Comparative study of multicellular tumor spheroid formation methods and implications for drug screening
|
|
|
- Alice Mariah Mathews
- 5 years ago
- Views:
Transcription
1 Supporting Information Comparative study of multicellular tumor spheroid formation methods and implications for drug screening Maria F. Gencoglu, Lauren E. Barney, Christopher L. Hall, Elizabeth A. Brooks, Alyssa D. Schwartz, Daniel C. Corbett, Kelly R. Stevens and Shelly R. Peyton* : Department of Chemical Engineering, University of Massachusetts Amherst, N540 Life Sciences Laboratories, 240 Thatcher Rd, Amherst, MA : Department of Bioengineering, University of Washington, Box , Seattle, WA, *Corresponding author: speyton@ecs.umass.edu 15 pages, 2 tables, 11 figures 1
2 Materials and Methods: RGD synthesis GRGDSPCG was synthesized on a CEM's Liberty Blue automated solid phase peptide synthesizer (CEM, Matthews, NC) using Fmoc protected amino acids (Peptide Solutions LLC, Las Vegas, NV). Resin was cleaved from the peptide by sparging nitrogen gas through a solution of peptide-resin and trifluoroacetic acid, triisopropylsilane, water, 2,2 -(Ethylenedioxy)diethanethiol at a ratio of 92.5:2.5:2.5:2.5 % by volume, respectively (Sigma-Aldrich, St. Louis, MO) for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the cleaved resin, and the peptide was precipitated out using dimethyl ether at -80 C (Thermo Fisher Scientific, Waltham, MA). Molecular mass was validated using a MicroFlex MALDI-TOF (Bruker, Billerica, MA) using α-cyano-4-hydroxycinnamic acid (Sigma-Aldrich, St. Louis, MO). Peptides were purified to 95% on a VYDAC reversed-phase c18 column attached to a Waters 2487 dual λ absorbance detector and 1525 binary HPLC pump (Waters, Milford, MA). Gene Expression Clustering and PCA RT-PCR data was clustered using a heatmap in R programming to generate dendrograms. Principal component analysis employed the Using the devtools package and factoextra R library to calculate principal components 1 and 2, and the shaded ovals representing 0.5 probability are shown in Figure 2b. Gene set enrichment analysis (GSEA) was performed on RNA collected from MDA-MB-231 and SkBr3 cells on TCPS, from polynipaam and from cells grown in polynipaam for 14 days before being dissociated to single cells back onto TCPS for 24 hours. A ranked list was generated from these samples, and enrichment of gene sets was analyzed. Normalized enrichment scores are reported from this analysis. The accession number for the RNA-Seq data is GSE
3 Table S1: Characterization of gene expression by RT-PCR. Gene Accession # Position Forward sequence, 5-3 Position Reverse sequence, 5-3 CLDN4 NM_ CAAGGCCAAGACCATGATCG 920 GAGTAAGGCTTGTCTGTGCG CDH3 NM_ GGAGGTGGAGAAAGAGGCTT 223 ACTCCTCAGCCTCCTCAGTA CDH5 NM_ TACCAGGACGCTTTCACCAT 1298 AAAGGCTGCTGGAAAATGGG ITGB4 NM_ ACTACACCCTCACTGCAGAC 3154 TCTGGCTTGCTCCTTGATGA ITGA2 NM_ GGGCATTGAAAACACTCGAT 1966 TCGGATCCCAAGATTTTCTG ITGB1 NM_ CATCTGCGAGTGTGGTGTCT 2262 GGGGTAATTTGTCCCGACTT FN1 NM_ CGGTGGCTGTCAGTCAAA 520 AATCCTCGGCTTCCTCCATAA RPS-13 NM_ AAGTACGTTTTGTGACAGGCA 403 CGGTGAATCCGGCTCTCTATTAG -actin NM_ GGACTTCGAGCAAGAGATGG 980 AGCACTGTGTTGGCGTACAG 3
4 Table S2: Pathology report of patient samples. Patient Age Diagnosis Treatment P1 Malignant ascites Cisplatin, and etoposide P2 Ovarian cancer with omental metastasis None P3 76 Uterine cancer and ascites Carboplatin, doxorubicin, and paclitaxel P4 66 Papillary cancer, recurrent ascites Carboplatin, paclitaxel, doxorubicin liposomal, gemcitabine, and topotecan P5 85 Ovarian cancer, new ascites Carboplatin, and paclitaxel P6 60 Cervical cancer and recurrent ascites Cisplatin, carboplatin, and paclitaxel 4
5 Figure S1. MCTS size distribution in polynipaam. Histograms of Day 14 diameters for MCTS formed in polynipaam. Cell lines are ordered from the highest to the lowest mean diameter across 23 breast (green), 2 prostate (blue), and 2 ovarian (red) cancer cell lines. 5
6 Figure S2. PolyNIPAAM MCTS size negatively correlated with TCPS doubling time. a. Mean diameter fold change in polynipaam vs. TCPS doubling time. b. Mean diameter fold change in microwells vs. TCPS doubling time. c. Mean diameter fold change in suspension vs. TCPS doubling time. Data for 13 breast (green), 2 prostate (blue), and 2 ovarian (red) cancer cell lines are shown. Mean diameter fold change measures how MCTS diameters changed from Day 1 to Day 14. Spearman rank correlation is reported as ρ with significance (p) determined by a two-tailed t-test. Doubling times are from Heiser, et al 46. 6
7 Figure S3. EGF affected MCTS size in polynipaam. Mean diameter fold change in polynipaam of 23 breast (green), 2 prostate (blue), and 2 ovarian (red) cancer cell lines seeded with routine culture medium (solid bars) or routine culture medium + EGF (pattern bars). Mean diameter fold change measures how MCTS diameters changed from Day 1 to Day 14. 7
8 Figure S4. Many breast cancer cell lines formed MCTS in polynipaam and could be transferred to 3D PEG-MAL hydrogel. a. Mean diameter fold change of 23 breast cancer cell lines grown into MCTS in polynipaam. Mean diameter fold change measures how MCTS diameters changed from Day 1 to Day 14. b. Live/dead images of MCTS (green: live cells, red: dead cells) in PEG-MAL hydrogels. Images taken 3 days postencapsulation. Scale bar: 100 μm. 8
9 Figure S5. MCTS size increased with seeding cell density in microwells and suspension. a. Effect of cell density on MCTS size in microwells (low density: 1.00x10 4 cells/cm 2 -solid bars and high density: 1.03x10 5 cells/cm 2 -pattern bars). b. Effect of cell density on MCTS size in suspension (low density: 1.05x10 2 cells/cm 2 -solid bars, medium density: 1.05x10 3 cells/cm 2 -pattern bars, and high density: 1.05x10 4 cells/cm 2 -empty bars). Data for 2 breast (green), 2 prostate (blue), and 2 ovarian (red) cancer cell lines are shown. ANOVA with the Tukey post-test was applied to individual cell lines for each method. No statistically significant differences between seeding densities were observed in any cell line-method combination. 9
10 Figure S6. MCTS reached sizes around µm. a. Mean diameter in polynipaam at day 14 (density: 100 cells/µl). b. Mean diameter in microwells at day 1 (density: 1.00x10 4 cells/cm 2 ). c. Mean diameter in suspension at day 3 (density: 1.05x10 4 cells/cm 2 ). Data for 2 breast (green), 2 prostate (blue), and 2 ovarian (red) cancer cell lines are shown. ANOVA with Tukey post-test was used to compare statistically significant differences across methods for each cell line: PC-3 (polynipaam vs. suspension**) and (microwells vs. suspension*). 10
11 Figure S7. MCTS became compact over time in microwells. MCTS diameter over time of 2 breast (AU565 and BT549, green), 2 prostate (LNCaPcol and PC-3, blue), and 2 ovarian (OVCAR-3 and SKOV-3, red) cancer cell lines for 24 hours after seeding in microwells. 11
12 Figure S8. MCTS proliferated in microwells. a. Live/dead staining of MCTS (green: live cells, red: dead cells). Scale bar: 100 μm. b. Ki67 staining of MCTS (purple: Ki67, blue: DAPI). Images for 2 breast (green), 2 prostate (blue), and 2 ovarian (red) cancer cell lines are shown. Scale bar: 100 μm. 12
13 Figure S9. Circularity was preserved in polynipaam, increased in microwells, and decreased in suspension. a. MCTS circularity in polynipaam (from Day 1 to Day 14). b. MCTS circularity in microwells (from Day 0 to Day 1). Low density: 1.00x10 4 cells/cm 2 -solid bars, and high density: 1.03x10 5 cells/cm 2 -pattern bars. c. MCTS circularity in suspension (from Day 0 to Day 3). Low density: 1.05x10 2 cells/cm 2 -solid bars, medium density: 1.05x10 3 cells/cm 2 -pattern bars, and high density: 1.05x10 4 cells/cm 2 -empty bars. AU565 breast (green), LNCapcol prostate (blue), and SKOV-3 (red) cancer cell lines. Within each method, ANOVA followed by Tukey post-test was applied to individual cell lines separately for each seeding density. Cell line-seeding density combinations with a statistically significant difference between initial and final values are marked. 13
14 Figure S10. RNA-Seq on breast cancer cells revealed enrichment of surface receptor linked signal transduction. a. Principal component analysis of MDA-MB-231 and SkBr3 grown on TCPS, in polynipaam for 14 days, or grown in polynipaam and then dissociated and plated back onto TCPS. b. Gene set enrichment analysis showed that cell surface receptor linked signal transduction was enriched on TCPS over MCTS, and cell-cell adhesion was enriched in MCTS as compared to TCPS, for MDA-MB-231 and SkBr3 cells. c. Several gene set categories were significantly enriched on TCPS (positive values) or in MCTS in 3D (negative values). 14
15 Figure S11. MCTS formed in polynipaam, microwells, and suspension could be encapsulated in PEG-MAL. a. Live/dead staining of MCTS (green: live cells, red: dead cells) encapsulated in 10 wt% PEG-MAL hydrogels with cell adhesion peptide RGD. b. Ki67 staining of MCTS (purple: Ki67, blue: DAPI) encapsulated in 10 wt% PEG-MAL hydrogels with cell adhesion peptide RGD. Images for breast cancer (AU565 and BT549) cell lines are shown. Scale bar: 100 μm. 15
Comparative Study of Multicellular Tumor Spheroid Formation Methods and Implications for Drug Screening
University of Massachusetts Amherst ScholarWorks@UMass Amherst Chemical Engineering Faculty Publication Series Chemical Engineering 2017 Comparative Study of Multicellular Tumor Spheroid Formation Methods
(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
Automated synthesis of backbone protected peptides
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Automated synthesis of backbone protected peptides Abu-Baker
Supporting Information for: Daniel Knappe, Stefania Piantavigna, Anne Hansen, Adam Mechler, Annegret Binas,
Supporting Information for: Oncocin (VDKPPYLPRPRPPRRIYNR-NH 2 ): a novel antibacterial peptide optimized against Gram-negative human pathogens Daniel Knappe, Stefania Piantavigna, Anne Hansen, Adam Mechler,
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one
Supporting Information
Supporting Information Cyclic Peptidyl Inhibitors against Human Peptidyl-Prolyl Isomerase Pin1 Tao Liu, Yu Liu, Hung-Ying Kao, *,, and Dehua Pei Table of Contents: Table S1. Structures of amino acid building
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
Supporting information for: Memory Efficient. Principal Component Analysis for the Dimensionality. Reduction of Large Mass Spectrometry Imaging
Supporting information for: Memory Efficient Principal Component Analysis for the Dimensionality Reduction of Large Mass Spectrometry Imaging Datasets Alan M. Race,,, Rory T. Steven,, Andrew D. Palmer,,,
VaTx1 VaTx2 VaTx3. VaTx min Retention Time (min) Retention Time (min)
a Absorbance (mau) 5 2 5 3 4 5 6 7 8 9 6 2 3 4 5 6 VaTx2 High Ca 2+ Low Ca 2+ b 38.2 min Absorbance (mau) 3 2 3 4 5 3 2 VaTx2 39.3 min 3 4 5 3 2 4. min 3 4 5 Supplementary Figure. Toxin Purification For
Co-culturing and Assaying Spheroids in the Corning Spheroid Microplate
Co-culturing and Assaying Spheroids in the Corning Spheroid Microplate Application Note Audrey Bergeron, Hannah Gitschier Corning Incorporated, Life Sciences Kennebunk, Maine Introduction Two-dimensional
Development of a Cell-penetrating Peptide that Exhibits Responsive. Changes in its Secondary Structure in the Cellular Environment
Development of a Cell-penetrating Peptide that Exhibits Responsive Changes in its Secondary Structure in the Cellular Environment iroko Yamashita, 1 Takuma Kato, 2 Makoto ba, 2 Takashi Misawa, 1 Takayuki
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Small Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS
Bruker Daltonics Application Note # MT-93/FTMS-38 Small Molecule Drug Imaging of Mouse Tissue by MALDI-TOF/TOF Mass Spectrometry and FTMS Introduction Matrix Assisted Laser Desorption Ionization (MALDI)
Triptycene-Based Small Molecules Modulate (CAG) (CTG) Repeat Junctions
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2015 Triptycene-Based Small Molecules Modulate (CAG) (CTG) Repeat Junctions Stephanie A. Barros
Microwave heating in peptide side chain modification via sulfhydryl reaction
Microwave heating in peptide side chain modification via sulfhydryl reaction E. Calce and S. De Luca* Institute of Biostructures and Bioimaging, National Research Council, 80134 Naples, Italy stefania.deluca@cnr.it
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma
Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
Solving practical problems. Maria Kuhtinskaja
Solving practical problems Maria Kuhtinskaja What does a mass spectrometer do? It measures mass better than any other technique. It can give information about chemical structures. What are mass measurements
A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
An efficient methodology to introduce o-(aminomethyl) phenyl-boronic acids into peptides: alkylation of secondary amines
Electronic Supplementary Material (ESI) for ew Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre ational de la Recherche Scientifique 2016 An efficient methodology to
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Analysis of Peptides via Capillary HPLC and Fraction Collection Directly onto a MALDI Plate for Off-line Analysis by MALDI-TOF
Analysis of Peptides via Capillary HPLC and Fraction Collection Directly onto a MALDI Plate for Off-line Analysis by MALDI-TOF Application Note 219 Joan Stevens, PhD; Luke Roenneburg; Kevin Fawcett (Gilson,
Supplementary Information
Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Rose et al. Supplementary Material. 1. Supplementary Materials and Methods
Rose et al. Supplementary Material 1. Supplementary Materials and Methods 1.1. Synthesis of the biotinylated CrA modules. 1.1.1. Instrumentation and reagents: All solvents were purchased from Carl Roth
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
SUPPORTING INFORMATION:
1S SUPPORTING INFORMATION: The discovery of the once weekly glucagon like peptide 1 (GLP-1) analog semaglutide Jesper Lau*, Paw Bloch, Lauge Schäffer, Ingrid Pettersson, Jane Spetzler, Jacob Kofoed, Kjeld
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supporting Information
Supporting Information Wiley-VCH 2013 69451 Weinheim, Germany Tuning the Intracellular Bacterial Targeting of Peptidic Vectors** Eric K. Lei, Mark P. Pereira, and Shana O. Kelley* anie_201302265_sm_miscellaneous_information.pdf
Prof. Steven S. Saliterman. Department of Biomedical Engineering, University of Minnesota
Department of Biomedical Engineering, University of Minnesota http://saliterman.umn.edu/ The meniscus is a fibrocartilaginous tissue primarily of type 1 collagen fibers. (In contrast to hyaline cartilage
SUPPLEMENTARY INFORMATION
doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation
A ph-dependent Charge Reversal Peptide for Cancer Targeting
Supporting Information A ph-dependent Charge Reversal Peptide for Cancer Targeting Naoko Wakabayashi 1, Yoshiaki Yano 1, Kenichi Kawano 1, and Katsumi Matsuzaki 1 1 Graduate School of Pharmaceutical Sciences,
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Cytosolic targeting of macromolecules using a ph-dependent fusogenic peptide in. combination with cationic liposomes
Cytosolic targeting of macromolecules using a ph-dependent fusogenic peptide in combination with cationic liposomes Sachiko Kobayashi, Ikuhiko Nakase, Noriko Kawabata, Hao-hsin Yu, Silvia Pujals, Miki
Supporting Information to accompany: Resolving the Chemistry of Zn 3 P 2 Nanocrystal Growth
Supporting Information to accompany: Resolving the Chemistry of Zn 3 P 2 Nanocrystal Growth Benjamin A. Glassy and Brandi M. Cossairt* Department of Chemistry, University of Washington, Box 351700, Bagley
Automated Sample Preparation/Concentration of Biological Samples Prior to Analysis via MALDI-TOF Mass Spectroscopy Application Note 222
Automated Sample Preparation/Concentration of Biological Samples Prior to Analysis via MALDI-TOF Mass Spectroscopy Application Note 222 Joan Stevens, Ph.D.; Luke Roenneburg; Tim Hegeman; Kevin Fawcett
Solid Phase Peptide Synthesis (SPPS) and Solid Phase. Fragment Coupling (SPFC) Mediated by Isonitriles
Solid Phase Peptide Synthesis (SPPS) and Solid Phase Fragment Coupling (SPFC) Mediated by Isonitriles Ting Wang a and Samuel J. Danishefsky a,b,* alaboratory for Bioorganic Chemistry, Sloan- Kettering
Daniela Dinulescu, PhD Assistant Professor Harvard Medical School
Daniela Dinulescu, PhD Assistant Professor Harvard Medical School % 5-year survival Ovarian Cancer Demographics The most deadly gynecologic malignancy. Late diagnosis = poor survival. 90 80 70 60 50 40
SUPPLEMENTAY FIGURES AND TABLES
SUPPLEMENTAY FIGURES AND TABLES Supplementary Figure S1: Validation of mir expression by quantitative real-time PCR and time course studies on mir- 29a-3p and mir-210-3p. A. The graphs illustrate the expression
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supporting Information. Recyclable hypervalent-iodine-mediated solid-phase peptide
Supporting Information Recyclable hypervalent-iodine-mediated solid-phase peptide synthesis and cyclic peptide synthesis Dan Liu, Ya-Li Guo, Jin Qu and Chi Zhang* for Address: State Key Laboratory of Elemento-Organic
Sorafenib resistance and JNK signaling in carcinoma during extracellular matrix stiffening
University of Massachusetts Amherst ScholarWorks@UMass Amherst Chemical Engineering Faculty Publication Series Chemical Engineering 2014 Sorafenib resistance and JNK signaling in carcinoma during extracellular
Supporting Information
Supporting Information Peptide macrocycles featuring a backbone secondary amine: a convenient strategy for the synthesis of lipidated cyclic and bicyclic peptides on solid support Alberto ddo*, Lena Münzker
Supplemental Figures Supplemental Figure 1:
Supplemental Figures Supplemental Figure 1: Representative FACS data showing Concurrent Brain cell type Acquisition using either Percoll PLUS (top row) or myelin removal beads (bottom two rows). Debris
Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Synthesis of cationic porphyrin modified amino. acids
Synthesis of cationic porphyrin modified amino acids Eric Biron and Normand Voyer* Département de chimie and CREFSIP, Faculté des sciences et de génie, Université Laval, Québec, Québec, Canada G1K 7P4
The study of phospholipids in single cells using an integrated microfluidic device
Supporting Information: The study of phospholipids in single cells using an integrated microfluidic device combined with matrix-assisted laser desorption/ionization mass spectrometry Weiyi Xie,, Dan Gao,
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Ovarian Cancer Survival. Ovarian Cancer Follow-up. Ovarian Cancer Treatment. Management of Recurrent Ovarian Carcinoma. 15,520 cancer deaths
Management of Recurrent Ovarian Carcinoma Lee-may Chen, M.D. Department of Obstetrics, Gynecology, & Reproductive Sciences UCSF Comprehensive Cancer Center Ovarian Cancer Survival United States, 28: 1
Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative
SUPPLEMENTARY INFORMATION Inhibition of fatty acid oxidation as a therapy for MYC-overexpressing triplenegative breast cancer Roman Camarda, Alicia Y. Zhou, Rebecca A. Kohnz, Sanjeev Balakrishnan, Celine
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of
Electronic Supplementary Information
Electronic Supplementary Information Microwave-assisted Kochetkov amination followed by permanent charge derivatization: A facile strategy for glycomics Xin Liu a,b, Guisen Zhang* a, Kenneth Chan b and
CarboMAX TM Enhanced Peptide Coupling at Elevated Temperature
Page 1 of 5 CarboMAX TM Enhanced Peptide Coupling at Elevated Temperature Summary CarboMAX is a new patented coupling methodology for peptide synthesis at elevated temperature. It offers improvements over
Analysis of Commercially Available Products Containing Stevia
Analysis of Commercially Available Products Containing Stevia Application note The commercial use of the herb stevia refers to the extracts from the Stevia rebaudina, Bertoni plant. Although originally
Supporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Supporting Information 1. General Information...S2 a. Materials b. HPLC
A facile in vitro platform to study cancer cell dormancy under hypoxic microenvironments using CoCl 2
Lee et al. Journal of Biological Engineering (2018) 12:12 https://doi.org/10.1186/s13036-018-0106-7 RESEARCH Open Access A facile in vitro platform to study cancer cell dormancy under hypoxic microenvironments
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD
AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:
York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Overview of methodology, tools and reagents for evaluating cell proliferation and invasion using multicellular tumor spheroids.
The Next Step in the Evolution of 3D Culture: Utilizing Extracellular Matrix to Enhance Multicellular Tumor Spheroid Models for Proliferation and Invasion Overview of methodology, tools and reagents for
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein
Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest
FGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
SUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs
Development of Degradable Stealth Nanospheres for Controlled Delivery of Anticancer Drugs Emmanuel. Akala, R.Ph., Ph.D. Department of Pharmaceutical Sciences School of Pharmacy First Generation Polymeric
Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supporting Information
Supporting Information The Effects of Spacer Length and Composition on Aptamer-Mediated Cell-Specific Targeting with Nanoscale PEGylated Liposomal Doxorubicin Hang Xing +, [a] Ji Li +, [a] Weidong Xu,
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Digitizing the Proteomes From Big Tissue Biobanks
Digitizing the Proteomes From Big Tissue Biobanks Analyzing 24 Proteomes Per Day by Microflow SWATH Acquisition and Spectronaut Pulsar Analysis Jan Muntel 1, Nick Morrice 2, Roland M. Bruderer 1, Lukas
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
Focus Application. Compound-Induced Cytotoxicity
xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving
Supplementary Data. Different volumes of ethanol or calcium solution were slowly added through one of four
Supplementary Data METHODS Liposome preparation Different volumes of ethanol or calcium solution were slowly added through one of four methods: Method I, no ethanol or calcium solution; Method II, exactly
HepaRG LX2. HepaRG HepaRG LX2 LX2
C Supporting Figure 1. Experimental design of s between and cells. (A) -hepatocytes were isolated from a 30 days of -progenitors. Differentiation into mature hepatocytes was achieved following a 2-weeks
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Single mammalian cell encapsulation