p.m246v % 93 0 CUSH23* g.chr17: _ deltgagg p.p295fs % 98 0 RB1 CUSH9* g.chr13: g>a p.v654m % E E+00 CUSH1037* g.chr13: t>g p.l665r % USP6NL CUSH12* g.chr10: g>a p.a20v % E E+00 CUSH9* g.chr10: c>t p.r421k % 46 0 CUL2 CUSH20* g.chr10: g>a p.a121v % E E+00 CUSH9* g.chr10: c>t p.r165q % GNAS CUSH1045 g.chr20: g>a p.r201h % E E+00 CUSH14 g.chr20: c>g p.q227e % *, CNV+ tumor! 9
10 Supplementary Table 4: Somatic protein-altering mutations in PRKACA-mutant tumors. Patient CUSH15 CUSH16 CUSH1 CUSH28060 CUSH5 CUSH1735 Gene Genome change (hg18) Protein change Ref. allele Tumor sample Non-ref. allele % Non-ref. allele Normal sample Ref. allele PRKACA g.chr19: a>c p.l206r % 41 0 DMBT1 g.chr10: t>c p.s338p % FAM193B g.chr5: a>c p.v744g % HSD17B12 g.chr11: a>c p.t207_splice % PRKACA g.chr19: a>c p.l206r % 34 0 GLP2R g.chr17: c>a p.p91t % GLP2R g.chr17: t>c p.s92p % CHAF1B g.chr21: t>g p.v95g % 59 1 NEO1 g.chr15: c>g p.p979a % 75 0 PRKACA g.chr19: a>c p.l206r % 25 0 HYDIN g.chr16: a>c p.v2150g % PRKACA g.chr19: a>c p.l206r % MAP3K4 g.chr6: g>a p.r1007h % MUC16 g.chr19: g>c p.t13896r % ACER3 g.chr11: a>g p.t238a % APPL1 g.chr3: a>g p.q117r % BBS7 g.chr4: a>c p.f379v % CDH13 g.chr16: a>g p.i38v % EIF3B g.chr7: t>g p.s465a % ITSN2 g.chr2: c>a p.a1578s % Non-ref allele NHS g.chrx: g>t p.v350f % NINL g.chr20: g>c p.l1308v % STAT6 g.chr12: a>c p.l93r % THOC2 g.chrx: a>g p.i93t % PRKACA g.chr19: a>c p.l206r % 49 0 C10orf90 g.chr10: a>t p.l339i % 37 0 DCLRE1C g.chr10: t>c p.n448d % 98 0 LAMC1 g.chr1: t>c p.s272p % MTRF1 g.chr13: g>a p.q24* % 77 1 PRKACA g.chr19: a>c p.l206r % 68 0 CTTNBP2 g.chr7: g>a p.h1657y % MMS22L g.chr6: c>g p.g900r % PROKR2 g.chr20: g>a p.r248w % 59 0! 10
11 Supplementary Table 5: Expression of PKA subunit genes in normal human adrenal gland. Gene Subunit FPKM PRKACA Cα PRKACB Cβ 7.27 PRKACG Cγ PRKAR1A R1α PRKAR1B R1β PRKAR2A R2α 4.79 PRKAR2B R2β 2.36 FPKM, fragments per kilobase of exon per million reads! 11
12 Supplementary Table 6: Phosphorylated CREB in PRKACA-mutant and wildtype tumors. PRKACA-mutant Wildtype Number of tumors assessed 8 5 % of nuclei positive for phosphorylated CREB Median Mean S.D Wildtype, tumors without mutations in PRKACA, CTNNB1 or GNAS.! 12
13 Supplementary Table 7: Primer sequences. Primer name CTNNB1_S45_F CTNNB1_S45_R GNAS_R201_F GNAS_R201_R GNAS_Q227_F GNAS_Q227_R PRKACA_L205_R PRKACA_L205_R! Primer sequence 5'-GCTGATTTGATGGAGTTGGAC-3' 5'-CAGGACTTGGGAGGTATCCA-3' 5'-ACTATGTGCCGAGCGATCA-3' 5'-CAGTTGGCTTACTGGAAGTTGA-3' 5'-ACCCCAGTCCCTCTGGAATA-3' 5'-CCAAAGAGAGCAAAGCCAAG-3' 5'-TTGTAGCCCTGGAGCAAGAT-3' 5'-GCCCACAGGTGACAGACTTC-3'! 13
14 Supplementary Figure 1: Overview of copy number variants in CNV-positive tumors. Frequency of gains (red) and losses (blue) plotted across genome.! 14
15 Supplementary Figure 2: Significant, focal CNVs in tumors. Left, deletions in blue. Right, amplifications in red. The green line signifies the threshold for significance, q = 0.25.! 15
16 Supplementary Figure 3: RNA-seq of a PRKACA-mutant tumor. Both wild-type (A) and mutant (C) alleles are detected in the tumor, as shown in the position highlighted.! 16
17 Supplementary Figure 4: Increased levels of phosphorylated CREB in PRKACAmutant tumors. Representative images of PRKACA-mutant tumor and wildtype tumor (no mutation in PRKACA, CTNNB1 or GNAS) stained for CREB phosphorylated at Ser133. Intense nuclear-specific staining is observed in majority of the nuclei in (a) the mutant tumor, but not in (b) the wildtype tumor. Scale bars represent 60 µm.!! 17
18 Supplementary Figure 5: Histology of PRKACA-mutant tumors.!! All tumors reviewed with PRKACA (n = 6) mutations were well-defined, solitary adrenal cortical nodules with well-differentiated morphology. The majority of these tumors had low-grade nuclei (5/6), and none of the tumors showed fibrosis, necrosis, mitosis and hemorrhage, consistent with benign adenomas. (a) 2.6-cm cortisol secreting adrenal cortical adenoma showing a bright yellow and brown cut surface that corresponds to its cellular composition as shown in b. The ruler is in centimeters and millimeters. (b) The tumor is comprised of lipid-rich clear cells (filled arrow) and oncocytic cells (open arrow) with granular eosinophilic cytoplasm. The scale bar represents 60 µm.! 18
19 Supplementary Figure 6: Model for cortisol-producing adrenal tumor formation due to gain-of-function mutation in PRKACA.! (a) In quiescent adrenal fasciculata cells, protein kinase A exists as an inactive tetramer, with the catalytic subunits bound to a dimer of regulatory subunits. (b) binds to its receptor, melanocortin receptor 2, which stimulates adenylyl cyclase via Gα s, leading to an increase in intracellular camp levels. camp binds to the regulatory subunits, causing the release of the catalytic subunits and downstream signaling, which leads to cell proliferation and cortisol production. (c) The mutant catalytic subunits are not bound by the regulatory subunit, and are thus constitutively active in the absence of external stimuli. The resulting uncontrolled cell proliferation and cortisol production lead to the formation of a cortisol-producing adrenal tumor. MC 2, melanocortin receptor 2; AC, adenylyl cyclase; R, regulatory subunit; C, catalytic subunit.!! 19
20 References 1. Nieman, L.K. et al. The diagnosis of Cushing's syndrome: an Endocrine Society ical Practice Guideline. J Endocrinol Metab 93, (2008). 2. Duregon, E. et al. Oncocytic adrenocortical tumors: diagnostic algorithm and mitochondrial DNA profile in 27 cases. Am J Surg Pathol 35, (2011).!! 20
The Adrenal Glands. I. Normal adrenal gland A. Gross & microscopic B. Hormone synthesis, regulation & measurement. II.
The Adrenal Glands Thomas Jacobs, M.D. Diane Hamele-Bena, M.D. I. Normal adrenal gland A. Gross & microscopic B. Hormone synthesis, regulation & measurement II. Hypoadrenalism III. Hyperadrenalism; Adrenal
More information27 F with new onset hypertension and weight gain. Rajesh Jain Endorama 10/01/2015
27 F with new onset hypertension and weight gain Rajesh Jain Endorama 10/01/2015 HPI 27 F with hypertension x 1 year BP 130-140/90 while on amlodipine 5 mg daily She also reports weight gain, 7 LB, mainly
More informationApproach to Adrenal Incidentaloma. Alice Y.Y. Cheng, MD, FRCP
Approach to Adrenal Incidentaloma Alice Y.Y. Cheng, MD, FRCP Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored, or transmitted in any form
More informationCarney complex with PRKAR1A mutation: A case report
Carney complex with PRKAR1A mutation: A case report Anil Satyaraddi, Aaron Chapla, Sahana Shetty, and Nihal Thomas Department of Endocrinology, Diabetes & Metabolism, Christian Medical College, Vellore,
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationMILD HYPERCORTISOLISM DUE TO ADRENAL ADENOMA: IS IT REALLY SUBCLINICAL?
MILD HYPERCORTISOLISM DUE TO ADRENAL ADENOMA: IS IT REALLY SUBCLINICAL? Alice C. Levine, MD Professor of Medicine Division of Endocrinology, Diabetes and Bone Diseases Georgia-AACE 2017 Annual Meeting
More informationWhat s New in Adrenal Gland Pathology. Marina Scarpelli
What s New in Adrenal Gland Pathology Marina Scarpelli Background Histological criteria for adrenocortical proliferative lesions Immunohistochemical markers Molecular markers Histological Criteria for
More informationActivating mutations in CTNNB1 in aldosterone producing adenomas
Activating mutations in CTNNB1 in aldosterone producing adenomas Tobias Åkerström 1, Rajani Maharjan 1, Holger Sven Willenberg 2, Kenko Cupisti 3, Julian Ip 4, Ana Moser 5, Peter Stålberg 1, Bruce Robinson
More informationSubclinical Cushing s Syndrome
Subclinical Cushing s Syndrome AACE 26th Annual Scientific & Clinical Congress Associate Clinical Professor of Medicine and Clinical Chief University of Miami Miller Scholl of Medicine Miami, Florida aayala2@miami.edu
More informationCushing s Syndrome. Diagnosis. GuidelineCentral.com. Key Points. Diagnosis
Cushing s Syndrome Consultant: Endocrine Society of Cushing s Syndrome Clinical Practice Guideline Writing Committee Key Points GuidelineCentral.com Key Points The most common cause of Cushing s syndrome
More informationSupplementary Table 2. Identified causative mutations and/or mutation candidates.
Supplementary Table 2. Identified causative mutations and/or mutation candidates. Nonsense mutations base change aa change Average depth Result of next generation in 432 patient Hereditary form of the
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationCase Based Urology Learning Program
Case Based Urology Learning Program Resident s Corner: UROLOGY Case Number 4 CBULP 2010 004 Case Based Urology Learning Program Editor: Associate Editors: Manager: Case Contributors: Steven C. Campbell,
More informationENDOCRINOLOGY 3. R. A. Benacka, MD, PhD, prof. Department of Pathophysiology Medical faculty, Safarik University, Košice
Academic lectures for general medicine 3rd year 2005/2006, 2013/2014 ENDOCRINOLOGY 3 R. A. Benacka, MD, PhD, prof. Department of Pathophysiology Medical faculty, Safarik University, Košice Figures and
More informationG3.02 The malignant potential of the neoplasm should be recorded. CG3.02a
G3.02 The malignant potential of the neoplasm should be recorded. CG3.02a Conventional adrenocortical neoplasm. Each of the below parameters is scored 0 when absent and 1 when present. 3 or more of these
More informationOctober 13, Surgical Nuances to Managing Cushing s Disease. Cortisol Regulation. Cushing s Syndrome Excess Cortisol. Sandeep Kunwar, M.D.
Surgical Nuances to Managing Cushing s Disease Cortisol Regulation Sandeep Kunwar, M.D. Surgical Director, California Center for Pituitary Disorders Associate Clinical Professor, University of California,
More informationRECURRENT ADRENAL DISEASE. Megan Applewhite Endorama 2/19/2015 SR , SC
RECURRENT ADRENAL DISEASE Megan Applewhite Endorama 2/19/2015 SR 2412318, SC 3421561 Category: Adrenal Attendings: Angelos & Grogan PATIENT #1 36yo woman with a hx of Cushing s Syndrome and right adrenalectomy
More informationNature Genetics: doi: /ng Supplementary Figure 1. Clinical timeline for the discovery WES cases.
Supplementary Figure 1 Clinical timeline for the discovery WES cases. This illustrates the timeline of the disease events during the clinical course of each patient s disease, further indicating the available
More informationWhole Exome Sequenced Characteristics
Supplementary Tables Supplementary Table 1: Patient characteristics of 45 whole exome sequenced HNSCC tumors Whole Exome Sequenced Characteristics Tumors (n=45) Age, years Median (range) 61.0 (19-90) Sex,
More informationHow to Recognize Adrenal Disease
How to Recognize Adrenal Disease CME Away India & Sri Lanka March 23 - April 7, 2018 Richard A. Bebb MD, ABIM, FRCPC Consultant Endocrinologist Medical Subspecialty Institute Cleveland Clinic Abu Dhabi
More informationof TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationEndocrine Topic Review. Sethanant Sethakarun, MD
Endocrine Topic Review Sethanant Sethakarun, MD Definition Cushing's syndrome comprises a large group of signs and symptoms that reflect prolonged and in appropriately high exposure of tissue to glucocorticoids
More informationMineralocorticoids: aldosterone Angiotensin II/renin regulation by sympathetic tone; High potassium will stimulate and ACTH Increase in aldosterone
Disease of the Adrenals 1 Zona Glomerulosa Mineralocorticoids: aldosterone Angiotensin II/renin regulation by sympathetic tone; High potassium will stimulate and ACTH Increase in aldosterone leads to salt
More informationThe Management of adrenal incidentaloma
The Management of adrenal incidentaloma Dimitrios Linos, MD Director of Surgery, Hygeia Hospital, Athens, Greece Consultant in Surgery, Massachusetts General Hospital, Boston, USA 8 th Postgraduate Course
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationEndogenous Cushing s syndrome: The Philippine general hospital experience
ORIGINAL ARTICLE Endogenous Cushing s syndrome: The Philippine general hospital experience Tom Edward N. Lo, Joyce M. Cabradilla, Sue Ann Lim, Cecilia A. Jimeno Section of Endocrinology and Metabolism,
More informationTHE HIGHS AND LOWS OF ADRENAL GLAND PATHOLOGY
THE HIGHS AND LOWS OF ADRENAL GLAND PATHOLOGY Symptoms of Adrenal Gland Disorders 2 Depends on whether it is making too much or too little hormone And on what you Google! Symptoms include obesity, skin
More informationC h a p t e r 3 8 Cushing s Syndrome : Current Concepts in Diagnosis and Management
C h a p t e r 3 8 Cushing s Syndrome : Current Concepts in Diagnosis and Management Padma S Menon Professor of Endocrinology, Seth G S Medical College & KEM Hospital, Mumbai A clinical syndrome resulting
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationEndocrine MR. Jan 30, 2015 Michael LaFata, MD
Endocrine MR Jan 30, 2015 Michael LaFata, MD Brief case 55-year-old female in ED PMH: HTN, DM2, HLD, GERD CC: Epigastric/LUQ abdominal pain, N/V x2 days AF, HR 103, BP 155/85, room air CMP: Na 133, K 3.6,
More informationAVS and IPSS: The Basics and the Pearls William F. Young, Jr., MD, MSc Professor of Medicine Mayo Clinic College of Medicine Rochester, MN, USA
AVS and IPSS: The Basics and the Pearls William F. Young, Jr., MD, MSc Professor of Medicine Mayo Clinic College of Medicine Rochester, MN, USA 2016 Mayo Foundation for Medical Education and Research.
More informationCUSHING SYNDROME Dr. Muhammad Sarfraz
Indep Rev Jul-Dec 2018;20(7-12) CUSHING SYNDROME Dr. Muhammad Sarfraz IR-655 Abstract: It is defined as clinical condition in which there are increased free circulating glucocorticoides casused by excessive
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationDifferential Diagnosis of Cushing s Syndrome
Differential Diagnosis of Cushing s Syndrome Cushing s the Diagnostic Challenge Julia Kharlip, MD and Caitlin White, MD Endocrinology, Diabetes and Metabolism Perelman School of Medicine at the University
More informationMy personal experience at University of Toronto and recent updates of
My personal experience at University of Toronto and recent updates of Endocrine Pathology Toshitetsu Hayashi M.D. Ph.D. ¹Department of Diagnostic Pathology, Takamatsu Red Cross Hospital, Japan ²Laboratory
More information57-year-old man with anxiety, diaphoresis, fatigue and bilateral adrenal nodules. Celeste Thomas November 1, 2012
57-year-old man with anxiety, diaphoresis, fatigue and bilateral adrenal nodules Celeste Thomas November 1, 2012 History of Present Illness 8 months prior to presentation developed intermittent right flank
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationAdrenocortical Oncocytoma
The Korean Journal of Pathology 2007; 41: 329-33 Adrenocortical Oncocytoma - A Case Report - Hun-Soo Kim Dae-Young Kang 1 Department of Pathology, Wonkwang University School of Medicine, Iksan; 1 Department
More informationPlasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
More informationAdrenal Mass. Cynthia Kwong SUNY Downstate Medical Center Grand Rounds October 13, 2016
Adrenal Mass Cynthia Kwong SUNY Downstate Medical Center Grand Rounds October 13, 2016 Case Presentation 65F found to have a 4cm left adrenal mass in 2012 now presents with 6.7cm left adrenal mass PMHx:
More informationCellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
More informationunderlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
More informationNature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
More informationCUSHING S SYNDROME. Chapter 8. Case: A 43-year-old man with delusions
Chapter 8 CUSHING S SYNDROME Case: A 43-year-old man with delusions A previously healthy 43-year-old man is brought to the emergency department for evaluation of confusion. The patient has complained to
More informationESUR 2018, Sept. 13 th.-16 th., 2018 Barcelona, Spain
ESUR 2018, Sept. 13 th.-16 th., 2018 Barcelona, Spain OUR APPROACH Incidental adrenal nodule/mass Isaac R Francis, M.B;B.S University of Michigan, Ann Arbor, Michigan Disclosures None (in memory) M Korobkin,
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationWhere in the adrenal cortex is cortisol produced? How do glucocorticoids inhibit prostaglandin production?
CASE 35 A 36-year-old woman presents to her gynecologist with complaints of amenorrhea and hirsutism. She has also noticed an increase in her weight (especially in the trunk region) and easy fatigability.
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationAdrenal incidentaloma guideline for Northern Endocrine Network
Adrenal incidentaloma guideline for Northern Endocrine Network Definition of adrenal incidentaloma Adrenal mass detected on an imaging study done for indications that are not related to an adrenal problem
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationIndications for Surgical Removal of Adrenal Glands
The adrenal glands are orange-colored endocrine glands which are located on the top of both kidneys. The adrenal glands are triangular shaped and measure about one-half inch in height and 3 inches in length.
More informationWhat causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite)
Oncogenes What causes cancer? Chemical factors (carcinogens) Physical factors (radiation, ionization) Biological factors (virus, bacteria, parasite) DNA Mutation or damage Oncogenes Tumor suppressor genes
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationPHSI3009 Frontiers in Cellular Physiology 2017
Overview of PHSI3009 L2 Cell membrane and Principles of cell communication L3 Signalling via G protein-coupled receptor L4 Calcium Signalling L5 Signalling via Growth Factors L6 Signalling via small G-protein
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationCortisol levels. Naturally produced by the adrenal Cortisol
1 + 2 Cortisol levels asleep awake Naturally produced by the adrenal Cortisol Man made tablets, injections, creams & inhalers Cortisone Hydrocortisone Prednisone Prednisolone Betamethasone Methylprednisolone
More informationFGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
More informationDiseases of the Adrenal gland
Diseases of the Adrenal gland Adrenal insufficiency Cushing disease vs syndrome Pheochromocytoma Hyperaldostronism What are the layers of the adrenal gland?? And what does each layer produce?? What are
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationA novel PRKAR1A mutation resulting in a splicing variant in a case of Carney complex
LETTER TO THE EDITOR Korean J Intern Med 2015;30:730-734 novel PRKR1 mutation resulting in a splicing variant in a case of arney complex Yi Sun Jang, Sung Dae Moon, Ju Hee Kim, Ihn Suk Lee, Jong Min Lee,
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationPituitary Adenomas: Evaluation and Management. Fawn M. Wolf, MD 10/27/17
Pituitary Adenomas: Evaluation and Management Fawn M. Wolf, MD 10/27/17 Over 18,000 pituitaries examined at autopsy: -10.6% contained adenomas (1.5-27%) -Frequency similar for men and women and across
More informationPathology of pituitary gland. By: Shifaa Qa qa
Pathology of pituitary gland By: Shifaa Qa qa Sella turcica Adenohypophysis (80%): - epithelial cells - acidophil, basophil, chromophobe - Somatotrophs, Mammosomatotrophs, Corticotrophs, Thyrotrophs, Gonadotrophs
More informationLecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
More informationCell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule
Cell Communication Cell Communication Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the ligand binds (may be on the plasma membrane or within
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationoncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
More informationNature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.
Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read
More informationDiagnostic Testing in Cushing's Syndrome: Reassessment of 17-hydroxycorticosteroid and 17-ketosteroid Measurements
CRTCAL REVEW [ K e i t h D u n c a n, M. D. March, 1985 Diagnostic Testing in Cushing's Syndrome: Reassessment of 17-hydroxycorticosteroid and 17-ketosteroid Measurements ntroduction The measurement of
More informationBrain Tumors. Andrew J. Fabiano, MD FAANS. Associate Professor of Neurosurgery Roswell Park Cancer Institute SUNY at Buffalo School of Medicine
Brain Tumors Andrew J. Fabiano, MD FAANS Associate Professor of Neurosurgery Roswell Park Cancer Institute SUNY at Buffalo School of Medicine Brain Tumors Brain Tumor Basics Types of Tumors Cases Brain
More informationAdrenocorticotropic Hormone-Independent Cushing Syndrome with Bilateral Cortisol-Secreting Adenomas
Case Report Endocrinol Metab 2013;28:133-137 http://dx.doi.org/10.3803/enm.2013.28.2.133 pissn 2093-596X eissn 2093-5978 Adrenocorticotropic Hormone-Independent Cushing Syndrome with Bilateral Cortisol-Secreting
More informationPharmacology of Corticosteroids
Pharmacology of Corticosteroids Dr. Aliah Alshanwani Dept. of Pharmacology College of Medicine, KSU Feb 2018 1 The Corticosteroids are steroid hormones produced by the adrenal cortex. They consist of two
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationMembrane associated receptor transfers the information. Second messengers relay information
Membrane associated receptor transfers the information Most signals are polar and large Few of the signals are nonpolar Receptors are intrinsic membrane proteins Extracellular and intracellular domains
More informationThe Pathological l Basis of Disease
Endocrine Diseases The Pathological l Basis of Disease - Graduate Course CMM5001 Qiao Li, MD, PhD Faculty of Medicine University of Ottawa qiaoli@uottawa.ca Outline Endocrine System Adrenal Gland Anatomy
More informationDIAGNOSTIC SLIDE SEMINAR: PART 1 RENAL TUMOUR BIOPSY CASES
DIAGNOSTIC SLIDE SEMINAR: PART 1 RENAL TUMOUR BIOPSY CASES Dr. Andrew J. Evans MD, PhD, FACP, FRCPC Consultant in Genitourinary Pathology University Health Network, Toronto, ON Case 1 43 year-old female,
More informationGeneral Principles of Endocrine Physiology
General Principles of Endocrine Physiology By Dr. Isabel S.S. Hwang Department of Physiology Faculty of Medicine University of Hong Kong The major human endocrine glands Endocrine glands and hormones
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More information3/27/2017. Pulmonary Pathology Specialty Conference. Disclosure of Relevant Financial Relationships. Clinical History:
Pulmonary Pathology Specialty Conference Saul Suster, M.D. Medical College of Wisconsin Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position
More informationAdrenal Disorders for the USMLE, Step One: Abnormalities of the Fasciculata: Hypercortisolism
Adrenal Disorders for the USMLE, Step One: Abnormalities of the Fasciculata: Hypercortisolism Howard Sachs, MD Patients Course, 2017 Associate Professor of Clinical Medicine UMass Medical School Adrenal
More informationArt labeling Activity: Figure 16.1
ANP 1105D Winter 2013 Assignment 6 part I: The Endocrine Sy... Assignment 6 part I: The Endocrine System, Chapter 16 Due: 11:59pm on Monday, March 4, 2013 Note: To understand how points are awarded, read
More informationMolecular Subtyping of Endometrial Cancer: A ProMisE ing Change
Molecular Subtyping of Endometrial Cancer: A ProMisE ing Change Charles Matthew Quick, M.D. Associate Professor of Pathology Director of Gynecologic Pathology University of Arkansas for Medical Sciences
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationCOPYRIGHTED MATERIAL. Adrenal Imaging. 1.1 Introduction. Khaled M. Elsayes 1, Isaac R. Francis 1, Melvyn Korobkin 1 and Gerard M.
1 Adrenal Imaging Khaled M. Elsayes 1, Isaac R. Francis 1, Melvyn Korobkin 1 and Gerard M. Doherty 2 1 Department of Radiology, University of Michigan 2 Department of Radiology and Surgery, University
More informationC) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1.
706-2000-Exam 4 Answer Key 1) The question asks you to explain peaks A and B in the top graph. The other two graphs were there to give you hints. The question did not ask for these other two graphs to
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationAdrenal venous sampling as used in a patient with primary pigmented nodular adrenocortical disease
Original Article on Translational Imaging in Cancer Patient Care Adrenal venous sampling as used in a patient with primary pigmented nodular adrenocortical disease Xiaoxin Peng 1, Yintao Yu 1, Yi Ding
More informationSupplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
More informationADRENAL INCIDENTALOMA. Jamii St. Julien
ADRENAL INCIDENTALOMA Jamii St. Julien Outline Definition Differential Evaluation Treatment Follow up Questions Case Definition The phenomenon of detecting an otherwise unsuspected adrenal mass on radiologic
More informationDr Rodney Itaki Lecturer Anatomical Pathology Discipline. University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology
Neoplasia Dr Rodney Itaki Lecturer Anatomical Pathology Discipline University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology General Considerations Overview: Neoplasia uncontrolled,
More informationCASE REPORT. Abstract. Introduction. Case Reports
CASE REPORT Two Rare Cases of Familial (Mother and Daughter) Adrenocorticotropic Hormone-independent Cushing s Syndrome due to Adrenal Adenoma, as well as the Asynchronous Development of Another Contralateral
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More information