Pituitary Tumor Transforming Gene is a Novel Anti2apoptotic Gene in UV2induced Apoptosis

Transcription

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology (3) : ( PTTG1) UV,,, 3 (,, ) ( PTTG1).,PTTG1. PTTG1. PTTG1, PTTG1 UV., RNAi2 HeLa PTTG1 UV, PTTG1 UV.,UV PTTG1,.,PTTG1 UV. PTTG1. ; ; (PTTG1) Q ; Q69113 Pituitary Tumor Transforming Gene is a Novel Anti2apoptotic Gene in UV2induced Apoptosis LAI Yong2Qing, ZHU Xu2Hui, NA Yan2Qun, XIN Dian2Qi 3 ( Department of Urology, Peking University First Hospital, Institute of Urology, Peking University, Beijing , China) Abstract Pituitary tumor transforming gene ( PTTG1) is widely detected in many tumors. Increasing evidences reveal that PTTG1 is associated with cell proliferation, cellular transformation and apoptosis. However, the functions of PTTG1 remain largely unclear, especially its role in DNA damage2induced apoptosis. We used UV irradiation to induce apoptosis in HeLa cells to examine the role of PTTG1 in UV2 induced apoptosis. RNAi2mediated knockdown of PTTG1 expression in cells lead to hypersensitivity to UV2 induced apoptosis, whereas over expression of PTTG1 decreased the UV2induced apoptosis, suggesting that PTTG1 acts as an anti2apoptotic factor in UV2induced apoptosis. Furthermore, similar to many other anti2 apoptotic genes, the expression of PTTG1 in protein levels decreased upon UV irradiation of cells. Our results may provide important information for understanding the role of PTTG1 in UV2induced apoptosis and tumorigenesis. Key words UV ; apoptosis ; pituitary tumor transforming gene 1 ( pituitary tumor transforming gene, PTTG1), securin, [1 ]. PTTG1 cdna 203, PTTG1, [2 ]., PTTG1 [3 6 ].,PTTG1.,PTTG1,, [1, 7, 8 ]. PTTG1, : [1, 9 13 ].,PTTG1 : , : (No ) 3 Tel : (010) ,E2mail : com Received : September 2,2007 ;Accepted : November 6,2007 Supported by National Natural Science Foundation of China (No ) 3 Corresponding author Tel : (010) , E2mail : com

2 [14, 15 ]., PTTG1 [16, 17 ]., PTTG1 NIH 3T3 293,.,PTTG1. PTTG1.,PTTG1, c2myc [18 ]., PTTG1, bfgf VEGF,, PTTG1 [19 ]. PTTG1 DNA. PTTG1., PTTG1 HeLa UV, PTTG1 UV.,HeLa PTTG1 UV,., PTTG1 UV DNA. PTTG HeLa ATCC. JM109. p GEMT2T Easy vector Promega ; Lipofectamine 2000 RNAi BLOCK2iT TM Inducible H1 RNAi Entry Vector Kit Invitrogen ; pires22 EGFP ApoAlert apoptosis kits BD Biosciences Clontech,Qiaquick Gel Extraction System RNeasy kit Qiagen,Wizard Plus SV Minipreps DNA Purification System Promega,BCA Protein Assay Kit PIERCE. T4 DNA T4 DNA NEB. Super Taq DNA. DNA marker. MBI Fermentas. DMEM Invitrogen.. PTTG1 Santa Cruz PTTG1 RNAi Invitrogen BLOCK2iT TM Inducible H1 RNAi Entry Vector Kit PTTG1 RNAi. pentr TM ΠH1ΠTO entry vector, DNA : Top strand oligo :5 2CACCGTCCTCTAG ACTTTGAGAGTTTCAAGAGAACTCTCAAAGTCTAGAGG ATTTTTTGGAA23 lower sterand oligo :5 2AAAATTC CAAAAAATCCTCTAGACTTTGAGAGTTCTCTTGAAACT CTCAAAGTCTAGAGGAC23. RNAi. pentr RNAi. 113 pires22pttg1 PTTG1 PCR HeLa cdna. : : 5 2AGAATGGCTACTCT GATCTATG23 : 5 2CACAAACTCTGAAGCACT AAG23. :94 3 min,94 30 s,50 45 s,72 60 s,33. PCR p GEM2 Teasy Vector, EcoR, pires2,. pires22pttg HeLa 10 % DMEM, 37,5 % CO 2. UV, 100 mm, 24 h, UV (model UVC2500 ; Hoefer),, UV. 10 ml,37,5 % CO PTTG1 RNAi HeLaΠP2T Lipofectamine 2000 pcdna TM 6ΠTR HeLa, 4 gπml blasticidin. Lipofectamine 2000 pentr TM ΠH1ΠTO RNAi pcdna TM 6ΠTR HeLa, 50 gπml zeocin. 2, 2 gπml blasticidin 25 gπml zeocin DMEM, HeLaΠP2T. 116 PTTG1 HeLaΠpIRES2 PTTG1 PTTG1 HeLa,

3 3 : ( PTTG1) UV 233 Lipofectamine 2000 pires22pttg1 pires22egfp HeLa, 600 gπml G418 DMEM. pires22pttg1 pires22egfp, 300 gπml G418 DMEM, HeLaΠpIRES2 PTTG1 HeLaΠvector. 117 Western, 50 g, Western, PTTG1 ( ). ( ) , UV,, PBS 2, ( PI) annexin 2PI, 488 nm PTTG1 UV PTTG1 RNAi, Western PTTG1. Fig. 1A, 1 gπml 24 h,helaπp2t PTTG1. UV DNA,, UV, PTTG1 DNA. PTTG1 UV, FACS UV HeLa HeLaΠP2T. 2 2 :1, 1 1 gπml 24 h. 200 JΠm 2 UV2C, (0 48 h),. UV ( 1 % 3 %). Fig. 1B, 1 gπml HeLaΠP2T UV, 3 ( 3 )., annexin.. Fig. 1C :1 gπml HeLaΠP2T UV, 3. UV 24 h, HeLaΠP2T 48 %, 3 33 % ( 3 ). PTTG1 UV. Fig. 1 The apoptotic response of HeLa and HeLaΠP2T cell lines to UV irradiation (A) Proteins expression level of PTTG1 in cell lines HeLa and HeLaΠP2T determined with Western blot. The first groups of 2 cell types were incubated in normal DMEM media and another group of HeLaΠP2T cell was incubated in DMEM with 1 gπml tetracycline for 24 hours ; (B,C) The apoptotic response of HeLa and HeLaΠP2T cell lines to UV irradiation. These two cell lines ( HeLa and HeLaΠP2T) were divided into 2 subpopulations, one incubated in normal DMEM, the other in DMEM with 1 gπml tetracycline for 24 hours. After UV irradiation (200 JΠm 2 ), cells were reincubated in their corresponding media. Apoptotic fractions were determined by flow cytometry at the indicated times. (B) The percentages of apoptotic cells were analyzed by flow cytometry after following UV irradiation at 0, 12, 24, 36 and 48 hours. ( C) The percentage of apoptotic cells was analyzed by flow cytometry after UV irradiation either immediately (0 hour) or 24 hours later, then annexin stained cells, and data are presented as means SEMof three independent experiments 212 PTTG1 UV2 PTTG1 UV2, PTTG1 HeLa UV., PTTG1 UV. PTTG1, Western HeLaΠpIRES2 PTTG1 HeLaΠvector PTTG1 ( pires2 ). Fig. 2A, HeLa, HeLaΠpIRES2 PTTG1 PTTG1

4 234 24, HeLaΠvector. PTTG1 UV, FACS HeLa HeLaΠp IRES2 PTTG1 HeLaΠvector UV JΠm 2 UV2C. (0 48 h),. ( 1 % 3 %). Fig. 2B, HeLaΠ pires2 PTTG1 UV, 2 ( )., annexin. Fig. 2C, HeLaΠ pires2 PTTG1 UV 2. UV 24 h, 19 % HeLaΠpIRES2 PTTG1, 2 32 % ( )., PTTG1 UV. Fig. 2 The apoptotic response of HeLa, HeLaΠVecror and HeLaΠpIRES2 PTTG1 cell lines to UV irradiation (A) Proteins expression level of PTTG1 in cell lines HeLa, HeLaΠVecror and HeLaΠpIRES2 PTTG1 determined with western blot. All of 3 cell lines were incubated in normal DMEM media. (B,C) The apoptotic response of HeLa, HeLaΠVecror and HeLaΠP2T cell lines to UV irradiation. Cell lines were UV challenged ( 200 JΠm 2 ) and reincubated in DMEM. ( B ) Apoptotic fractions were determined by flow cytometry at the indicated times. ( C) The percentage of apoptotic cells was analyzed by flow cytometry after UV irradiation at either immediately 0 hour or 24 hours later, then Annexin stained cells, and data are presented as means SEM of three independent experiments 213 UV PTTG1,PTTG1 HeLa UV., UV PTTG1. Western UV HeLa PTTG1. Fig. 3A,Western,UV PTTG1,., 400 JΠm 2 HeLa,, Western PTTG1, UV PTTG1, UV 015 h PTTG1 ( Fig. 3B). 3 RNAi PTTG1 UV HeLa, PTTG1 HeLa UV ; PTTG1 UV HeLa, PTTG1 UV ;, Western UV HeLa PTTG1.,UV PTTG1,. :PTTG1. PTTG1 p53, p53 DNA, p53 [20 ]. :p53. P53., PTTG1 p53.,,, Rb. Rb,. Rb TNF [21 ].,Rb caspase, Rb., PTTG1 UV, Romero [22 ], PTTG1. :1) UV PTTG1?,?,? 2) p53 PTTG1,??

5 3 : ( PTTG1) UV 235 Fig. 3 The effect of UV irradiation on PTTG1 expression (A) After exposure to UV irradiation of different doses, the cells were reincubated in DMEM media for 12 hours and expression of PTTG1 was examined with Western blot. (B) HeLa cells were exposed to UV irradiation at the dose of 400 JΠm 2, then reincubated in DMEM. They were harvested at the indicated times to determine the expression of PTTG1 protein PTTG1. ( References) [ 1 ] Zhang X,Horwitz G A, Prezant T R, et al. Structure, expression, and function of human pituitary tumor2transforming gene ( PTTG) [J ]. Mol Endocrinol, 1999, 13 (1) : [ 2 ] Kakar S S, Jennes L. Molecular cloning and characterization of the tumor transforming gene ( TUTR1 ) : a novel gene in human tumorigenesis [J ]. Cytogenet Cell Genet, 1999, 84 (324) : [ 3 ] Zou H, McGarry T J,Bernal T, et al. Identification of a vertebrate sister2chromatid separation inhibitor involved in transformation and tumorigenesis [J ]. Science, 1999, 285 (5426) : [ 4 ] Yu R, Ren S G, Horwitz G A, et al. Pituitary tumor transforming gene (PTTG) regulates placental J EG23 cell division and survival : evidence from live cell imaging [J ]. Mol Endocrinol, 2000, 14 (8) : [ 5 ] Jallepalli P V, Waizenegger I C, Bunz F, et al. Securin is required for chromosomal stability in human cells [J ]. Cell, 2001,105 (4) : [ 6 ] Wang Z, Yu R, Melmed S. Mice lacking pituitary tumor transforming gene show testicular and splenic hypoplasia, thymic hyperplasia, thrombocytopenia, aberrant cell cycle progression, and premature centromere division [J ]. Mol Endocrinol, 2001,15(11) : [ 7 ] Pei L, Melmed,S, Isolation and characterization of a pituitary tumor2 transforming gene (PTTG) [J ]. Mol Endocrinol, 1997, 11(4) : [ 8 ] Dominguez A,Ramos2Morales F, Romero F, et al. hpttg, a human homologue of rat pttg, is overexpressed in hematopoietic neoplasms. Evidence for a transcriptional activation function of hpttg [ J ]. Oncogene, 1998,17 (17) : [ 9 ] Zhang X, Horwitz G A, Heaney A P, et al. Pituitary tumor transforming gene ( PTTG) expression in pituitary adenomas [J ]. J Clin Endocrinol Metab, 1999, 84(2) : [10 ] Saez C,Japon M A,Ramos2Morales F, et al. hpttg is over2expressed in pituitary adenomas and other primary epithelial neoplasias [J ]. Oncogene, 1999,18(39) : [11 ] Heaney A P, Singson R, McCabe CJ, et al. Expression of pituitary2 tumour transforming gene in colorectal tumours [J ]. Lancet, 2000, 355(9205) : [12 ] Shibata Y, Haruki N, Kuwabara Y, et al. Expression of PTTG (pituitary tumor transforming gene) in esophageal cancer [J ]. Jpn J Clin Oncol, 2002, 32(7) : [13 ] Tfelt2Hansen J, Yano S, Bandyopadhyay S, et al. Expression of pituitary tumor transforming gene ( PTTG) and its binding protein in human astrocytes and astrocytoma cells : function and regulation of PTTG in U87 astrocytoma cells [J ]. Endocrinology, 2004,145 (9) : [14 ] Solbach C, Roller M,Fellbaum C, et al. PTTG mrna expression in primary breast cancer : a prognostic marker for lymph node invasion and tumor recurrence [J ]. Breast, 2004, 13 (1) :80281 [15 ] Ogbagabriel S, Fernando M, Waldman F M, et al. Securin is overexpressed in breast cancer [J ]. Mod Pathol, 2005, 18(7) : [16 ] Boelaert K, McCabe C J, Tannahill L A, et al. Pituitary tumor transforming gene and fibroblast growth factor22 expression : potential prognostic indicators in differentiated thyroid cancer [ J ]. J Clin Endocrinol Metab, 2003, 88(5) : [17 ] Saez C, Martinez2Brocca M A, Castilla C, et al. Prognostic significance of human pituitary tumor2transforming gene immunohistochemical expression in differentiated thyroid cancer [J ]. J Clin Endocrinol Metab, 2006, 91 (4) : [18 ] Pei L. Identification of c2myc as a down2stream target for pituitary tumor2transforming gene [J ]. J Biol Chem, 2001,276 (11) : 84842

6 [19 ] McCabe C J, Khaira J S,Boelaert K, et al. Expression of pituitary tumour transforming gene ( PTTG) and fibroblast growth factor22 ( FGF22 ) in human pituitary adenomas : relationships to clinical tumour behaviour [J ]. Clin Endocrinol (Oxf), 2003, 58 (2) : [20 ] Bernal J A,Luna R.,Espina A, et al. Human securin interacts with p53 and modulates p532mediated transcriptional activity and apoptosis [J ]. Nat Genet, 2002, 32(2) : [21 ] Jovine L,Qi H, Williams Z, et al. The ZP domain is a conserved module for polymerization of extracellular proteins [ J ]. Nat Cell Biol, 2002, 4(6) : [22 ] Romero F,Gil2Bernabe A M, Saez C, et al. Securin is a target of the UV response pathway in mammalian cells [J ]. Mol Cell Biol, 2004, 24(7) : HPV,., (HPV), HPV.,,, New England Journal of Medicine. HPV,. HPV,., HPV, HPV, 12,, HPV HPV216. HPV216 DNA,. HPV216.,HPV216 DNA 72 %., HPV,., 3 6. HPV216 DNA 9 6., HPV. Merck HPV, Gandasil.. HPV,. Merck HPV216 HPV218 HPV26 HPV211. Cennanix, HPV216 HPV218.,Merck. HPV216 HPV218., HPV,HPV. ( N. Seppa :Science News,May 12,2007,Vol. 171,p. 291)