Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex.

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex."

Transcription

1 Figure Captions Fig.1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5- FU(10)/LDH nanohybrids, C) TEM image of 5-FU(10)/LDH nanohybrids, D) FT-IR of Na-5FU, LDH-Cl and 5-FU(50)/LDH nanohybrids. Fig.2 DNA-binding ability of 5-FU/LDH nanocomplex. Lane 1: DNA ladder, Lane 2: dsdna only, Lane 3: 5-FU/LDH nanocomplex only, Lane 4-7: dsdna-5-fu/ldh with the dsnda:ldh mass ratio from 1:5 to 1:40. Fig.3 Confocal microscopy images of MCF-7 cells taking up red fluorescence sirna AF456/LDH nanohybrids (A and C: cells cultured at 37 o C and 4 o C, respectively) and sirna AF456-5-FU/LDH nanocomplex (B and D: cells cultured at 37 o C and 4 o C, respectively). The scale bars: 50 μm. The mass ratio of LDH to sirna: 40:1. Fig.4 Cytotoxicity of LDHs at different concentrations to MCF-7 cell lines Fig.5 MTT assay analysis of effects of treatments with 5-FU, 5-FU(10)/LDH, DC-siRNA/LDH, and CD-siRNA-5-FU/LDH on the viability of MCF-7 cells at the 5-FU concentration from µg/ml and the CD-siRNA concentration at 40 nm in all relevant treatments for 72 h at 37 o C. Data represent mean ±SD (n=5). ** p<0.05 versus 5-FU treatment, * p<0.01 versus 5-FU treatment. **** p< versus 5-FU treatment. Fig.6 FACS analysis of cell distribution for apoptosis and necrosis on MCF-7 cells after treatment with LDH, 5-FU/LDH, CD-siRNA/LDH and CD-siRNA-5-FU/LDH for 24 h. The concentration of 5-FU: 2.4 µg/ml and CD-siRNA: 40 nm. Fig.7 Suppression of Bcl-2 protein expression in MCF-7 cells after single or combined treatment with 5-FU and CD-siRNA delivered by LDHs. (A) Western blot analysis after 1

2 transfection with 5-FU and CD-siRNA delivered by LDH for 24h. (B) Quantitative evaluation of the percent change in expression levels of Bcl-2 protein against α-tubulin. The 5-FU, CD-siRNA concentration in all samples was 1.2 μg/ml and 40 nm, respectively. LDH concentration is 50 μg/ml. 2

3 A B (006) 5-FU(50)/LDH 5-FU(10)/LDH (003) (((006)0 LDH C D Na-5FU FU(50)/LDH LDH Fig. 1 Physicochchemical characterization of LDH nanoparticles and 5-FU/LDH nanocomplex. A) XRD, B) Particle size distribution and zeta potential distribution of LDHs and 5-FU(10)/LDH nanohybrids, C) TEM image of 5-FU(10)/LDH nanohybrids, D) FT-IR of Na-5FU, LDH-Cl and 5-FU(50)/LDH nanohybrids. 3

4 Lane Ladder dsdna 5-FU/LDH 1:5 1:10 1:20 1:40 Fig. 2 DNA-binding ability of 5-FU/LDH nanocomplex. Lane 1: DNA ladder, Lane 2: dsdna only, Lane 3: 5-FU/LDH nanocomplex only, Lane 4-7: dsdna-5-fu/ldh with the dsdna:5- FU/LDH mass ratio from 1:5 to 1:40. 4

5 Nuclei Red sirna 456 Merged A B C D Fig. 3 Confocal microscopy images of MCF-7 cells taking up Red sirna 456/LDH nanohybrids (A and C: cells cultured at 37 o C and 4 o C, respectively) and Red sirna FU/LDH nanocomplex (B and D: cells cultured at 37 o C and 4 o C, respectively). The scale bars: 50 μm. The mass ratio of LDH to sirna: 40:1. 5

6 Cell viability (%) Concentration of LDH (µg/ml) Fig. 4 Cytotoxicity of LDHs at different concentrations to MCF-7 cell lines. 6

7 C ell viability (% ) **** **** * ** Fig. 5 MTT assay analysis of effects of treatments with 5-FU, 5-FU(10)/LDH, DC-siRNA/LDH, and CD-siRNA-5-FU/LDH on the viability of MCF-7 cells at the 5-FU concentration from µg/ml and the CD-siRNA concentration at 40 nm in all relevant treatments for 72 h at 37 o C. Data represent mean ±SD (n=5). ** indicated p<0.05 versus 5-FU treatment, * p<0.01 versus 5- FU treatment. **** p< versus 5-FU treatment. 7

8 5-FU 5-FU/LDH CD-siRNA/LDH CD-siRNA-5-FU/LDH Fig 6. FACS analysis of cell distribution for apoptosis and necrosis on MCF-7 cells after treatment with 5-FU, 5-FU/LDH, CD-siRNA/LDH and CD-siRNA-5-FU/LDH for 24 h. The concentration of 5-FU: 2.4 µg/ml and CD-siRNA: 40 nm. 8

9 A Bcl-2 α-tub LDH 5-FU 5-FU/LDH CD-siRNA/ CD-siRNA-5- LDH FU/LDH B Fig 7. Suppression of Bcl-2 protein expression in MCF-7 cells after single or combined treatment with 5-FU and CD-siRNA delivered by LDHs. (A) Western blot analysis after transfection with 5-FU and CD-siRNA delivered by LDH for 24h. (B) Quantitative evaluation of the percent change in expression levels of Bcl-2 protein against α-tubulin. The 5-FU, CD-siRNA concentration in all samples was 2.4 μg/ml and 40 nm, respectively. LDH concentration is 50 μg/ml. 9

10 Supplement Co-delivery of sirna and an Anticancer Drug Using Layered Double Hydroxide Nanoparticles in Effective Cancer Treatment Li Li a,, Wenyi Gu a, *, Jiezhong Chen b,c, Weiyu Chen a, Zhi Ping Xu a, * a Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, QLD 4072, Australia b School of Biomedical Sciences, University of Queensland, St Lucia, QLD 4072 c Faculty of Science, Medicine and Health, University of Wollongong, Northfields Avenue, NSW 2522, Australia. Fax: ; Tel: ; 10

11 Lane Ladder dsdna LDH 1:5 1:10 1:20 1:40 Fig. S1 DNA-binding ability of LDH nanoparticles. Lane 1: DNA ladder, Lane 2: dsdna only, Lane 3: LDHs only, Lane 4-7: dsdna/ldh with the dsdna: LDH mass ratio from 1:5 to 1:40. 11

12 Nuclei Red sirna 456 Merged A B Fig. S2 Confocal microscopy images of MCF-7 cells with Red sirna 456/LDH nanonybris (A) and Red sirna FU/LDH nanocomplex (B) cultured at 37 o C for 4h. The scale bars are 50 μm. The mass ratio of the particles to Red sirna 456 is 20:1. 12

13 A C ell V iability (% ) * B C ell V iability (% ) * Fig. S3 The effect of combined treatment with CD-siRNA and 5-FU co-delivered by LDHs on viability of HCT-116 and U2OS after 72-hour treatment at 37 o C. (A) HCT-116 cells and (B) U2OS cells. Data represent mean ±SD (n=4 or 5).* indicated P<

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supporting Information

Supporting Information Supporting Information Toward High-Efficient Red Emissive Carbon Dots: Facile Preparation, Unique Properties, and Applications as Multifunctional Theranostic Agents Shan Sun,, Ling Zhang, Kai Jiang, Aiguo

More information

International Conference on Biomedical and Biological Engineering (BBE 2016)

International Conference on Biomedical and Biological Engineering (BBE 2016) International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

Twin Research and Human Genetics

Twin Research and Human Genetics Twin Research and Human Genetics Article title: Familial aggregation of migraine and depression: insights from a large Australian twin sample Authors: Yuanhao Yang 1, Huiying Zhao 1, Andrew C Heath 2,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

The University of Queensland, National Research Centre for Environmental Toxicology (Entox), Brisbane QLD 4108 Australia

The University of Queensland, National Research Centre for Environmental Toxicology (Entox), Brisbane QLD 4108 Australia Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 2014 Supplementary Information: Behaviour of titanium dioxide and zinc oxide nanoparticles

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment Supplementary Data for Kang et al. (Title) Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells by Regulating the Interaction of Tumor with its Immune Microenvironment Tae-Wook Kang 1,3,,

More information

Supporting Information for:

Supporting Information for: Supporting Information for: Ultrasensitive Fluorescent Probes Reveal an dverse ction of Dipeptide Peptidase IV and Fibroblast ctivation Protein during Proliferation of Cancer Cells Qiuyu Gong,, Wen Shi,

More information

A novel toxicogenomics-based approach to categorize. (non-)genotoxic carcinogens

A novel toxicogenomics-based approach to categorize. (non-)genotoxic carcinogens Supplementary Material A novel toxicogenomics-based approach to categorize (non-)genotoxic carcinogens Mirjam M Schaap, Paul FK Wackers, Edwin P Zwart, Ilse Huijskens, Martijs J Jonker, Giel Hendriks,

More information

APOLs with low ph dependence can kill all African trypanosomes

APOLs with low ph dependence can kill all African trypanosomes SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Material properties that control the cytotoxicity of ZnO nanoparticles

Material properties that control the cytotoxicity of ZnO nanoparticles Material properties that control the cytotoxicity of ZnO nanoparticles Alex Punnoose, Jordan Chess, Catherine Anders, John Rassmussen, Denise Wingett, Kelsey Dodge and Katie Rainey, Boise State University,

More information

Supplementary Information. Additives Stabilize Calcium Sulfate Hemihydrate (Bassanite) in Solution

Supplementary Information. Additives Stabilize Calcium Sulfate Hemihydrate (Bassanite) in Solution Additives Stabilize Calcium Sulfate Hemihydrate (Bassanite) in Solution Yun-Wei Wang and Fiona C. Meldrum School of Chemistry, University of Leeds, Woodhouse Lane, Leeds LS2 9JT Figure S1: Raman spectra

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Long term stability of isolated human serum derived exosomes

Long term stability of isolated human serum derived exosomes Long term stability of isolated human serum derived exosomes Candice de Boer (PhD student) Regenerative Medicine Laboratory Supervisor: Associate Professor Neil Davies Exosomes First discovered during

More information

Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line

Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Endah Puji Septisetyani, Muthi Ikawati, Barinta Widaryanti and Edy Meiyanto* ) Cancer Chemoprevention Research Center,

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Optical Trapping and Manipulation of a Single Human Virus. Presented by:

Optical Trapping and Manipulation of a Single Human Virus. Presented by: Optical Trapping and Manipulation of a Single Human Virus Presented by: www.osa.org/bt Contact your Technical Group and Get Involved! Twitter - #BTTechGroupOSA Announce new activities Promote interactions

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Dental Practitioner Programs Currently Accredited by the ADC

Dental Practitioner Programs Currently Accredited by the ADC Dental Practitioner Programs Currently Accredited by the ADC (as at 18 May 2017 contact the ADC for any updated information) Please note that graduates of programs accredited by the Australian Dental Council

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Is B-type natriuretic peptide a risk factor for heart failure in patients treated with bardoxolone methyl?

Is B-type natriuretic peptide a risk factor for heart failure in patients treated with bardoxolone methyl? University of Wollongong Research Online Illawarra Health and Medical Research Institute Faculty of Science, Medicine and Health 2015 Is B-type natriuretic peptide a risk factor for heart failure in patients

More information

Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells

Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells Wang et al. BMC Cancer 2014, 14:37 RESEARCH ARTICLE Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells Harris Wang 1, The Vo 1, Ali Hajar

More information

Figure S1, Beyer et al.

Figure S1, Beyer et al. Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

At the heart of health promotion: Health Promotion Policy & Advocacy. Rachelle Foreman

At the heart of health promotion: Health Promotion Policy & Advocacy. Rachelle Foreman . At the heart of health promotion: Australian About the Heart Maps Foundation & Health Promotion Policy & Advocacy Rachelle Foreman I would like to pay my respects to the Traditional Owners of the land

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Chemodrug delivery using integrin-targeted PLGA-Chitosan nanoparticle for lung cancer therapy

Chemodrug delivery using integrin-targeted PLGA-Chitosan nanoparticle for lung cancer therapy www.nature.com/scientificreports Received: 12 September 2017 Accepted: 16 October 2017 Published: xx xx xxxx OPEN Chemodrug delivery using integrin-targeted PLGA-Chitosan nanoparticle for lung cancer therapy

More information

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Focus Application. Compound-Induced Cytotoxicity

Focus Application. Compound-Induced Cytotoxicity xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving

More information

DEVELOPMENT OF AN EFFECTIVE STRATEGY FOR SULFIDE CONTROL IN SEWERS USING FREE NITROUS ACID

DEVELOPMENT OF AN EFFECTIVE STRATEGY FOR SULFIDE CONTROL IN SEWERS USING FREE NITROUS ACID DEVELOPMENT OF AN EFFECTIVE STRATEGY FOR SULFIDE CONTROL IN SEWERS USING FREE NITROUS ACID Howard Leemon 1, David Fillmore 2, Anthony Keating 1, Guangming Jiang 3, Sandeep Sarathy 1, Zhiguo Yuan 3 1. Cloevis

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133

More information

13 13 1 1 1 12 0250512 24 1 1 48 1 70250512 24 1 148 1 0250512 24 1 48 1313 7025 0512 24 1 48 1313 13 13 11 24 0250512 48 1 7 124 0250512 48 1 124 0250512 48 13 13 7124 0250512 48 1313 13 13 1350250512

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

DMBA acts on cumulus cells to desynchronize nuclear and cytoplasmic maturation of pig oocytes

DMBA acts on cumulus cells to desynchronize nuclear and cytoplasmic maturation of pig oocytes DMBA acts on cumulus cells to desynchronize nuclear and cytoplasmic maturation of pig oocytes Zhi-Qiang Song 1, Xuan Li 1, Yan-Kui Wang 1, Zhi-Qiang Du 1,2*, Cai-Xia Yang 1,2* Supplementary information

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Thea viridis extract inhibits growth and invasion of colorectal cancer via MAPK/ERK signaling pathway suppression.

Thea viridis extract inhibits growth and invasion of colorectal cancer via MAPK/ERK signaling pathway suppression. J Med Oncl Ther 2016; 1 (1): 1-7 Journal of Medical Oncology and Therapeutics Thea viridis extract inhibits growth and invasion of colorectal cancer via MAPK/ERK signaling pathway suppression. Min Lv 1,

More information

Rabies virus-like particles expressed in HEK293 cells

Rabies virus-like particles expressed in HEK293 cells Engineering Conferences International ECI Digital Archives Vaccine Technology IV Proceedings Spring 5-21-2012 Rabies virus-like particles expressed in HEK293 cells Diego Fontana Cell Culture Laboratory

More information

Supporting Information

Supporting Information Supporting Information Bauer et al. 10.1073/pnas.1610421113 SI Materials and Methods Immunofluorescence experiments were performed as described (8). Briefly, NUGC-3 cells were treated with 25 μm PK11007

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Pei-Ru Wei, Yaswanth Kuthati, Ranjith Kumar Kankala and Chia-Hung Lee *

Pei-Ru Wei, Yaswanth Kuthati, Ranjith Kumar Kankala and Chia-Hung Lee * Int. J. Mol. Sci. 2015, 16, 20943-20968; doi:10.3390/ijms160920943 Article OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Synthesis and Characterization

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Engineered Immune Cells for Cancer Therapy : Current Status and Prospects

Engineered Immune Cells for Cancer Therapy : Current Status and Prospects When Engineering Meets Immunology Engineered Immune Cells for Cancer Therapy : Current Status and Prospects Yong Taik Lim, Ph.D. Nanomedical Systems Laboratory (http://www.nanomedicalsystems.org) SKKU

More information

Regulation of mutual inhibitory activities between AMPK and Akt with quercetin in MCF-7 breast cancer cells

Regulation of mutual inhibitory activities between AMPK and Akt with quercetin in MCF-7 breast cancer cells ONCOLOGY REPORTS 24: 1493-1497, 2010 Regulation of mutual inhibitory activities between AMPK and Akt with quercetin in MCF-7 breast cancer cells YUN-KYOUNG LEE and OCK JIN PARK Department of Food and Nutrition,

More information

Honokiol synergizes chemotherapy drugs in multidrug resistant breast cancer cells via enhanced apoptosis and additional programmed necrotic death

Honokiol synergizes chemotherapy drugs in multidrug resistant breast cancer cells via enhanced apoptosis and additional programmed necrotic death INTERNATIONAL JOURNAL OF ONCOLOGY 42: 721-732, 2013 Honokiol synergizes chemotherapy drugs in multidrug resistant breast cancer cells via enhanced apoptosis and additional programmed necrotic death WEI

More information

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector kda 1 2 3 4 5 26 14 1 7 Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector 5 4 35 25 15 1 Supplementary Figure 1. SDS-PAGE of acterially expressed and purified proteins.

More information

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors CORRECTION NOTICE Nat. Med. 22, 194 21 (216) Blocking mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Yi Du, Hirohito Yamaguchi, Yongkun Wei, Jennifer L Hsu, Hung-Ling Wang, Yi-Hsin

More information

GABA- LOADED HALLOYSITE NANOTUBE SYSTEM: RELEASE CHARACTERISTICS and EFFECT on SEIZURE PARAMETERS in EPILEPTIC RATS

GABA- LOADED HALLOYSITE NANOTUBE SYSTEM: RELEASE CHARACTERISTICS and EFFECT on SEIZURE PARAMETERS in EPILEPTIC RATS GABA- LOADED HALLOYSITE NANOTUBE SYSTEM: RELEASE CHARACTERISTICS and EFFECT on SEIZURE PARAMETERS in EPILEPTIC RATS Dr. Gülsel YURTDAŞ KIRIMLIOĞLU, Prof.Dr. Yasemin YAZAN, Prof.Dr. Kevser EROL, Res.Assis.

More information

Insulin induces drug resistance in melanoma through activation of the PI3K/Akt pathway

Insulin induces drug resistance in melanoma through activation of the PI3K/Akt pathway University of Wollongong Research Online Illawarra Health and Medical Research Institute Faculty of Science, Medicine and Health 214 induces drug resistance in melanoma through activation of the PI3K/Akt

More information

Antiproliferative and apoptotic effects of black turtle bean extracts on human breast cancer cell line through extrinsic and intrinsic pathway

Antiproliferative and apoptotic effects of black turtle bean extracts on human breast cancer cell line through extrinsic and intrinsic pathway DOI 10.1186/s13065-017-0281-5 RESEARCH ARTICLE Open Access Antiproliferative and apoptotic effects of black turtle bean extracts on human breast cancer cell line through extrinsic and intrinsic pathway

More information

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella

More information

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai,

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity independently of the LKB1 AMPK pathway Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Wen-Pin Su, Helen

More information

Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids

Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids Gene Transfection in High Serum Levels: Case Studies with New Cholesterol Based Cationic Gemini Lipids Santosh K. Misra 1, Joydeep Biswas 1, Paturu Kondaiah 2, Santanu Bhattacharya 1,3 * 1 Department of

More information

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii

Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii María Lázaro-Díez, Itziar Chapartegui-González, Santiago Redondo-Salvo, Chike Leigh, David Merino, David San Segundo, Jesús

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

CANCER THERAPEUTICS: A NOVEL APPROACH

CANCER THERAPEUTICS: A NOVEL APPROACH CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:

More information

Nature Biotechnology: doi: /nbt.2354

Nature Biotechnology: doi: /nbt.2354 a b c Summed up peptide ion signals (arb. u.) 1E+03 INSR 1E+02 1E+01 1E+00-10 - 5 0 5 10 Summed up peptide ion signals (arb. u.) 1E+03 INSR 1E+02 1E+01 1E+00-10 -5 0 5 10 1E+03 1E+02 1E+01 INSR 1E+00-10

More information

CHAPTER 4 METHOD AND LOCATION OF DIALYSIS. Nancy Briggs Kylie Hurst Stephen McDonald Annual Report 35th Edition

CHAPTER 4 METHOD AND LOCATION OF DIALYSIS. Nancy Briggs Kylie Hurst Stephen McDonald Annual Report 35th Edition CHAPTER 4 METHOD AND LOCATION OF DIALYSIS Nancy Briggs Kylie Hurst Stephen McDonald 212 Annual Report 35th Edition METHOD AND LOCATION OF DIALYSIS ANZDATA Registry 212 Report AUSTRALIA Figure 4.1 Aust

More information

Functionalized Nanoparticles for multiphotonic imaging of cancer cells

Functionalized Nanoparticles for multiphotonic imaging of cancer cells Functionalized anoparticles for multiphotonic imaging of cancer cells M. Blanchard-Desce, M. Werts,. erambourg, E Duguet, M. Smaïhi, V. Lebret, L. Raehm, J.. Durand, C. Dubernet, D. Methy Institut Charles

More information

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations Title VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body Authors Hideaki Yamamoto 1, Tappei Takada 1 *, Yoshihide Yamanashi 1, Masatsune Ogura 2, Yusuke Masuo

More information

Authors Rahul K. Keswani, Mihael Lazebnik & Daniel W. Pack

Authors Rahul K. Keswani, Mihael Lazebnik & Daniel W. Pack Reinstatement of Retroviral Infectivity via Non-Covalent Attachment of DOTAP, DOPE and Cholesterol to Murine Leukemia Virus-Like Particles Hybrid Viral/Lipid Gene Delivery Vectors Authors Rahul K. Keswani,

More information

MTH1 deficiency selectively increases noncytotoxic oxidative DNA damage in lung cancer cells: more bad news than good?

MTH1 deficiency selectively increases noncytotoxic oxidative DNA damage in lung cancer cells: more bad news than good? Abbas et al. BMC Cancer (2018) 18:423 https://doi.org/10.1186/s12885-018-4332-7 RESEARCH ARTICLE Open Access MTH1 deficiency selectively increases noncytotoxic oxidative DNA damage in lung cancer cells:

More information

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative

More information

Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer. Nanohybrids for Cancer Targeted Photodynamic Therapy

Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer. Nanohybrids for Cancer Targeted Photodynamic Therapy Supporting Information Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer Nanohybrids for Cancer Targeted Photodynamic Therapy Fangyuan Li, a Sin-Jung Park, b Daishun Ling b, Wooram Park b,

More information

Supporting Information

Supporting Information Supporting Information Toller et al. 10.1073/pnas.1100959108 SI Materials and Methods Cell Lines, Bacterial Strains, and Infection Conditions. Cell lines were grown in the following media: AGS, U2OS, stable

More information

Targeting and Regulating of an Oncogene via Nanovector Delivery of MicroRNA using Patient- Derived Xenografts

Targeting and Regulating of an Oncogene via Nanovector Delivery of MicroRNA using Patient- Derived Xenografts 677 Ivyspring International Publisher Research Paper Theranostics 2017; 7(3): 677-693. doi: 10.7150/thno.16357 Targeting and Regulating of an Oncogene via Nanovector Delivery of MicroRNA using Patient-

More information

A new tool for screening : Cellular imaging (HCA/HCS)

A new tool for screening : Cellular imaging (HCA/HCS) Biotechnology company specialized in cellular imagery which provides HCA/HCS services A new tool for screening : Cellular imaging (HCA/HCS) Applications : Efficacy & Toxicoloxy assays Julian BURSZTYKA,

More information

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo

ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

InhalT 90 Current Project Status

InhalT 90 Current Project Status InhalT 90 Current Project Status 90-Day Nose-Only Inhalation Toxicity Study of Cerium Oxide Nanoparticles in Female Wistar Rats with subsequent Analysis of Gene Expression Profiles Sponsor s Study Monitor

More information

International Graduate Research Programme in Cardiovascular Science

International Graduate Research Programme in Cardiovascular Science 1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.

More information

Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma

Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share

More information

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients

Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Author's response to reviews Title: LATS2 is De-methylated and Overexpressed in Nasopharyngeal Carcinoma and Predicts Poor Prognosis of the Patients Authors: Yan Zhang (zhangy2@sysucc.org.cn) Chun-Fang

More information

Cytotoxicity and cell cycle arrest induced by andrographolide lead to programmed cell death of MDA-MB-231 breast cancer cell line

Cytotoxicity and cell cycle arrest induced by andrographolide lead to programmed cell death of MDA-MB-231 breast cancer cell line Cytotoxicity and cell cycle arrest induced by andrographolide lead to programmed cell death of MDA-MB-231 breast cancer cell line Banerjee et al. Banerjee et al. Journal of Biomedical Science (2016) 23:40

More information

STOCK and FLOW. ANZDATA Registry 2011 Report CHAPTER 1 STOCK & FLOW. Blair Grace Kylie Hurst Stephen McDonald 1-1

STOCK and FLOW. ANZDATA Registry 2011 Report CHAPTER 1 STOCK & FLOW. Blair Grace Kylie Hurst Stephen McDonald 1-1 CHAPTER 1 STOCK & FLOW Blair Grace Kylie Hurst Stephen McDonald 1-1 ANZDATA Registry 2011 Report The number of new patients in Australia decreased slightly to 2257 in 2010. While there is variation in

More information

Ethanolic extract of Moringa oleifera increased cytotoxic effect of doxorubicin on HeLa cancer cells

Ethanolic extract of Moringa oleifera increased cytotoxic effect of doxorubicin on HeLa cancer cells Vol. 12/2 (2012)108-114 JOURNAL OF NATURAL REMEDIES Ethanolic extract of Moringa oleifera increased cytotoxic effect of doxorubicin on HeLa cancer cells Adam Hermawan*, Kholid Alfan Nur, Sarmoko, Dyaningtyas

More information

In vitro macrophage assays for selection of drug candidates for preclinical development. Philippa Allen GSK

In vitro macrophage assays for selection of drug candidates for preclinical development. Philippa Allen GSK In vitro macrophage assays for selection of drug candidates for preclinical development. Philippa Allen GSK Role of macrophages in the lung First line of host defence to inhaled matter. Regulate immune

More information