Pulmonary Macrophage Transplantation Therapy

Size: px
Start display at page:

Download "Pulmonary Macrophage Transplantation Therapy"

Transcription

1 Pulmonary Macrophage Transplantation Therapy Rare Pediatric Respiratory Disease: Science Shapes Precision Care Conference Sanford Consortium for Regenerative Medicine La Jolla, CA July 6, 2017 Bruce Trapnell, M.D. Director, Translational Pulmonary Science Center Professor of Medicine and Pediatrics University of Cincinnati Medical Center

2 Outline Background Hereditary pulmonary alveolar proteinosis (hpap) Validated model Csf2rb-/- mice (KO) Pulmonary macrophage transplantation (PMT) therapy Overview of approach Therapeutic efficacy Cell localization, engraftment, differentiation Safety WT versus gene-corrected macrophages Nonclinical data status Clinical trial plan

3 Hereditary pulmonary alveolar proteinosis (hpap) Hereditary PAP is a rare disease characterized by accumulation of surfactant in alveolar macrophages and pulmonary alveoli causing restrictive lung impairment, and progressive hypoxemic respiratory failure Disease is caused by mutations in the genes encoding the GM CSF receptor α or β chains (CSF2RA, CSF2RB) GM CSF is required for alveolar surfactant clearance GM CSF regulates cholesterol clearance by macrophages constitutively and in reversible fashion Surfactant catabolism is not impaired PAP, but clearance is reduced secondary to cholesterol congestion

4 CSF2RA/B mutations known to cause hpap Chain (CSF2RA) NH 2 A17G + G196R G196R 920dupGC R217X Q170X Ex7 Ex7 8 Xp 0.4 Ex5&6 Xp 1.6, i(xq) Houston Xp 0.1 Signal Peptide Extra cellular 173 nt 192 nt 254 nt Transmembrane Intra cellular COOH Chain (CSF2RB) N S271L 631delC C Mouse GM CSF R β KO ( Ex7) Adapted from: Suzuki AJRCCM, 2010

5 hpap Pathology Reproduced in ips Cell-Derived Macrophages Blood hpap Normal Surfactant exposure Normal hpap hpap + gene Rx ips cells Before CSF2RA lentivirus S Gene corrected MΦs 0 hr after Surfactant Exposure Oil-red-O stain (neutral lipid) 24 hr after Suzuki AJRCCM. 189: ; 2014

6 Serum GM CSF Autoantibody ELISA Test GM CSF autoantibody (μg/ml serum) Optimal cutoff by ROC curve analysis Sensitivity & specificity = 100% based on ROC analysis Adapted from Uchida et al. J, Immunologic Methods. 402: 57 70; 2014

7 Serum GM CSF Concentration Routine ELISA performed using serum Used to screen for GM CSF receptor dysfunction Serum GM CSF (ng/ml) LLOQ 0.1 hpap Family members Healthy controls Suzuki, et al AJRCCM. 182: ; 2010.

8 GM CSF Signaling pstat5 Max Identifies Hereditary PAP 40 pstat5-max (MFI) NL apap spap hpap cpap

9 Current Therapy: Whole lung lavage Before After (5 days)

10 PMT therapy of hereditary PAP Gene-corrected macrophage L Defective macrophage due to CSF2RA mutations CSF2RB GM-CSF L CD34 O 2 Pulmonary alveolus CO 2 CD34 CSF2RA gene-correction vector Blood HSPC

11 Csf2rb / (KO) mice recapitulate human hpap a Human hpap CSF2RB S271L Murine hpap Csf2rb -/- (KO) h b c BAL turbidity (O.D. 600nm) WT KO d SP-D (mg/ml BAL) e WT KO WT KO *** f g WT KO *** *** WT KO *** *** GM-CSF (pg/ml BAL) M-CSF (pg/ml BAL) MCP-1 (pg/ml BAL) BAL GM-CSF (pg/ml) BAL turbidity (O.D. 600nm) PU.1 mrna (au) PPARγ mrna (au) ABCG1 mrna (au) *** *** i j *** *** *** *** WT KO WT KO WT KO nd *** 0 *** 0 *** WT KO k l Time (weeks) KO WT KO WT *** *** Suzuki Nature, 2014.

12 Preclinical evaluation of PMT therapy of hpap a Endotracheal administra on of macrophages into lungs Expansion WT HPSC s Macrophage HPSCs differen a on WT KO; gene corrected Csf2rb / (KO) mouse Suzuki Nature, 2014.

13 Lung histology 1 year after PMT WT KO KO + PMT SP-B PAS Suzuki. Nature, 2014.

14 PMT using WT or gene-corrected KO macrophages have similar therapeutic efficacy a GM-R-LV Mouse GM-R β Csf2rb IRES GFP-LV GFP CMV promoter cppt WPRE R enhancer RRE EF1α promoter U3Δ GFP U5 GFP b d Donor { LV vector { Recipient { GM CSF R β Ac n WT None KO KO GFP-LV KO KO GM-R-LV KO c d 4 e e g f * * BAL turbidity (OD 600 nm) SP D (mg/ml BAL) * * PMT cells { GFP-LV { GM-R-LV { WT KO + KO + 0 PMT cells { GFP-LV { GM-R-LV { WT KO KO PMT cells { GFP-LV { GM-R-LV { WT KO KO + + Suzuki Nature, 2014.

15 PMT corrects secondary polycythemia j Hemoglobin (mg/dl) Hemoglobin Hematocrit Erythropoietin * * PMT 0 { + WT KO k 60 l 600 Hematocrit (% rbc) * * Epo (pg/ml) * * PMT 0 { + PMT 0 { + WT KO WT KO Suzuki Nature, 2014.

16 PMT improves survival PMT Survival KO + PMT KO **** Age (days) Suzuki Nature, 2014.

17 Effect of cell dose on therapeutic efficacy of PMT Efficacy results summary (Pre clinical) Effector cell AMs, mature BMDMs, and progenitors have Rx efficacy Cell doses 5 x10e5 => similar efficacy 10e5 cells Rx effective at two months Cell dose/time to Rx effect = constant Strong cell survival advantage drives Rx Preclinical studies with clinical vector in patient cells completed/successful Trapnell, Pre Pre IND information package

18 c a MWM Transplanted macrophages remain in the lungs KO + PMT (1 month) KO + PMT (1 year) WT Lung Lys-M GFP+ Lung Blood BM Spleen Lung Blood BM Spleen - EGFP - Lys-M d b 2.0 Vector copy number Lung ND ND ND Blood BM Spleen Suzuki Nature, 2014.

19 c Transplanted macrophages localize to alveoli PMT: Lys M GPF Knock in BMDMs KO untreated KO + PMT Alveolar PMT-Derived Alveolar Interstitial d % PMT derived cells Interstitial Suzuki Nature, Endogenous 0 Alveolar Interstitial Localization

20 Transplanted macrophages engraft efficiently j k GM-CSF (pg/ml BAL fluid) Macrophage engraftment (% CD131+ BAL cells) l n * ns 0 WT KO +PMT BAL Turbidity (OD 600 nm) Cell number (x10 5 /mouse) 0 Suzuki Nature, Time after PMT (months)

21 GM CSF regulates alveolar macrophage population size via a reciprocal feedback mechanism M CSF Alveolar macrophage Survival Differentiation Population size GM CSF Blood Air M CSF Pulmonary GM CSF Lung Surfactant homeostasis Alveolar stability Oxygen uptake Suzuki Nature, 2014.

22 Importance of pulmonary GM CSF concentration GM-CSF Absent GM-CSF Increased Constitutively Unpublished

23 Transplanted macrophages adopt a normal phenotype Untreated controls Treated f BMDM WT (AM) KO (AM) KO + PMT (AM) % of Max CD11b Siglec F MCH class II SiglecF CD11c CD11b Suzuki Nature, Specific antibody Fluorescence Control antibody

24 Alveolar macrophage transcriptome 1 year after PMT a WT KO + PMT KO 0 1- Pearson correlation coefficient No change Suzuki Nature, 2014.

25 Results of preclinical safety studies PMT using WT or KO gene corrected macrophages into KO mice: No behavioral changes No cellular inflammation in the lungs No pro inflammatory cytokine increase in the lungs (TNFα, IL 1β, IL 6) No changes in baseline hematologic parameters Reduction in PAP biomarkers: M CSF, GM CSF, MCP 1 Doses of 5,000,000 cells/mouse were safe and well tolerated providing a 10 fold safety margin for cell dose Suzuki Nature, 2014.

26 Estimating the cell dose for PMT in humans Calculation method Human cell dose % AM # Alveolar number (relative) 0.03 x 10e9 0.5% Body weight (relative) 1.1 x 10e9 14% AM number (relative) 1.1 x 10e9 19% Alveolar surface area (relative) 4.4 x 10e9 78% AM number (absolute) 5.6 x 10e9 100% Based on values for corresponding mouse and human parameters 500,000 cells/mouse gives good/maximum efficacy at 1 year 100,000 cells/mouse gives detectable therapeutic efficacy at 2 months 4 x 10e6 cells/mouse was well tolerated and safe without adverse events Calculated from corresponding mouse and human parameter Calculate from the absolute human parameter

27 Translating PMT therapy to humans with hpap Dose No. Dose (40 kg human) Safety margin Delivery site 1 12 x 10e segment 2 24 x 10e segment x 10e6 8.8 All remaining segments Trapnell, Pre Pre IND information package

28 Conclusions Pulmonary GM CSF: Regulates alveolar macrophage population size, surfactant homeostasis, alveolar stability, and lung function GM CSF is a critical pulmonary hormone Pulmonary macrophage transplantation (preclinical): Myeloablation not required Safe and well tolerated High therapeutic efficacy Durable treatment effect (>1 year) Prolongs lifespan by 20% A strong survival advantage drives efficacy

29 Acknowledgements Translational Pulmonary Science Center, Cincinnati, OH, USA Takuji Suzuki Paritha Arumugam Takura Sakagami Claudia Chalk Antony Sallese Brenna Carey Bruce Trapnell Experimental Hematology, Cincinnati, OH USA Punam Malik Carolyn Lutzko Pulmonary Medicine, Cincinnati, OH, USA Robert Wood (Harvard Medical School, Cambridge, MA, USA) Cole Trapnell Hannover Medical School, Hannover, Germany Nico Lachmann Thomas Moritz Funding (PAP Research Program) NIH UL1 RR NIH R01 HL NIH R01 HL NIH U54 HL12762 (NIH R21 HL106134) (NIH R01 HL71823) (NIH U54 RR019498)

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed

More information

Prevalence and healthcare burden of pulmonary alveolar proteinosis

Prevalence and healthcare burden of pulmonary alveolar proteinosis McCarthy et al. Orphanet Journal of Rare Diseases (2018) 13:129 https://doi.org/10.1186/s13023-018-0846-y LETTER TO THE EDITOR Prevalence and healthcare burden of pulmonary alveolar proteinosis Cormac

More information

Pearson r = P (one-tailed) = n = 9

Pearson r = P (one-tailed) = n = 9 8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable

More information

Hereditary Pulmonary Alveolar Proteinosis Pathogenesis, Presentation, Diagnosis, and Therapy

Hereditary Pulmonary Alveolar Proteinosis Pathogenesis, Presentation, Diagnosis, and Therapy Hereditary Pulmonary Alveolar Proteinosis Pathogenesis, Presentation, Diagnosis, and Therapy Takuji Suzuki 1, Takuro Sakagami 1, Lisa R. Young 2,3, Brenna C. Carey 1, Robert E. Wood 2, Maurizio Luisetti

More information

Active STAT5 promotes long lived cytotoxic CD8 T cells that induce regression of autochthonous mouse melanoma.

Active STAT5 promotes long lived cytotoxic CD8 T cells that induce regression of autochthonous mouse melanoma. Active STAT5 promotes long lived cytotoxic CD8 T cells that induce regression of autochthonous mouse melanoma. SITC 211 Grégory Verdeil No relationships to disclose T cell adoptive transfer for cancer

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal

Translatability of cytokine data: from animals to humans. Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Translatability of cytokine data: from animals to humans Marie-Soleil Piche, PhD Associate Scientific Director of Immunology Charles River, Montreal Presentation outline Overview of cytokines Factors related

More information

Natural Killer Cells: Development, Diversity, and Applications to Human Disease Dr. Michael A. Caligiuri

Natural Killer Cells: Development, Diversity, and Applications to Human Disease Dr. Michael A. Caligiuri Natural Killer Cells: Development, Diversity, November 26, 2008 The Ohio State University Comprehensive Cancer Center The James Cancer Hospital and Solove Research Institute Columbus, Ohio, USA 1 Human

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

pplementary Figur Supplementary Figure 1. a.

pplementary Figur Supplementary Figure 1. a. pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective

More information

Supplementary Figure 1

Supplementary Figure 1 d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP

More information

Preclinical Experience with rhasm for Niemann-Pick Disease

Preclinical Experience with rhasm for Niemann-Pick Disease Preclinical Experience with rhasm for Niemann-Pick Disease Gerry Cox, MD, PhD Vice President, Clinical Development September 16, 2014 Shani Niemann-Pick disease Type B UK www.genzyme.com Acid Sphingomyelinase

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Review and Public RAC Discussion of Protocol #

Review and Public RAC Discussion of Protocol # Review and Public RAC Discussion of Protocol #0508 725 A phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding

More information

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Supplementary table I. Real-time primers used in the study. The fold change was obtained by Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1). Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome

Supplemental Data. Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in. Hermansky-Pudlak Syndrome Page 1 Supplemental Data Epithelial-Macrophage Interactions Determine Pulmonary Fibrosis Susceptibility in Hermansky-Pudlak Syndrome Lisa R. Young, Peter M. Gulleman, Chelsi W. Short, Harikrishna Tanjore,

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies

NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,

More information

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

PU.1 regulation of human alveolar macrophage differentiation requires granulocyte-macrophage colony-stimulating factor

PU.1 regulation of human alveolar macrophage differentiation requires granulocyte-macrophage colony-stimulating factor Am J Physiol Lung Cell Mol Physiol 285: L1132 L1136, 2003. First published August 1, 2003; 10.1152/ajplung.00216.2003. PU.1 regulation of human alveolar macrophage differentiation requires granulocyte-macrophage

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway

Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases

Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Supplementary Information Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases Ulrike Mock 1, Kristoffer Riecken 1, Belinda Berdien 1, Waseem Qasim 2, Emma Chan

More information

Novel pharmacotherapy in ARDS

Novel pharmacotherapy in ARDS Novel pharmacotherapy in ARDS Danny McAuley Royal Victoria Hospital and Queen s University of Belfast Critical Care Cananda Forum October 2012 Disclosures GSK; consultancy and participate in research funded

More information

Rare cause of dyspnoea: protein accumulation in the lungs

Rare cause of dyspnoea: protein accumulation in the lungs Rare cause of dyspnoea: protein accumulation in the lungs Interstitial or diffuse lung disorders are disorders affecting the spaces between the alveoli and blood vessels (the so-called interstitium) in

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Generation of Robust Antibody Responses to HIV-1 MPER Antigens in Mice Reconstituted with Cultured B cells

Generation of Robust Antibody Responses to HIV-1 MPER Antigens in Mice Reconstituted with Cultured B cells Generation of Robust Antibody Responses to HIV-1 MPER Antigens in Mice Reconstituted with Cultured B cells T. Matt Holl 1, Masayuki Kuraoka 1, Dongmei Liao 1, Laurent Verkoczy 2, M. Anthony Moody 2, Munir

More information

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1

Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1 % of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy

More information

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging

More information

Rituximab therapy in pulmonary alveolar proteinosis improves alveolar macrophage lipid homeostasis

Rituximab therapy in pulmonary alveolar proteinosis improves alveolar macrophage lipid homeostasis Malur et al. Respiratory Research 212, 13:46 RESEARCH Open Access Rituximab therapy in pulmonary alveolar proteinosis improves alveolar macrophage lipid homeostasis Anagha Malur 1, Mani S Kavuru 1,3, Irene

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

Cystinosis Research Foundation Progress Report. Energy homeostasis and muscle wasting in nephropathic cystinosis. Final Report

Cystinosis Research Foundation Progress Report. Energy homeostasis and muscle wasting in nephropathic cystinosis. Final Report Cystinosis Research Foundation Progress Report Energy homeostasis and muscle wasting in nephropathic cystinosis Principle Investigator: Robert Mak, MD, PhD Institution: University of California, San Diego

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Clinical Translation of Immunotherapy using WT1 and CMV specific TCR Gene Transfer

Clinical Translation of Immunotherapy using WT1 and CMV specific TCR Gene Transfer Clinical Translation of Immunotherapy using WT1 and CMV specific Gene Transfer Dr Emma C Morris Reader, Dept of Immunology, UCL Consultant Haematologist (BMT), UCLH and RFH ISCT, 2/5/211 Gene Transfer

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Pedro A. Martinez, PhD December 7 th, 2015

Pedro A. Martinez, PhD December 7 th, 2015 RAP-536 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA-1 Function in Murine β-thalassemia Pedro A. Martinez, PhD December 7 th, 2015 Outline

More information

NK cell flow cytometric assay In vivo DC viability and migration assay

NK cell flow cytometric assay In vivo DC viability and migration assay NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with

More information

Regulatory B cells in autoimmunity. Liwei Lu University of Hong Kong, China

Regulatory B cells in autoimmunity. Liwei Lu University of Hong Kong, China Regulatory B cells in autoimmunity Liwei Lu University of Hong Kong, China Multiple functions of B cells in immunity LeBien and Tedder, Blood (2008) B cell functions in autoimmune pathogenesis The Immunopathogensis

More information

7.013 Spring 2005 Problem Set 6

7.013 Spring 2005 Problem Set 6 MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel NAME TA 7.013 Spring 2005 Problem Set 6 FRIDAY April 29th,

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Imaging in pediatric lung diseases The roles of CT and pathology in diagnosing inherited and developmental lung diseases

Imaging in pediatric lung diseases The roles of CT and pathology in diagnosing inherited and developmental lung diseases Imaging in pediatric lung diseases The roles of CT and pathology in diagnosing inherited and developmental lung diseases Dr Alistair D Calder Consultant Radiologist We re not so different, you and I. Invasiveness

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented

BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh

More information

Supplemental information

Supplemental information Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman

More information

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. 1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic

More information

Nature Immunology: doi: /ni.3866

Nature Immunology: doi: /ni.3866 Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils

More information

Novità nelle MDS. Matteo G Della Porta. Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy

Novità nelle MDS. Matteo G Della Porta. Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy Novità nelle MDS Matteo G Della Porta Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy matteo.della_porta@hunimed.eu Outline ARCH Predictive value of somatic

More information

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress 3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

In Vivo Models and Cell Delivery for Lung Indications NO DISCLOSURES

In Vivo Models and Cell Delivery for Lung Indications NO DISCLOSURES In Vivo Models and Cell Delivery for Lung Indications Marlowe Eldridge MD Department of Pediatrics and Biomedical Engineering University of Wisconsin School of Medicine and Public Health NO DISCLOSURES

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

D CD8 T cell number (x10 6 )

D CD8 T cell number (x10 6 ) IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p

More information

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta

More information

Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection

Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection Supplementary Information Therapeutic PD L1 and LAG 3 blockade rapidly clears established blood stage Plasmodium infection Noah S. Butler, Jacqueline Moebius, Lecia L. Pewe, Boubacar Traore, Ogobara K.

More information

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were

Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

alveolar macrophages (AMs) after 24 hours of in vitro culture in complete medium

alveolar macrophages (AMs) after 24 hours of in vitro culture in complete medium Online Supplement for: NF-κB ACTIVATION IN ALVEOLAR MACROPHAGES REQUIRES IκB KINASE-β, BUT NOT NF-κB INDUCING KINASE Supershift and Competition Assays for NF-κB Competition and supershift assays were performed

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Long-term innate immune memory via effects on bone marrow progenitors

Long-term innate immune memory via effects on bone marrow progenitors Long-term innate immune memory via effects on bone marrow progenitors Helen S Goodridge, PhD helen.goodridge@csmc.edu Regenerative Medicine Institute, Cedars-Sinai Medical Center, Los Angeles, USA Fondation

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

A phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding

A phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding A phase I pilot study of safety and feasibility of stem cell therapy for AIDS lymphoma using stem cells treated with a lentivirus vector encoding multiple anti-hiv RNAs John A. Zaia, M.D. John J. Rossi,

More information

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)

Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human) Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis

More information

Pulmonary Surfactant. Jian kang, M.D. Pediatric PGY-2

Pulmonary Surfactant. Jian kang, M.D. Pediatric PGY-2 Pulmonary Surfactant Jian kang, M.D. Pediatric PGY-2 Objectives Functions Composition Metabolism Applications Functions To increase pulmonary compliance To prevent the lung from collapsing at the end of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Supplementary Figures

Supplementary Figures Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

More information

Production of the Formed Elements (Chapter 11) *

Production of the Formed Elements (Chapter 11) * OpenStax-CNX module: m62120 1 Production of the Formed Elements (Chapter 11) * Ildar Yakhin Based on Production of the Formed Elements by OpenStax This work is produced by OpenStax-CNX and licensed under

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

February 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti

February 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti February 14, 2003 Report on preclinical studies in gc-ko mice Fabio Candotti Five published reports (see details below) have described the development of peripheral blood lymphocytes as well as cellular

More information

A Mechanism-Based PK/PD Model Predicts the Time-Course of Hematological responses for Epoetin beta

A Mechanism-Based PK/PD Model Predicts the Time-Course of Hematological responses for Epoetin beta A Mechanism-Based PK/PD Model Predicts the Time-Course of Hematological responses for Epoetin beta N. Hayashi, K. P. Zuideveld, P. Jordan & R. Gieschke Modeling & Simulation Group & Biometrics, F. Hoffmann-La

More information

Atherosclerosis is an Inflammatory Disease: Does it Matter? Atherosclerosis is an Inflammatory Disease: Does it Matter?

Atherosclerosis is an Inflammatory Disease: Does it Matter? Atherosclerosis is an Inflammatory Disease: Does it Matter? 12 th Annual Cardiovascular Disease Prevention Symposium February 8, 2013 Atherosclerosis is an Inflammatory Disease: Does it Matter? Ira Tabas, M.D., Ph.D. Richard J. Stock Professor of Medicine, Cell

More information

Pulmonary Alveolar Proteinosis

Pulmonary Alveolar Proteinosis Pulmonary Alveolar Proteinosis Sara R. Greenhill and Darrell N. Kotton Chest 2009;136;571-577 DOI 10.1378/chest.08-2943 The online version of this article, along with updated information and services can

More information