Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
|
|
- Junior Stevenson
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative to mock results. The plot shows that the significant SOD1 activity increase (t = 3.172; p =.33, n = 3) is not a result of increased levels. This suggests an allosteric modulator may be influencing SOD1 activity within the infected cells. SOD2 activity is reduced overall but SOD2 levels are also reduced, thus SOD2 activity relative to expression is unchanged. Relative SOD activity (:) * + CP Relative SOD1 activity + DDC Relative SOD2 activity
2 Supplementary Figure 2. Cleaved caspases 3 and 9 are found in the SR-VAD-fmk reactive aggregates. and infected mork13 cells were plated into chambered coverslips and allowed to grow to approximately 7% confluency. Cells were incubated with SR-VAD-fmk for 3 minutes before fixing and immunofluorescent labelling with (A) caspase 3 at a 1 in 4 dilution, (B) cleaved caspase 3 at a 1 in 4 dilution, (C) caspase 6/cleaved caspase 6 each at 1 in 5 dilution and (D) cleaved caspase 9 at a 1 in 5 dilution. All antibodies were purchased from Cell Signalling Technology (Genesearch, QLD, AUS). In merged images DAPI staining (blue) shows cell nuclei, green indicates the caspase antibody and red represents SR-VAD-fmk. Pro-caspase 3 shows little localisation to the SR- VAD-fmk reactive aggregates whereas cleaved caspase 3 shows staining within this area. Similar localisation is observed for caspase 9 but the aggregates appear devoid of pro- /caspase 6. Scale bars = 25 µm.
3 A. Pro-caspase 3 Caspase antibody SR-VAD-fmk Merge B. Caspase 3 C. Pro-/Caspase 6 D. Caspase 9
4 Supplementary Figure 3. ROS trapping or inhibition of caspases does not alter bcl-2 levels in prion infected cells. and infected mork13 cells were treated for 24 hours with (A) 5 µm TEMPO-9-AC radical trap or (B).6 µm SR-VAD-fmk caspase inhibitor and cells harvested for bcl-2 western blotting. Shown are representative bcl-2 blots with coomassie brilliant blue stain for loading. Data derived from three independent repeats is presented graphically (below) as a percentage of the untreated mock control value. Hollow bars indicate mock cell responses, filled bars represent infected cells with -/+ designating without/with treatments respectively. (A) Despite the mock cells treated with TEMPO-9-AC demonstrating increased levels of bcl-2 (t = 6.446, p =.23, n = 3), the infected cells did not show a response or recovery of bcl-2 levels upon treatment. (B) Caspase inhibition did not significantly influence bcl-2 level in either the mock or infected cells. A. B. TEMPO-9-Ac Bcl SR-VAD-fmk Bcl-2 stain stain 18kDa 18kDa Percentage mock control Percentage mock control
5 Supplementary Figure 4. Effect of chronic and acute hydrogen peroxide induced oxidative stress on SOD2 levels. To examine the effects of generic chronic oxidative stress insults on levels of SOD2 in cultured mork13 cells, cells were exposed to five doses of 1 µm hydrogen peroxide over five days then harvested for western blotting. In this time period no overt increase in cell death could be observed but a small increase is measurable by trypan blue staining (5% +/- 2.5). A single dose of 1 µm hydrogen peroxide was also applied overnight to a separate sample of cells to mimic an acute insult, with the cells harvested before most had died. Example western blots are show in (A) and quantification of SOD2 signal as compared with loading and relative to the untreated cell sample is shown in (B). SOD2 detection is significantly increased with chronic low-level oxidative stress caused by hydrogen peroxide (t = 4.586, p =.44, n = 3). Acute stress produced a highly variable detection of SOD, which is not significantly different from untreated cells (t =.765, p =.524, n = 3). A. B. 14kDa SOD2 stain for SOD2 (% Change from Untreated) Untreated * Chronic stress ns Acute stress
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationSD-1 SD-1: Cathepsin B levels in TNF treated hch
SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for
More informationAdditional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationHuman recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.
Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSTUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS
STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department
More informationSupplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationAPOLs with low ph dependence can kill all African trypanosomes
SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41564-17-34-1 In the format provided by the authors and unedited. APOLs with low ph dependence can kill all African trypanosomes Frédéric Fontaine 1, Laurence
More informationDownregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationFIG S1 Replication rates of S. suis strain 10, 10Δsly, and 10cpsΔEF on mono- and virus pre-infected porcine PCLS.
A strain 10 10cps EF B strain 10 H1N1 + strain 10 10cps EF H1N1 + 10cps EF 10 8 10 sly 10 7 H3N2 + strain 10 H3N2 + 10cps EF CFU/ml media 10 7 10 6 10 5 10 4 CFU/ml media 10 6 10 5 10 4 10 3 0 2 4 8 12
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationIKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
More informationA263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationNimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated
Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated apoptosis and inhibition of epithelial-to-mesenchymal transition Ramadevi Subramani a, Ph.D., Elizabeth Gonzalez b, MS.,
More informationExtracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation
Supplementary material; Title; Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Authors; Petra Wäster 1, Ida Eriksson 1, Linda Vainikka 1, Inger Rosdahl 2,
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSupplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationPro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
More information6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More information% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.
A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *
More informationSupplementary Figure 1. Mother centrioles can reduplicate while in the close association
C1-GFP distance (nm) C1-GFP distance (nm) a arrested HeLa cell expressing C1-GFP and Plk1TD-RFP -3 s 1 2 3 4 5 6 7 8 9 11 12 13 14 16 17 18 19 2 21 22 23 24 26 27 28 29 3 b 9 8 7 6 5 4 3 2 arrested HeLa
More informationDownregulation of the c-myc target gene, peroxiredoxin III, contributes to Arsenic Trioxide-induced apoptosis in Acute Promyelocytic Leukemia (APL)
Downregulation of the c-myc target gene, peroxiredoxin III, contributes to Arsenic Trioxide-induced apoptosis in Acute Promyelocytic Leukemia (APL) Pablo E. Vivas-Mejía, Ph.D. Research Scientist, University
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationDysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File
Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,
More informationgenome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
More informationSupplementary figures and legends for
Supplementary figures and legends for No evident dose-response relationship between cellular ROS level and its cytotoxicity a paradoxical issue in ROS-based cancer therapy Chunpeng Zhu, Wei Hu, Hao Wu,
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSupplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationHuman neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii
Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii María Lázaro-Díez, Itziar Chapartegui-González, Santiago Redondo-Salvo, Chike Leigh, David Merino, David San Segundo, Jesús
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationROS Activity Assay Kit
ROS Activity Assay Kit Catalog Number KA3841 200 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationUniversity of Groningen
University of Groningen Mechanisms of Hemagglutinin Targeted Influenza Virus Neutralization Brandenburg, Boerries; Koudstaal, Wouter; Goudsmit, Jaap; Klaren, Vincent; Tang, Chan; Bujny, Miriam V.; Korse,
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationNature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationSupplementary materials
Supplementary materials Chemical library from ChemBridge 50,240 structurally diverse small molecule compounds dissolved in DMSO Hits Controls: No virus added μ Primary screening at 20 g/ml of compounds
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins
Supplemental Material PDGFRb regulates craniofacial development through homodimers and functional heterodimers with PDGFRa Katherine A. Fantauzzo and Philippe Soriano Supplemental materials provided: Supplemental
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male
More informationSupporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via
Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationSupplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of
More informationEpithelial cell death is an important contributor to oxidant-mediated acute lung injury SUPPORTING INFORMATION 60611, USA
Epithelial cell death is an important contributor to oxidant-mediated acute lung injury SUPPORTING INFORMATION G.R. Scott Budinger 1,2 *, Gökhan M. Mutlu 1 *, Daniela Urich 2, Saul Soberanes 1, Leonard
More informationMitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition
Supplementary Information Mitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition Sunita Maharjan, Masahide Oku, Masashi Tsuda, Jun Hoseki 2 & Yasuyoshi
More informationB. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.
Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1
More informationNature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
More informationSLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4
GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More information