Cancer Biology Products
|
|
|
- Millicent Simon
- 5 years ago
- Views:
Transcription
1
2 Cancer Biology Products Rev Apoptosis Cell adhesion ζ/δ ζ/δ Akt β-catenin ASK-1 Cutaneous Lymphocyte-associated Antigen (CLA) Dystroglycan-Phosphorylated (Tyr893) EMMPRIN (Neurothelin, CD147) BAP37 Endoglin (CD105) Bax Bcl-2 Galectin 3 BRCA1 gpibα (CD42b) Caspase-3 gpiib (CD41) Caspase-8 Hermes (CD44, Pgp-1) Caspase-9 ICAM-1/CD54 Cytochrome c ICAM-2/CD102 c-myc ICAM-3/CD50 Daxx ILK-1 DcR1 (TRAIL-R3, CD263) Integrin α2/cd49b DcR2 (TRAIL-R4, CD264) Integrin α4/cd49d DcR3 Integrin α5/cd49e DR3 (TRAMP) Integrin α6/cd49f DR4 (TRAIL-R1, CD261) Integrin αl/cd11a DR5 (TRAIL-R2, CD262) Integrin αm/cd11b Integrin αv/cd51 Fas (CD95) Integrin αv/β3 (CD51/61) Fas-L (CD178) Integrin αx/cd11c Fas-L (CD178.1) Integrin β1/cd29 Lyn Integrin β1-phosph. (Tyr783) Mcl-1 Integrin β1-phosph. (Tyr795) NOD2 Integrin β2/cd18 p53 Integrin β3/cd61 p53 - Acetylated (Lys305) Integrin β4 /CD104 p53 - Acetylated (Lys382) MAdCAM-1 p53-phosphorylated (Ser392) NCAM/CD56 PARC (H7AP1) p130 Cas PARP Panendothelial Cell Antigen PD-1 Paxillin PTEN Paxillin - Phosphorylated (Tyr31) PYK2 Paxillin - Phosphorylated (Tyr118) Rb (Retinoblastoma 1) PECAM-1/CD31 Survivin PNAd Survivin (Thr34) L-Selectin/CD62L p63 ( N) P-Selectin/CD62P p63 (TA) Siglec-2/CD22 TACC3 c-src TWEAK (CD255) Src Phosphorylated (Tyr419) TWEAK receptor (Fn14, CD266) VCAM-1/CD106 Caspase 2L MMP9 Page 1
3 Cell Cycle APC1 Prohibitin APC2 Rad17 - Phosphorylated (Ser645) APC3 Rb APC5 RCC1 APC6 SKP1A APC7 SOCS2 APC8 Stathmin/Op18 Phosphorylated (Ser16) APC10 TACC3 APC11 TPX2 ASK1 p97/vcp Cdk2 Cdk4 Aurora A (Aurora 2) Cyclin B1 Aurora A (Aurora 2) phosph, (Thr288) Aurora A (Aurora 2, AIK) phosph, (Ser 66) Cell Motility/Cytoskeleton BRCA1 β-actin α-adducin -Phosphorylated (Ser167/Thr170) α-adducin (Thr445) cdc2 (p34) Cytokeratin (pan reactive) Cdc6 Cytokeratin 7/17 Cdc25A-Phosphorylated (Ser17) Cytokeratin 18 Cdc25C Cytokeratin 19 Cdk7 (CAK) Centrin 2 (Caltractin) Lamin A Ch-TOG Map4 - Phosphorylated (Ser768) Chk2 Microtubule Associated Protein 2ab (MAP2ab) Cyclin E Myosin heavy chain p130 Cas p27kip1 Fanconi anemia D2-Phosphorylated (Ser222) PI3K p110 delta Eg5 PRC-1 Eg5-Phosphorylated (Thr927) PTEN Fbx5 α-tubulin c-fos γ-tubulin Galectin 3 VASP c-jun MAD2 Chromatin Remodeling/ MCM2 Acetylation & Deacetylation MCM3 Acetylated lysine MCM4 CBP MCM5 GCN5 MCM6 H2A.X MCM7 H2A.X-phosphorylated (Ser139) mtor HDAC1 c-myc HDAC2 Ninein HDAC3 p21 (CDKN1A) HDAC4 p27kip1 Histone H2A p53 Histone H3 p53 - Acetylated (Lys305) Histone H4 p53 - Acetylated (Lys382) HMG14 p63 ( N) HMG17 p63 (TA) Nucleolin-phosphorylated (Thr76/Thr84) PCNA Spt16 (FACT140 complex) PKA (catalytic domain) SSRP1 PLK-1 PLK-1 - Phosphorylated (Thr210) PRC1 Page 2
4 DNA Repair/Replication Artemis BRCA1 -Phosphorylated (Ser167/Thr170) CHOP (GADD153) Elongin B Elongin C Fanconi anemia D2-Phosphorylated (Ser222) H2A.X H2A.X-Phosphorylated (Ser139) Ku80 MCM2 MCM3 MCM4 MCM5 MCM6 MCM7 NBS1 p53 p53-acetylated (Lys305) p53-acetylated (Lys382) PARP PCNA Rad17 - Phosphorylated (Ser645) SMC1L1/SMC1 SSRP1 SUMO I Topo I Topo II α Topo II β SIRT1 Growth Factors/Growth Factor Receptors EGFR FGFR1 FGFR2 VEGF Mitochondria Metabolism JNK1 BAP37 SIK2 Cytochrome c Cytochrome p450-2b6 (CYP2B6) Prohibitin UCP2 UCP4 Protein Kinase/Phosphatase Akt ASK1 Aurora A (Aurora 2) Aurora A (Aurora 2) phosph, (Thr288) Aurora A (Aurora 2, AIK) phosph, (Ser 66) -Phosphorylated (Ser167/Thr170) CAMKII-Phosphorylated (Thr286) Cdc2 (p34) Cdc6 Cdc25A-Phosphorylated (Ser17) Cdc25C Chk2 ERK2 Fyn GCN2 GSK-3β ILK-1 JAK1 Lck Lyn Map-4-Phosphorylated (Ser768) MKK6 NEK-9 p38 MAPK p90 Rsk PERK-Phosph, (Thr980) Phosphotyrosine PI3K p110 delta PKA (catalytic domain) PKC PLK-1 PLK-1 - Phosphorylated (Thr210) PTEN PYK2 B-Raf (Thr598/Ser601) SLP76 c-src Src Phosphorylated (Tyr419) Syk TIF1β ZAP-70 SIK2 Page 3
5 Protein Synthesis eif-2α SOCS6 elf-2γ c-src eif-4e Src Phosphorylated (Tyr419) PERK-Phosph, (Thr980) STAT 1 STAT 2 Signaling/Signaling Intermediates STAT ζ/δ STAT 4 Akt STAT 5b ASB1 STAT 6 ASK1 TRIM VASP Aurora A (Aurora 2, AIK) WSB2 Aurora A (Aurora 2, AIK) phosph, (Ser 66) ZAP-70 Aurora A (Aurora 2, AIK) phosph, (Thr288) Steroid Receptors/Nuclear Receptors -Phosphorylated (Ser167/Thr170) CPF CaMKII-Phosphorylated (Thr286) NCOA1/SRC1 cdc2 (p34) NCOA2/GRIP1 Cdc6 NCOA3/SRC3 Cdc25A-Phosphorylated (Ser17) PXR Cdc25c RARα Chk2 RARα (Ser369) DNA-Pkcs DNA-Pkcs Phosphorylated (Thr2609) Transcriptional Regulators eif3/p116 BAP37 ERK2 C/EBP β CBP Fyn CHOP (GADD153) GAPDH CPF GPR83 (GPR72, GIR) GSK-3β ILK-1 Elongin B JAK1 Elongin C LAT c-fos Lck FOXD3 Lyn FOXP3 Map4 - Phosphorylated (Ser768) GATA 3 MKK6 GCN5 mtor HDAC1 NEK9 HDAC2 NTAL HDAC3 p90 Rsk HDAC4 p130 Cas Histone H3 Phosphotyrosine Histone H4 PI3K p110 delta HMG14 PKA (catalytic domain) HMG17 PLK-1 hnrnp D PLK-1 - Phosph, (Thr210) hnrnp K-Acetlyated (Lys219) PYK2 IκB-α RAPTOR c-jun Shc Ku (Ku-70/Ku-80) SIT Ku80 SLP-76 c-myc SOCS2 Nanog SOCS3 NCOA2/GRIP1 Page 4
6 Transcriptional Regulators (continued) Ubiquitin Conjugation/Degradation NCOA3/SRC3 APC1 NF-κB p50 APC2 NF-κB p65 APC3 NPM/B23-Phospho. (Thr199) APC5 NPM/B23-Phospho. (Thr234/Thr237) APC6 Nucleolin-Phosphorylated (Thr76/Thr84) APC7 Oct4 (Oct-4, POU5F1) APC8 p53 APC10 p53 - Acetylated (Lys305) APC11 p53 - Acetylated (Lys382) ASB1 p63 ( N) BRCA1 p63 (TA) Elongin B p300 Elongin C PARP Fbx5 Pol II/CTD PARC (H7AP1) Prohibitin SKP1A PTBP1 SUMO I PXR Cbl RARα RARα (Ser369) Control Cell Lysate Rb FOXP3 cell lysate (mouse) RORγt FOXP3 cell lysate (human) RXRα (Ser61) SKP1A Other/Miscellaneous SOX2 Adiponectin Sp1 CRP (C-reactive protein) Sp3 Neurofilament heavy protein (NF-H) Spt16 (FACT140 complex) Neurofilament medium protein (NF-M) SSRP1 NOTCH 1 STAT 1 Perforin STAT 2 RANK (CD265) STAT 3 RANKL (TRANCE, CD254) STAT 4 TREM-1 STAT 5b FLIC (Flagellin) STAT 6 SUMO I T-bet TAF250 TIF1β Topo I Topo II α Topo II β Xbp-1 (COOH terminus) RIG-1 Page 5
Cell Biology. Cell Biology. biolegend.com 455
14-3-3 ε 460 14-3-3 ζ 460 14-3-3 ζ/δ 460 Acetylated Lysine 460 β-actin 461 α-adducin 461 Adiponectin 462 AIP1 462 Akt 462 Akt Phosphorylated (Ser473) 463 Alix 463 AMPKα 463 Annexin V 464 APC1 464 APC2
blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific
Supplementary figure legends Figure 1: Selective expression of regulatory markers on CD4 + LAP + T cells. Human peripheral blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and
Supplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
Signaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
Phosphorylation Site Company Cat #
Supplemental Table 1. Antibodies used for RPPA analysis. Label Protein Phosphorylation Site Company Cat # Used on MDA_CLSS Used on MDA_Pilot 4EBP1 4EBP1 Cell Signaling 9452 No 4EBP1.pS65 4EBP1 S65 Cell
Rino Ragno Rome Center for Molecular Design Department of Chemistry and Phamaceutical Technology Faculty of Pharmacy and Medicine
Rino Ragno Rome Center for Molecular Design Department of Chemistry and Phamaceutical Technology Faculty of Pharmacy and Medicine HDAC Inhibitors: Structure-Based Modeling and Isoform-Selectivity Prediction
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
PATHOGEN INNOCUOUS ANTIGEN. No Danger- very low expression of costimulatory ligands Signal One Only
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv illai AICD Naive Activated Effector Memory Activated Effector Naive AICD Activated
Therapeutic Resistance to HER2 Targeted Therapies. Neil Spector, M.D Duke Cancer Institute Duke University Medical Center
Therapeutic Resistance to HER2 Targeted Therapies Neil Spector, M.D Duke Cancer Institute Duke University Medical Center Relevant Financial Disclosures Millennium/Takeda Pharmaceuticals (consultant, sponsored
LANCE and LANCE Ultra TR-FRET Technology Product List
LANCE and LANCE Ultra TR-FRET Technology Product List ORDERING INFORMATION Please refer to the following for ordering LANCE TR-FRET and LANCE Ultra TR-FRET products. LANCE TR-FRET and LANCE Ultra TR-FRET
CENTRAL LABORATORY SERVICES
CENTRAL LABORATORY SERVICES Bridging the Gaps in Biomarker Development and Testing for Global Clinical Trials Biomarkers, Digital Pathology & the Central Lab Presentation Title Presenter Name July 16,
Signal Transduction Pathway Smorgasbord
Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.
Cell Structure & Function Antibodies and Reagents
Cell Structure & Function Antibodies and Reagents BioLegend is ISO 13485:2003 Certified Toll-Free Tel: (US & Canada): 1.877.BIOLEGEND (246.5343) Tel: 858.768.5800 02-0012-02 World-Class Quality Superior
Bio-Plex Pro Cell Signaling Assays
Acute Phase Response Cancer Cardiovascular Disease Diabetes Cytokines, Chemokines, Growth Factors Immunology/Inflammation Immunoglobulin Isotyping Cell Signaling Toxicology Bio-Plex Pro Cell Signaling
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science
Yong Wu, Ph.D. Division of Cancer Research and Training (DCRT) Charles R. Drew University of Medicine & Science Jay Vadgama, Ph.D Chief, Division of Cancer Research and Training Background One in 8 women
Supplementary figures
Supplementary figures Supplementary Figure 1 A WT -/- Percentage(%).6.4.2 Peripheral blood Cell number(1 6 ) 4 3 2 1 MLN Cell number(1 7 ) 1 8 6 4 2 Spleen Supplementary Figure 1 No baseline value differences
Apoptosis Oncogenes. Srbová Martina
Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation
BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points)
Name: BIO360 Quiz #1 September 14, 2012 1. Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) 2. The controversial hypothesis that only a small subset
OncoMir Library Cancer Type Target Gene
OncoMir Library Cancer Type Target Gene hsa-let-7a-1 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-2 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-3 Breast Cancer, Lung
Lecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers
Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
The Role of Protein Domains in Cell Signaling
The Role of Protein Domains in Cell Signaling Growth Factors RTK Ras Shc PLCPLC-γ P P P P P P GDP Ras GTP PTB CH P Sos Raf SH2 SH2 PI(3)K SH3 SH3 MEK Grb2 MAPK Phosphotyrosine binding domains: PTB and
Carfilzomib for PTCL. Julie M. Vose, M.D., M.B.A. University of Nebraska Medical Center
Carfilzomib for PTCL Julie M. Vose, M.D., M.B.A. University of Nebraska Medical Center jmvose@unmc.edu A spectrum of mutations observed in AITL target NF-κB pathway GEP: Enrichment of NF-κB Pathway in
2. Appendix Tables legend General Legend applicable for Table S1 to S4 (Page 10)
Appendix Data The hvps- signalling module counteracts inhibition of the PIK-Akt pathway to maintain mtorc activity and tumour growth Ruzica Bago, Eeva Sommer, Pau Castel, Claire Crafter, Fiona P. Bailey,
T cell and Cell-mediated immunity
T cell and Cell-mediated immunity Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, it School of Medicine i Medical Research Building B815-819 Email: Lu.Linrong@gmail.com
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM
CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CD43: the molecule and its signaling capacities favors a Th1 differentiation pattern and contributes
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis
Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis induction in bladder transitional-cell papilloma RT4 cells: Evidence for a regulatory loop between
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm)
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm) Class I Class II HDAC1 HDAC2 HDAC3 HDAC8 HDAC4 HDAC5 HDAC6 HDAC7 HDAC9 HDAC10 4.5 12.6 9.1 79.8 13.2 11.4
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
T cell and Cell-mediated immunity
T cell and Cell-mediated immunity ( 第十章 第十二章第十二章 ) Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, School of Medicine Medical Research Building B815-819
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Prof. R. V. Skibbens. Cell Cycle, Cell Division and Cancer (Part 2)
Prof. R. V. Skibbens November 22, 2010 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality - clocks go in only one direction G1 doesn t have replication-inducing
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
Oncogenes and Tumor. supressors
Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene
Timing Matters in T Cell Differentiation
Virtual PI Meeting April 2012 000 p1 001 101 p3 p2 011 100 111 110 Timing Matters in T Cell Differentiation Natasa Miskov-Zivanov University of Pittsburgh 010 Acknowledgements 2 Faeder Lab: Department
Phospholipase C γ Prof. Graham Carpenter
Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular
Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28
A 4OHT Dox hraf iip tumors inras ddh 2 O -RT Ink/Arf / Pten l/ l R26-lsl-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF V6E Ink/Arf / Pten / R26-rtTA Tyr-reERT2 TetO-hRAF
Karyotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl
Chapt. 18 Cancer Molecular Biology of Cancer Student Learning Outcomes: Describe cancer diseases in which cells no longer respond Describe how cancers come from genomic mutations (inherited or somatic)
Computational Biology I LSM5191
Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture 6 Notes: Control Systems in Gene Expression Pulling it all together: coordinated control of transcriptional regulatory molecules Simple Control:
Signal transduction of smooth muscle contraction. Smooth muscle contraction. p p. active. MLC 20 MBS PP1 δ M21. active. active. inactive PKC.
International Corporation life. science. discovery. International Corporation Kinase Assay Kits { Kinase Detection and Inhibitor Screening Assay Kits Signal transduction of smooth muscle contraction Smooth
PI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program:
PI3K Background The phosphatidylinositol 3-kinase (PI3K) pathway is a key cell signaling node whose dysregulation commonly results in the transformation of normal cells into cancer cells. The role of PI3K
Response and resistance to BRAF inhibitors in melanoma
Response and resistance to BRAF inhibitors in melanoma Keith T. Flaherty, M.D. Massachusetts General Hospital Cancer Center Disclosures Roche/Genentech: consultant GlaxoSmithKline: consultant BRAF mutations
Biol403 MAP kinase signalling
Biol403 MAP kinase signalling The mitogen activated protein kinase (MAPK) pathway is a signalling cascade activated by a diverse range of effectors. The cascade regulates many cellular activities including
EGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes
1st Electronic Conference on Molecular Science EGF receptor transactivation is crucial for cholinergic MAP kinase signaling in human keratinocytes Wymke Ockenga, Sina Kühne, Antje Banning and Ritva Tikkanen
Lecture 1, Fall 2014 The structure of the eukaryotic cell, as it relates to cells chemical and biological functions.
Lecture 1, Fall 2014 The structure of the eukaryotic cell, as it relates to cells chemical and biological functions. There are several important themes that transcends just the chemistry and bring the
Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018
Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations
Supplementary information S1 (table): Specifications of individual protein protein interactions within the Cbl and Cbl-b interactomes
Supplementary information S1 (table): Specifications of individual protein protein interactions within the Cbl and Cbl-b interactomes Cbl/Cbl-b binding protein Cbl domain/residue Binding protein domain/residue
I. Top scoring maps. 1.IFN gamma signaling
I. Top scoring maps 1.IFN gamma signaling Interferon-gamma signaling Interferons (IFNs) are pleiotropic cytokines that mediate anti-viral responses, inhibit proliferation and participate in immune surveillance
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras
Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module 6 Cell Division, Cell Cycle, Cell Growth and Differentiation, Programmed Cell Death
G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl
P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis
Genomic and transcriptomic landscapes of acute promyelocy3c leukemia Kankan Wang
Genomic and transcriptomic landscapes of acute promyelocy3c leukemia Kankan Wang State Key Laboratory of Medical Genomics Rui-Jin Hospital Shanghai Jiaotong University School of Medicine Understanding
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
Post-translational modifications of proteins in gene regulation under hypoxic conditions
203 Review Article Post-translational modifications of proteins in gene regulation under hypoxic conditions 1, 2) Olga S. Safronova 1) Department of Cellular Physiological Chemistry, Tokyo Medical and
Peng Zhang 1, Michelle Yueqin Chen 1, Diana Caridha 1, William J. Smith 2 & Peter K. Chiang 1
Peng Zhang 1, Michelle Yueqin Chen 1, Diana Caridha 1, William J. Smith 2 & Peter K. Chiang 1 1 Walter Reed Army Institute of Research, 2 United States Army Medical Research Institute of Chemical Defense
Molecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
Deregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
Molecular Cell Biology Spring 2014, Michael Pavlov To read: relevant parts from chapters 20 and 25.
Molecular Cell Biology Spring 2014, Michael Pavlov To read: relevant parts from chapters 20 and 25. Lecture 10: Initiation of the Cell Cycle and its aberrations. Cip/Kip and Ink4 brake the cell cycle Inhibition
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
p53 and Apoptosis: Master Guardian and Executioner Part 2
p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy
IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of
Preface IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of plant lectins on lymphocyte activation were studied back in the 1960s, the modern era began
Compound Screening Libraries
MedChem Express Compound Screening Libraries Optimized for drug screening and new indication research Bioactive Compound Library FDA-Approved Drug Library Anti-Cancer Compound Library Kinase Inhibitor
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Cell cycle control (mammalian)
Apr. 21, 2005 Cell cycle control (mammalian) Basic mechanisms & protein components Checkpoints Chap. 21, by Lodish et al., 5 th ed. 2004 Chap. 17, by Alberts et al., 4 th ed. 2002 鍾明怡 mychung@vghtpe.gov.tw
Cell Cycle Regulation. Adrian R. Black
Cell Cycle Regulation Adrian R. Black 845-3090 Adrian.black@roswellpark.org Loss of Growth Control Block of Apoptosis Evasion of Senescence Angiogenesis Invasion hases of the cell cycle Mitosis: Chromosome
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
Basic tumor nomenclature
Jonas Nilsson jonas.a.nilsson@surgery.gu.se Sahlgrenska Cancer Center Bilder gjorda av Per Holmfeldt och Jonas Nilsson Benign tumor Basic tumor nomenclature Malignant tumor = cancer Metastasis Carcinoma:
Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research
Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6
Signal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 )
Signal transduction and protein kinase inhibitors Feng Qian ( 钱峰 ) fengqian@sjtu.edu.cn Protein Kinases in the Human Genome 518 kinases 1.7 % of human genome Lipid kinases Nucleotide kinases Cell Signaling
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
The Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
Cell Cyc Cell Cy l c e
Mechanisms of Cell Proliferation 1 Cell Cycle G 2 S G 1 2 Multi-cellular organisms depend on cell division/proliferation; Each organism has a developmental plan that determines its behavior and properties;
IUPHAR Nomenclature Report: The Class Frizzled
supplemental material IUPHAR Nomenclature Report: The Class Frizzled receptors Gunnar Schulte Section of Receptor Biology & Signaling, Dept. Physiology & Pharmacology, Karolinska Institutet, S-171 77 Stockholm,
Phospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
The elements of G protein-coupled receptor systems
The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch
Two projects. Innate immunity, human gene6cs and resistance to infec6on. HAMLET; a new type of tumor- killing molecular complex
Two projects Innate immunity, human gene6cs and resistance to infec6on HAMLET; a new type of tumor- killing molecular complex Innate immune signaling Toxins d Capsule Metabolic genes Metalbinding proteins
VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Chapter 6: Cancer Pathways. Other Pathways. Cancer Pathways
Chapter 6: Cancer Pathways Limited number of pathways control proliferation and differentiation Transmit signals from growth factors, hormones, cell-to-cell communications/interactions Pathways turn into
Core Immunohistochemical Stains revised
AKT1 Akt1/PKBa Epitomics 1085-1 Akt1/PKBa AKT-pS473 (ps473) Epitomics 2118-1 1:600(H),, 1:1000(M) 1:400(H),, 1:200(M) A Ser/Thr protein kinase whose activity plays a key role in various cellular functions,
Targeted Proteomics (RPPA) as a Discovery Platform for Cancer and Other Applications
Targeted Proteomics (RPPA) as a Discovery Platform for Cancer and Other Applications Shixia Huang, Ph.D. Director, Antibody-based Proteomics Core Advance Technology & Analytics Seminar Series April 9 th,
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
MAPK Pathway
MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth
THE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells
Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,
Chapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
Cell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
Supplemental text file, including:
Supplemental text file, including: Supplemental Table S1: Kinase profile for XL147 Supplemental Table S2: Effects of XL147 on PI3K Pathway Signaling in MCF7 and PC-3 Cells Supplemental Table S3: XL147
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
MARCH 2001 VOLUME 14, NUMBER 3. Copyright 2001 by the American Chemical Society. p53 Signaling and Cell Cycle Checkpoints
MARCH 2001 VOLUME 14, NUMBER 3 Copyright 2001 by the American Chemical Society Invited Review p53 Signaling and Cell Cycle Checkpoints Zoe A. Stewart and Jennifer A. Pietenpol* Department of Biochemistry,
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.