Sialylation of EGFR by the ST6Gal-I sialyltransferase promotes EGFR activation and resistance to gefitinib-mediated cell death
|
|
- Bartholomew Griffin
- 5 years ago
- Views:
Transcription
1 Britin et l. Journl of Ovrin Reserch (2018) 11:12 RESEARCH Open Access Silyltion of EGFR y the ST6Gl-I silyltrnsferse promotes EGFR ctivtion nd resistnce to gefitini-medited cell deth Colleen M. Britin 1, Andrew T. Holdrooks 1, Joshu C. Anderson 2, Christopher D. Willey 2 nd Susn L. Bellis 1* Astrct Bckground: The ST6Gl-I silyltrnsferse is upregulted in numerous cncers, nd high expression of this enzyme correltes with poor ptient prognosis in vrious mlignncies, including ovrin cncer. Through its silyltion of select cohort of cell surfce receptors, ST6Gl-I modultes cell signling to promote tumor cell survivl. The gol of the present study ws to investigte the influence of ST6Gl-I on nother importnt receptor tht controls cncer cell ehvior, EGFR. Additionlly, the effect of ST6Gl-I on cncer cells treted with the common EGFR inhiitor, gefitini, ws evluted. Results: Using the OV4 ovrin cncer cell line, which lcks endogenous ST6Gl-I expression, kinomics ssy reveled tht cells with forced overexpression of ST6Gl-I exhiited incresed glol tyrosine kinse ctivity, finding confirmed y immunolotting whole cell lystes with n nti-phosphotyrosine ntiody. Interestingly, the kinomics ssy suggested tht one of the most highly ctivted tyrosine kinses in ST6Gl-I-overexpressing OV4 cells ws EGFR. Bsed on these findings, dditionl nlyses were performed to investigte the effect of ST6Gl-I on EGFR ctivtion. To this end, we utilized, in ddition to OV4 cells, the SKOV3 ovrin cncer cell line, engineered with oth ST6Gl-I overexpression nd knockdown, s well s the BxPC3 pncretic cncer cell line with knockdown of ST6Gl-I. In ll three cell lines, we determined tht EGFR is sustrte of ST6Gl-I, nd tht the silyltion sttus of EGFR directly correltes with ST6Gl-I expression. Cells with differentil ST6Gl-I expression were susequently evluted for EGFR tyrosine phosphoryltion. Cells with high ST6Gl-I expression were found to hve elevted levels of sl nd EGF-induced EGFR ctivtion. Conversely, knockdown of ST6Gl-I gretly ttenuted EGFR ctivtion, oth slly nd post EGF tretment. Finlly, to illustrte the functionl importnce of ST6Gl-I in regulting EGFR-dependent survivl, cells were treted with gefitini, n EGFR inhiitor widely used for cncer therpy. These studies showed tht ST6Gl-I promotes resistnce to gefitini-medited poptosis, s mesured y cspse ctivity ssys. Conclusion: Results herein indicte tht ST6Gl-I promotes EGFR ctivtion nd protects ginst gefitini-medited cell deth. Estlishing the tumor-ssocited ST6Gl-I silyltrnsferse s regultor of EGFR provides novel insight into the role of glycosyltion in growth fctor signling nd chemoresistnce. Keywords: β-glctoside α2-6 silyltrnsferse 1 (ST6GAL1), Glycosyltion, Epiderml growth fctor receptor (EGFR) cell signling, Gefitini, Tumor cell iology, Kinomics, Tyrosine kinse * Correspondence: ellis@u.edu Equl contriutors 1 Deprtment of Cell, Developmentl, nd Integrtive Biology, University of Alm t Birminghm, 350 McCllum Building, 1918 University Blvd, Birminghm, AL 35294, USA Full list of uthor informtion is ville t the end of the rticle The Author(s) Open Access This rticle is distriuted under the terms of the Cretive Commons Attriution 4.0 Interntionl License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.
2 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 2 of 11 Bckground It hs long een known tht tumor cells disply n ltered profile of cell surfce glycns, however the functionl role of glycosyltion in regulting tumor cell ehvior remins poorly-understood. The chnges in tumor glycosyltion re not rndom; insted, select suset of glycns is consistently enriched in cncer cells. One of these elevted glycn structures is α2-6 linked silic cid, which is dded to N-glycosylted proteins y the ST6Gl-I silyltrnsferse [1 3]. ST6Gl-I is upregulted in numerous cncers including ovrin, pncretic, colon nd rest [4 8], nd high ST6Gl-I expression correltes with poor ptient outcomes in severl types of mlignncies [5 8]. One of the centrl questions regrding ST6Gl-I s protumorigenic ctivity is how chnges in surfce silyltion influence intrcellulr signling cscdes to modulte tumor cell ehvior. We nd others hve reported tht ST6Gl-I regultes the structure nd function of specific cohort of memrne receptors. As exmples, ST6Gl-I-medited silyltion of the β1 integrin drives tumor cell migrtion nd invsion [9 12], wheres α2-6 silyltion of oth the Fs nd TNFR1 deth receptors prevents poptosis y locking lignd-induced receptor internliztion [13, 14]. ST6Gl-I-dependent silyltion lso plys prominent role in regulting the oligomeriztion of multiple receptors including CD45 [15] nd PECAM [16]. Through its collective ctions on diverse receptors, ST6Gl-I functions s mster regultor to control cell phenotype. In cncer cells, the upregultion of ST6Gl-I promotes hllmrk cncer stem cell (CSC) ehviors including tumorspheroid growth, selfrenewl, tumor-inititing potentil nd resistnce to chemotherpy [4, 5, 17 19]. In the present study we identify nother importnt receptor regulted y ST6Gl-I, the receptor tyrosine kinse, EGFR. OV4 ovrin cncer cells with enforced ST6Gl-I expression were sujected to n unised kinomics ssy, which reveled tht EGFR ws one of the most differentilly ctivted kinses in cells with upregulted ST6Gl-I. Specificlly, EGFR tyrosine kinse ctivity ws mrkedly enhnced in cells with high ST6Gl-I expression. Bsed on the kinomics results, we developed severl cell model systems with either ST6Gl-I overexpression or knockdown to estlish tht EGFR is directly α2-6 silylted y ST6Gl-I. Significntly, we find tht ST6Gl-I-medited silyltion of EGFR stimultes oth the sl nd EGF-induced ctivtion of EGFR. Furthermore, α2-6 silyltion of EGFR regultes the viility of cells exposed to the EGFR inhiitor, geftini. These results not only estlish new tumor-promoting function for ST6Gl-I, ut lso more rodly illuminte the importnce of tumor glycns in fundmentl tumor cell survivl pthwys. Methods Cell culture For routine mintennce of cell lines, cells were grown in DME/F12 (OV4) or RPMI (SKOV3 nd BxPC3) medi supplemented with 10% fetl ovine serum (FBS Atlnt Biologicls) nd 1% ntiiotic/ntimycotics (Invitrogen). Cells were trnsduced with lentivirus encoding either the humn ST6Gl-I gene (Genecopoei) or shrna ginst ST6Gl-I (Sigm, TRCN , sequence CCGGCGTGTGCTACTACTACCAGAACTC- GAGTTCTGGTAGTAGTAGCACACGTTTTTG). Polyclonl popultions of stly-trnsduced cells were isolted y puromycin selection. Overexpression or knockdown of ST6Gl-I ws verified vi immunolot using nti-st6gl-i got polyclonl ntiody (R&D Systems, AF5924). Kinomics ssy OV4 EV or OE cells were lysed y dding pre-chilled M- PER Mmmlin Protein Extrction Regent (Thermo- Scientific) contining protese nd phosphtse inhiitors (Thermo Scientific). After 30 min incution on ice, the lyste ws centrifuged t 14,000 rpm t 4 C, nd the superntnt immeditely collected nd stored t 80 C. Glol kinse ctivity (kinomic) profiling ws performed in the UAB Kinome Core ( com) using the PmSttion 12 pltform (PmGene, BV, The Netherlnds) s previously descried [20 25]. Briefly, lystes were loded onto wells of 2% BSA locked PmChips specific for the kinome nlyzed 15 μg lyste for the protein tyrosine kinse (PTK) chip nd 2 μg lyste for the serine threonine kinse (STK) chip. Lystes were loded long with stndrd kinse uffer (PmGene) contining ATP nd FITC-leled ntiodies for detection of phosphorylted sustrte proes. Both kinetic nd end of rection (end-level) peptide sustrte phosphoryltion imge cpture dt ws collected with Evolve softwre (PmGene) nd nlyzed using the BioNvigtor (v. 6.2, PmGene). Upstrem kinse prediction ws performed using the UpKin upstrem kinse prediction tool (PmGene) tht clcultes normlized kinse sttistic score nd specificity score using dt from the pulic phosphonet dtse ( to identify highly ltered kinses tht re displyed in r grph nd volcno plots [21, 22]. Immunolotting Cells were serum deprived for 2 h using medi contining 1% FBS prior to tretment with 100 ng/ml rhegf (R&D, 236-EG). Cells were treted for indicted times nd lysed using rdioimmune precipittion ssy (RIPA) uffer supplemented with protese nd phosphtse inhiitors. Totl protein concentrtion ws mesured y BCA (Pierce). Smples were resolved y SDS-PAGE nd
3 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 3 of 11 c d Fig. 1 ST6Gl-I promotes n increse in overll tyrosine kinse ctivity.. OV4 cells were stly trnsduced with lentivirus encoding ST6Gl-I, nd ST6Gl-I overexpression (OE) ws confirmed y immunolotting (EV = empty vector control).. Whole rry imge cpture t finl prewsh cycle numer 92 of PTK rry illustrting chnges in tyrosine phosphoryltion with qulittively selected ltered spots (yellow rrows) incresed in ST6Gl-I OV4 OE cells s compred to EV cells. c. Whole chip comprtive OE nd EV rry-men phosphoryltion intensity (y xis per cell) over time in the kinetic/prewsh cycles (x xis per cell) for oth the STK (left 2 pnels) nd PTK (right two pnels) rrys. d. EV or OE cells were immunolotted with n nti-phosphotyrosine ntiody trnsferred to polyvinylidene difluoride memrnes. Memrnes were incuted with 5% nonft dry milk in TBS contining 0.1% Tween-20 (TBST). Immunolots were proed with ntiodies for p-egfr (Y-1068, Cell Signling Technology, ct #3777), or totl EGFR (Cell Signling Technology, ct #4267), followed y incution with pproprite HRP-conjugted secondry ntiodies (Cell Signling Technologies). Protein loding ws verified using nti-β-tuulin (Acm, 21058). Protein ws detected y enhnced chemiluminescence using the ECL sustrte from Pierce (ct# 32106). To visulize sl p-egfr levels, which re lower thn levels of EGF-induced p-egfr, we optimized lotting conditions y incresing the totl mount of protein loded (> 40 μg) nd prolonging film exposure times. We lso used more sensitive ECL regent for the sl p- EGFR lots (SuperSignl West Dur from BioRd ct# ). In ddition to immunolotting for p-egfr nd totl EGFR, OV4 cells were immunolotted for totl levels of tyrosine phosphoryltion using n HRP-conjugted ntiody ginst phospho-tyrosine (BD Biosciences, ct #610011). Immunolotting for p-egfr ws performed using three independently-prepred cell lystes, nd densitometric quntifiction of nds from t lest three independent lots ws chieved using ImgeJ softwre. All nds were normlized to their respective β-tuulin loding controls. Student s t test ws employed to determine significnce (p <0.05). SNA precipittion ssy 250 μg of cell lyste ws incuted with 150 μg ofsnagrose (Vector Ls, ct# AL-1303). Smples were incuted t 4 C overnight on rottor. α2-6 silylted proteins were then precipitted y centrifugtion nd wshed 3 times with ice cold PBS. Precipittes were resolved y SDS- PAGE nd immunolotted for EGFR s descried ove. Cspse 3/7 luminescence ssy Cells were seeded t equl densities into culture pltes nd llowed to dhere overnight. Prior to gefitini
4 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 4 of 11 Fig. 2 ST6Gl-I overexpression ttenutes serine/threonine kinse ctivity. Br nd volcno plots of kinses with ltered STK ctivity in OV4 OE vs. EV cells.. Br plot of serine/threonine kinses identified with the BioNvigtor UpKin STK PmApp v14.0 (PmGene) scored s incresed (rightwrd) or decresed (leftwrd) in OE reltive to EV. Length of r indictes extent of chnge (KSTAT; Kinse Sttistic) nd color of r indictes specificity of ech kinse to the predicted phosphosites used to mesure its respective ctivity.. In the volcno plot, kinses re similrly scored s incresed or decresed (y xis) in OE reltive to EV, colored y specificity. A comined KSTAT + specificity score (x xis) is denoted, with text size indicting the numer of seed peptides used to identify tht kinse tretment, cells were serum deprived in 1% FBScontining medi for 2 h nd then treted with 1 μm gefitini (Selleckchem, ct #S1025) for h. Reconstituted Cspse-Glo 3/7 ssy regent (Promeg, ct #G8093) ws then dded into ech well, mixed vi oritl shker, nd incuted t room temperture for 45 min. Luminescence ws quntified with BioTek Synergy H1 plte reder. The vlues represented were normlized to the cspse vlue for untreted cells. At lest two independent experiments were conducted for ech cell line. Results Kinomics ssys revel tht ST6Gl-I overexpression switches signling to fvor tyrosine kinse ctivtion The OV4 ovrin cncer cell line is one of the few cncer lines tht lcks detectle ST6Gl-I protein. To evlute the role of ST6Gl-I in regulting kinse ctivity, ST6Gl-I ws stly overexpressed (OE) in OV4 cells using lentivirl vector (Fig 1). An empty vector (EV) control cell line ws lso generted. As previously reported [26], OV4 OE cells hve incresed surfce α2-6 silyltion reltive to EV cells, s mesured y SNA lelling nd flow cytometry. SNA is lectin tht specificlly recognizes α2-6 silic cids. To screen for potentil chnges in cell signling consequent to forced ST6Gl-I expression, EV nd OE cells were sujected to kinomics ssy. As shown in Fig. 1, EV nd OE cells displyed noticele differences in the phosphoryltion of select sustrtes (rrows), suggesting tht ST6Gl-I modultes the ctivity of distinct suset of kinses. Interestingly, OE cells exhiited modest decrese in the net ctivity of serine/threonine kinses, compred with EV, cells (Fig. 1c, left pnel), wheres OE cells hd sustntilly incresed tyrosine kinse ctivity (Fig. 1c, right pnel). Enhnced tyrosine kinse ctivity in the OE line ws confirmed y immunolotting whole cell lystes with n nti-phosphotyrosine ntiody tht detects glol chnges in tyrosine kinse ctivity (Fig 1d). We next evluted the ctivity of specific serine/threonine kinses modulted y ST6Gl-I (Fig 2). In generl, most of the serine/threonine kinses proed y the
5 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 5 of 11 Fig. 3 Tyrosine kinses, including EGFR, re more ctivted in cells with ST6Gl-I overexpression. Br nd volcno plots of kinses with ltered PTK ctivity in OV4 OE vs. EV cells.. Br plot of tyrosine kinses identified with the BioNvigtor UpKin PTK PmApp v8.0 (PmGene) scored s incresed (rightwrd) or decresed (leftwrd) in OE reltive to EV. Length of r indictes extent of chnge (KSTAT; Kinse Sttistic) nd color of r indictes specificity of ech kinse to the predicted phosphosites used to mesure its respective ctivity.. In the volcno plot, kinses re similrly scored s incresed or decresed (y xis) in OE reltive to EV, colored y specificity. A comined KSTAT + specificity score (x xis) is denoted, with text size indicting the numer of seed peptides used to identify tht kinse kinomics ssy exhiited incresed ctivtion in EV cells. The most prominent differentilly ctivted kinses re shown in Fig. 2. These include severl memers of the protein kinse C (PKC) nd clcium-clmodulin-kinse-like (CAMKL) fmilies. The specificity score mesures the specificity of the kinse for its cognte peptides on the chip, with red indicting high specificity. The volcno plot in Fig. 2 reltes the specificity score to the normlized kinse sttistic score (i.e. reltive kinse ctivity) to provide n overll score for kinse ctivtion. Fig 3 depicts tyrosine kinse ctivity in EV nd OV4 cells. Notly, nerly ll of the tyrosine kinses screened were more ctive in OE cells (Fig. 3). Mny of these hyperctivted kinses re known to e ssocited with cell trnsformtion, such s the nonreceptor tyrosine kinses, src nd lyn, nd receptor tyrosine kinses, MET, ERBB4 nd EGFR. As shown in the volcno plot (Fig. 3), one of the most differentilly-ctivted tyrosine kinses in OE vs. EV cells ws EGFR (rrow). ST6Gl-I overexpression in OV4 ovrin cncer cells increses sl nd EGF-induced EGFR ctivtion Given tht the kinomics ssy pointed to enhnced EGFR ctivtion in cells with forced ST6Gl-I expression, we conducted dditionl nlyses of this receptor. We first determined whether EGFR ws direct sustrte for ST6Gl-I. To this end, cell lystes were incuted with grose-conjugted SNA lectin to precipitte α2-6 silylted proteins. These proteins were resolved y SDS-PAGE nd immunolotted for EGFR. As shown in Fig. 4, α2-6 silylted EGFR ws clerly pprent in OE, ut not EV, cells. The totl mount of EGFR ws equivlent in EV nd OE cells, indicting tht forced expression of ST6Gl-I did not lter EGFR expression. To ssess the effects of EGFR silyltion on EGFR ctivtion, cells were treted with EGF for up to 30 min, nd then lystes were immunolotted for p- EGFR (representtive lot in Fig. 4 nd corresponding densitometric nlyses of lots from three independently-generted cell lystes in Fig 4c). At oth 5 nd 15 min following EGF stimultion, OE cells exhiited incresed ctivtion of EGFR reltive to EV cells. In the lot depicted in Fig. 4, p-egfr levels in the untreted (UT) popultions were elow the limits of detection. We therefore optimized immunolotting conditions to increse sensitivity (see Methods section), enling visuliztion of sl p-egfr. Fig. 4d
6 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 6 of 11 d c e Fig. 4 EGFR phosphoryltion is enhnced in OV4 ovrin cncer cells with ST6Gl-I overexpression.. To mesure levels of α2-6 silylted EGFR, cell lystes were incuted with SNA-grose. SNA is lectin tht specificlly recognizes α2-6 silic cids. Silylted proteins were precipitted nd then immunolotted for EGFR.. Representtive p-egfr immunolot of EV or OE cells treted with EGF for 5, 15 nd 30 min. c. Densitometric nlysis of three independent lots of p-egfr in EGF-treted OV4 cells, with vlues normlized to the β-tuulin loding control. d. Representtive p-egfr immunolot of EV or OE cells to evlute sl EGFR phosphoryltion. e. Densitometric nlysis of three independent lots of sl p-egfr in OV4 cells. *, p <0.05 (densitometry in Fig. 4e) shows tht EGFR is more ctivtedintheoelineeveninthesenceofexogenouslydded EGF. These dt re consistent with the kinomics ssy, which ws conducted on untreted cells. ST6Gl-I ctivity regultes sl nd EGF-induced EGFR ctivtion in SKOV3 ovrin cncer cells To determine whether silyltion-dependent regultion of EGFR ws conserved cross cncer cell lines, EGFR ctivity ws exmined in the SKOV3 ovrin cncer line. ST6Gl-I ws either overexpressed (OE) in SKOV3 cells, or stly knocked-down (KD) using shrna-ering lentivirl vector (Fig. 5). SNA precipittion ssys showed tht, in comprison with EV control cells, EGFR hd incresed α2-6 silyltion in OE cells, nd decresed α2-6 silyltion in KD cells. As with the OV4 line, mnipulting ST6Gl-I expression in SKOV3 cells hd no effect on totl levels of EGFR. In correspondence with differentil silyltion, sl p-egfr ws higher in SKOV3 OE vs. EV cells, wheres p-egfr levels were gretly reduced in KD cells (densitometry for p-egfr in Fig. 5). Along with chnges in sl ctivtion, silyltion of EGFR regulted the response to EGF (representtive lots in Fig. 5c nd densitometry in Fig. 5d). EGFinduced EGFR ctivtion ws enhnced in OE cells, ut diminished in KD cells. ST6Gl-I knockdown impirs sl nd EGF-induced EGFR ctivtion in BxPC3 pncretic cncer cells Recent studies suggest tht ST6Gl-I hs similr function in multiple cncer types including ovrin, colon, nd pncretic denocrcinom. We therefore evluted EGFR ctivtion in pncretic cncer line, BxPC3. ST6Gl-I expression ws knocked down (KD) in this line, which led to loss in α2-6 silyltion of EGFR, s mesured y SNA precipittion ssy (Fig. 6). Consistent with reduced EGFR silyltion, ST6Gl-I KD cells hd drmticlly decresed levels of sl ctivtion of EGFR (densitometry for p-egfr in Fig. 6). As with sl ctivtion, EGF-stimulted EGFR ctivtion ws suppressed y ST6Gl-I KD (representtive lots in Fig. 6c nd densitometry in Fig. 6d). Considering tht elevted ST6Gl-I levels resulted in incresed EGFR ctivtion in ll three cell lines, we next tested whether endogenous expression of ST6Gl-I correltes with p- EGFR in side-y-side comprison of the lines. Fig. 6e shows tht SKOV3 EV cells, which hve the highest levels of ST6Gl-I of the three lines, exhiit the most pronounced sl ctivtion of EGFR, wheres the
7 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 7 of 11 cell response to the EGFR inhiitor, gefitini. In prior study, it ws shown tht ST6Gl-I KD sensitizes cells to gefitini-induced cell deth [27]. Accordingly, OV4 EV nd OE cells were treted with gefitini, nd then monitored for poptosis using cspse 3/7 ctivity ssy. As shown in Fig. 7, OV4 OE cells were resistnt to gefitinimedited poptosis. Contrrily, ST6Gl-I KD in BxPC3 cells enhnced gefitini-induced cell deth (Fig. 7). c d Fig. 5 EGFR phosphoryltion is enhnced in SKOV3 ovrin cncer cells with ST6Gl-I overexpression, ut decresed in cells with ST6Gl-I knockdown.. SKOV3 cells were stly trnsduced with lentivirus encoding humn ST6Gl-I, or lterntively, shrna for ST6Gl-I. ST6Gl-I overexpression (OE) nd knockdown (KD) were confirmed y immunolotting. EV, OE or KD cell lystes were precipitted y SNA-grose nd immunolotted for EGFR to detect levels of α2-6 silylted EGFR. Totl cell lystes were immunolotted for ctivted EGFR (p-egfr, py1068) or totl EGFR.. Densitometric nlysis of three independent lots of sl p-egfr in SKOV3 cells (normlized to β-tuulin). c. Representtive p-egfr immunolot of EV, OE or KD cells treted with EGF for 5, 15 nd 30 min. d. Densitometric nlysis of three independent lots of p-egfr in EGF-treted SKOV3 cells. *, p <0.05 lowest ST6Gl-I expressing cells, OV4 EV, disply the lest mount of sl p-egfr. This finding suggests tht, irrespective of the diverse genetic ckgrounds of these three cell lines, there is correspondence etween the level of ST6Gl-I ctivity nd EGFR ctivtion. ST6Gl-I-medited silyltion of EGFR regultes the viility of cells treted with gefitini The comined results in Figs 1, 2, 3, 4, 5 nd 6 estlished tht ST6Gl-I medited silyltion of EGFR enhnces its ctivtion, s indicted y greter tyrosine kinse ctivity. To confirm the importnce of ST6Gl-I in regulting EGFR-dependent cell survivl, we exmined Discussion Accumulting evidence suggests tht ST6Gl-I is potent survivl fctor, providing cncer cells with protection ginst vriety of microenvironmentl ssults. Explicitly, α2-6 silyltion of select receptors inhiits glectin-medited poptosis [28 30], nd ST6Gl-I lso prevents cell deth driven y TNFR1 [14, 31] nd Fs [13]. In ddition, ST6Gl-I protects tumor cells ginst cytotoxicity medited y rdition [32] nd chemotherpy drugs including cispltin, gemcitine nd docetxel [5, 17 19]. Furthermore, ST6Gl-I enles tumor cell survivl under conditions of serum growth fctor deprivtion y enhncing Akt ctivtion, nd preventing tumor cell exit from the cell cycle [26]. In the current study, we descrie new survivl function for ST6Gl-I in modulting the ctivity of EGFR. Utilizing n unised kinomics ssy, we show tht overll sl tyrosine kinse ctivity, phenomenon well-known to contriute to mlignnt trnsformtion [33 36], is profoundly elevted in cells with forced overexpression of ST6Gl-I. In prticulr, EGFR is one of the most highly ctivted of these tyrosine kinses. To sustntite this result, we mnipulted ST6Gl-I expression in 3 different cncer cell lines, using oth overexpression nd knockdown pproches. In these models, EGFR ws shown to e direct sustrte for ST6Gl-I-medited silyltion, nd in every cse, α2-6- silyltion of EGFR incresed oth the sl nd EGFinduced ctivtion of EGFR. Thus, EGFR α2-6-silyltion is consistently correlted with incresed tyrosine kinse ctivity despite the diverse genetic lesions present in the 3 distinct cncer lines. As well, ST6Gl-I-medited EGFR silyltion protected tumor cells ginst gefitini-induced cell deth. The role of silyltion in regulting EGFR hs een previously investigted. Prk et l. mnipulted ST6Gl-I expression in colon crcinom cells, nd in concordnce with our work, reported tht EGFR silyltion prevented geftini-induced cytotoxicity [27]. However, in contrst to our studies, α2-6 silyltion ppered to inhiit EGFinduced EGFR tyrosine phosphoryltion [27]. The reson for this discrepncy is currently uncler. Other investigtors hve mnipulted glol silyltion to interrogte the functionl effects on EGFR. Wong s group incuted cells with silidse enzyme tht cleves ll silic cid linkges (α2-3, α2-6 nd α2-8) [37]. In this study, the removl of surfce silyltion fcilitted the formtion of
8 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 8 of 11 c d e Fig. 6 Knockdown of ST6Gl-I diminishes EGFR phosphoryltion in BxPC3 pncretic cncer cells.. Using lentivirus, BxPC3 cells were stly trnsduced with shrna for ST6Gl-I, nd ST6Gl-I knockdown (KD) ws confirmed y immunolotting. EV or KD cell lystes were precipitted y SNA grose nd immunolotted for EGFR to detect α2-6 silylted EGFR. Totl cell lystes were immunolotted for ctivted EGFR (p-egfr, py1068) or totl EGFR.. Densitometric nlysis of three independent lots of sl p-egfr in BxPC3 cells (normlized to β-tuulin). c. Representtive p-egfr immunolot of EV or KD cells treted with EGF for 5, 15 nd 30 min. d. Densitometric nlysis of three independent lots of p-egfr in EGF-treted BxPC3 cells. e. Totl cell lystes from EV cells of the OV4, SKOV3 nd BxPC3 lines were immunolotted for ST6Gl-I, p-egfr (Y1068) or totl EGFR. *, p <0.05 Fig. 7 ST6Gl-I ctivity protects cncer cells ginst gefitini-medited poptosis.. OV4 EV or OE cells nd. BxPC3 EV or KD cells were treted with gefitini for 24, 48 nd 72 h nd nlyzed for poptosis vi luminescence ssy tht detects cspse 3 nd 7 ctivity. Cspse ctivity in geftini-treted cells ws normlized to cspse ctivity in untreted cells. Dt shown re from representtive experiment, with t lest 2 independent experiments performed for ech cell line. Grph depicts mens ± S.D
9 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 9 of 11 EGF-induced EGFR dimers. This group further generted recominnt, solule EGFR protein nd reported tht silidse-treted EGFR protein exhiited greter dimeriztion [38]. Yrem s group ddressed the question of EGFR silyltion y incuting cells with metolic precursor of silic cid tht ugments the intrcellulr pool of silic cid, leding to enriched receptor silyltion [39]. The ensuing increse in EGFR silyltion ws found to hinder EGFR s ssocition with the extrcellulr glectin lttice, potentiting EGFR internliztion. No chnges in EGFR dimeriztion were oserved in this ltter study. Tken together, these studies highlight the importnce of silic cid in EGFR signling, however there re some cvets ssocited with mnipulting the glol silyltion of tumor cells. First, complete removl of cell surfce silyltion vi silidse tretment hs profound effects on cell signling, ltering the ctivity of myrid of receptors. Secondly, there is sustntil evidence tht the α2-3 nd α2-6 silic cid linkges re not lwys functionlly equivlent. This is est exemplified y the ctivity of lectins such s glectins nd siglecs tht clerly discriminte etween α2-3 nd α2-6 silyltion. Finlly, there is n extensive literture suggesting tht α2-6 silyltion is prticulrly enriched in cncer cells [1 3] (nd lso stem cells [40, 41]). Our group hs sought to model the tumor cell phenotype y exmining the effect of selective ST6Gl-I upregultion, without grossly ltering α2-3 silyltion. Through this pproch, we find tht high ST6Gl-I ctivity enhnces EGFR ctivtion, consistent with the vst literture suggesting tht ST6Gl-I cts s tumor-driver gene. Further studies will e needed to etter understnd the effect of α2-6 silyltion on EGFR. EGFR hs complex mechnism of regultion involving receptor oligomeriztion, lipid rft locliztion, shedding, nd dynmic prtitioning etween cellulr comprtments including the plsm memrne, endosome nd nucleus [42 45]. Mny of these processes re known to e influenced y EGFR glycn composition [39, 46 48]. Furthermore, glycosyltion modultes the overll conformtion of EGFR in the sence of lignd inding. For exmple, the N-glycns on two key Asn residues, Asn-420 nd Asn 579, pper to mintin EGFR in low ffinity stte. Altion of Asn-420 glycosyltion (vi mutgenesis) leds to constitutive EGFR tyrosine phosphoryltion nd spontneous oligomer formtion [49]. Elimintion of the Asn-579 site wekens uto-inhiitory tether interctions, nd increses the numer of preformed EGFR dimers in the sence of lignd [50]. It is tempting to speculte tht the ddition of the ulky, negtively-chrged silic cid t Asn-420 nd/or Asn-570 could disrupt these criticl uto-inhiitory interctions, potentiting sl EGFR ctivtion. Regrdless of the mechnism y which α2-6 silyltion modultes EGFR structure (or potentilly, locliztion), results herein re consistent with other studies indicting tht ST6Gl-I protects ginst gefitini-induced cell deth [27]. Gefitini is widely-used in cncer therpy [51], nd hence, the levels of ST6Gl-I expression in ptient smples could e n importnt indictor of ptient response to tretment. Intensive investigtion is currently focused on how EGFR modifictions ffect the efficcy of EGFR inhiitors, however the role of EGFR glycosyltion in drug response hs received limited ttention. Conclusions The collective dt in this report indicte tht upregultion of ST6Gl-I, common feture of cncer cells, promotes heightened ctivtion of EGFR s well s resistnce to gefitini-induced cell deth. Considering the immense contriution of EGFR to cncer [43, 52, 53], the estlishment of α2-6 silyltion s novel EGFR regultory mechnism could dvnce fundmentl understnding of the reltionship etween growth fctor signling nd cncer cell ehvior. Funding These studies were supported y NIH grnt R01 GM (SLB). CMB ws supported y Predoctorl Fellowship funded y the T32 GM Cell nd Moleculr Biology trining grnt. ATH ws supported Predoctorl Fellowship from the Americn Hert Assocition. Avilility of dt nd mterils All dt generted or nlyzed during this study re included in this pulished rticle. The dtsets descried in this report re ville from the corresponding uthor on resonle request. Authors contriutions CMB nd ATH were responsile for the cquisition nd nlysis of the dt. JCA nd CDW provided technicl ssistnce with the kinomics ssys nd nlysis of the dt otined from these experiments. CMB, ATH nd SLB were responsile for the concept nd design of this study, nd together wrote the mnuscript. All uthors red nd pproved the finl mnuscript. Ethics pprovl nd consent to prticipte Not pplicle. Consent for puliction Not pplicle. Competing interests The uthors declre tht they hve no competing interests. Pulisher s Note Springer Nture remins neutrl with regrd to jurisdictionl clims in pulished mps nd institutionl ffilitions. Author detils 1 Deprtment of Cell, Developmentl, nd Integrtive Biology, University of Alm t Birminghm, 350 McCllum Building, 1918 University Blvd, Birminghm, AL 35294, USA. 2 Deprtment of Rdition Oncology, University of Alm t Birminghm, th Avenue South, Birminghm, AL 35233, USA.
10 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 10 of 11 Received: 29 Novemer 2017 Accepted: 30 Jnury 2018 References 1. Dll Olio F, Chiricolo M. Silyltrnsferses in cncer. Glycoconj J. 2001;18: Vrki NM, Vrki A. Diversity in cell surfce silic cid presenttions: implictions for iology nd disese. Lortory investigtion; journl of technicl methods nd pthology. L Investig. 2007;87(9): Schultz MJ, Swindll AF, Bellis SL. Regultion of the metsttic cell phenotype y silylted glycns. Cncer Metstsis Rev. 2012;31(3-4): Swindll AF, Londono-Joshi AI, Schultz MJ, Fineerg N, Buchsum DJ, Bellis SL. ST6Gl-I protein expression is upregulted in humn epithelil tumors nd correltes with stem cell mrkers in norml tissues nd colon cncer cell lines. Cncer Res. 2013;73(7): Schultz MJ, Holdrooks AT, Chkrorty A, Grizzle WE, Lnden CN, Buchsum DJ, et l. The tumor-ssocited glycosyltrnsferse ST6Gl-I regultes stem cell trnscription fctors nd confers cncer stem cell phenotype. Cncer Res. 2016;76(13): Hsieh CC, Shyr YM, Lio WY, Chen TH, Wng SE, Lu PC, et l. Elevtion of et-glctoside lph2,6-silyltrnsferse 1 in fructoseresponsive mnner promotes pncretic cncer metstsis. Oncotrget. 2017;8(5): Lise M, Belluco C, Perer SP, Ptel R, Thoms P, Gnguly A. Clinicl correltions of lph2,6-silyltrnsferse expression in colorectl cncer ptients. Hyridom. 2000;19: RecchiMA,HerM,HornezL,Hrduin-LepersA,PeyrtJP,DelnnoyP. Multiplex reverse trnscription polymerse chin rection ssessment of silyltrnsferse expression in humn rest cncer. Cncer Res. 1998;58: Christie DR, Shikh FM, Lucs JA 4th, Lucs JA 3rd, Bellis SL. ST6Gl-I expression in ovrin cncer cells promotes n invsive phenotype y ltering integrin glycosyltion nd function. J Ovrin Res. 2008;1(1): Shikh FM, Seles EC, Clem WC, Hennessy KM, Zhuo Y, Bellis SL. Tumor cell migrtion nd invsion re regulted y expression of vrint integrin glycoforms. Exp Cell Res. 2008;314(16): Lin S, Kemmner W, Grigull S, Schlg PM. Cell surfce lph 2,6 silyltion ffects dhesion of rest crcinom cells. Exp Cell Res. 2002;276(1): Zhu Y, Srivtn U, Ullh A, Ggnej H, Berenson CS, Lnce P. Suppression of silyltrnsferse y ntisense DNA reduces invsiveness of humn colon cncer cells in vitro. Biochim Biophys Act. 2001;1536: Swindll AF, Bellis SL. Silyltion of the Fs deth receptor y ST6Gl-I provides protection ginst Fs-medited poptosis in colon crcinom cells. J Biol Chem. 2011;286(26): Holdrooks AT, Britin CM, Bellis SL. ST6Gl-I silyltrnsferse promotes tumor necrosis fctor (TNF)-medited cncer cell survivl vi silyltion of the TNF receptor 1 (TNFR1) deth receptor. J Biol Chem. 2017;Epu hed of print. 15. Amno M, Glvn M, He J, Bum LG. The ST6Gl I silyltrnsferse selectively modifies N-glycns on CD45 to negtively regulte glectin-1- induced CD45 clustering, phosphtse modultion, nd T cell deth. J Biol Chem. 2003;278(9): Kitzume S, Immki R, Ogw K, Komi Y, Futkw S, Kojim S, et l. Alph2,6-silic cid on pltelet endothelil cell dhesion molecule (PECAM) regultes its homophilic interctions nd downstrem ntipoptotic signling. J Biol Chem. 2010;285: Schultz MJ, Swindll AF, Wright JW, Sztul ES, Lnden CN, Bellis SL. ST6Gl-I silyltrnsferse confers cispltin resistnce in ovrin tumor cells. J Ovrin Res. 2013;6(1): Chen X, Wng L, Zho Y, Yun S, Wu Q, Zhu X, et l. ST6Gl-I modultes docetxel sensitivity in humn heptocrcinom cells vi the p38 MAPK/ cspse pthwy. Oncotrget. 2016;7(32): Chkrorty A, Dorsett KA, Trummell HQ, Yng ES, Oliver PG, Bonner JA, et l. ST6Gl-I silyltrnsferse promotes chemoresistnce in pncretic ductl denocrcinom y rogting gemcitine-medited DNA dmge. J Biol Chem. 2018;293(3): Duverger A, Wolschendorf F, Anderson JC, Wgner F, Bosque A, Shishido T, et l. Kinse control of ltent HIV-1 infection: PIM-1 kinse s mjor contriutor to HIV-1 rectivtion. J Virol. 2014;88(1): Anderson JC, Tylor RB, Fivesh JB, de Wijn R, Gillespie GY, Willey CD. Kinomic ltertions in typicl Meningiom. Med Res Arch 2015; Gilert AN, Shevin RS, Anderson JC, Lngford CP, Eustce N, Gillespie GY, et l. Genertion of microtumors using 3D humn iogel culture system nd ptient-derived Gliolstom cells for Kinomic profiling nd drug response testing. J Vis Exp 2016; Anderson JC, Willey CD, Meht A, Wely K, Chen D, Durte CW, et l. High throughput Kinomic profiling of humn cler cell renl cell crcinom identifies Kinse ctivity dependent moleculr sutypes. PLoS One. 2015; 10(9):e Ghosh AP, Willey CD, Anderson JC, Wely K, Chen D, Meht A, et l. Kinomic profiling identifies focl dhesion kinse 1 s therpeutic trget in dvnced cler cell renl cell crcinom. Oncotrget. 2017;8(17): Yng ES, Willey CD, Meht A, Crowley MR, Crossmn DK, Chen D, et l. Kinse nlysis of penile squmous cell crcinom on multiple pltforms to identify potentil therpeutic trgets. Oncotrget. 2017;8(13): Britin CM, Dorsett KA, Bellis SL. The Glycosyltrnsferse ST6Gl-I protects tumor cells ginst serum growth fctor withdrwl y enhncing survivl signling nd prolifertive potentil. J Biol Chem. 2017;292(11): Prk JJ, Yi JY, Jin YB, Lee YJ, Lee JS, Lee YS, et l. Silyltion of epiderml growth fctor receptor regultes receptor ctivity nd chemosensitivity to gefitini in colon cncer cells. Biochem Phrmcol. 2012;83(7): Fukumori T, Tkenk Y, Yoshii T, Kim HR, Hogn V, Inohr H, et l. CD29 nd CD7 medite glectin-3-induced type II T-cell poptosis. Cncer Res. 2003;63(23): Toscno MA, Binco GA, Ilrregui JM, Croci DO, Correle J, Hernndez JD, et l. Differentil glycosyltion of TH1, TH2 nd TH-17 effector cells selectively regultes susceptiility to cell deth. Nt Immunol. 2007;8(8): Zhuo Y, Chmms R, Bellis SL. Silyltion of et1 integrins locks cell dhesion to glectin-3 nd protects cells ginst glectin-3-induced poptosis. J Biol Chem. 2008;283(32): Liu Z, Swindll AF, Kesterson RA, Schoe TR, Bullrd DC, Bellis SL. ST6Gl-I regultes mcrophge poptosis vi lph2-6 silyltion of the TNFR1 deth receptor. J Biol Chem. 2011;286(45): Lee M, Prk JJ, Lee YS. Adhesion of ST6Gl I-medited humn colon cncer cells to fironectin contriutes to cell survivl y integrin et1-medited pxillin nd AKT ctivtion. Oncol Rep. 2010;23(3): Blume-Jensen P, Hunter T. Oncogenic kinse signlling. Nture. 2001; 411(6835): Levitzki A, Gzit A. Tyrosine kinse inhiition: n pproch to drug development. Science. 1995;267(5205): Regd T, Trgeting RTK. Signling pthwys in cncer. Cncers (Bsel). 2015; 7(3): Vlhovic G, Crwford J. Activtion of tyrosine kinses in cncer. Oncologist. 2003;8(6): Yen HY, Liu YC, Chen NY, Tsi CF, Wng YT, Chen YJ, et l. Effect of silyltion on EGFR phosphoryltion nd resistnce to tyrosine kinse inhiition. Proc Ntl Acd Sci U S A. 2015;112(22): Liu YC, Yen HY, Chen CY, Chen CH, Cheng PF, Jun YH, et l. Silyltion nd fucosyltion of epiderml growth fctor receptor suppress its dimeriztion nd ctivtion in lung cncer cells. Proc Ntl Acd Sci U S A. 2011;108(28): Mthew MP, Tn E, Seui CT, Bovonrtwet P, Sklr S, Bhttchry R, et l. Metolic flux-driven silyltion lters internliztion, recycling, nd drug sensitivity of the epiderml growth fctor receptor (EGFR) in SW1990 pncretic cncer cells. Oncotrget. 2016;7(41): Hsehir K, Tteno H, Onum Y, Ito Y, Asshim M, Hiryshi J. Structurl nd quntittive evidence for dynmic glycome shift on production of induced pluripotent stem cells. Mol Cell Proteomics. 2012;11(12): Wng YC, Stein JW, Lynch CL, Trn HT, Lee CY, Colemn R, et l. Glycosyltrnsferse ST6GAL1 contriutes to the regultion of pluripotency in humn pluripotent stem cells. Sci Rep. 2015;5: Lmert S, Vind-Kezunovic D, Krvinen S, Gnidecki R. Lignd-independent ctivtion of the EGFR y lipid rft disruption. J Invest Dermtol. 2006; 126(5): Normnno N, De Luc A, Binco C, Strizzi L, Mncino M, Miello MR, et l. Epiderml growth fctor receptor (EGFR) signling in cncer. Gene. 2006; 366(1): Perez-Torres M, Vlle BL, Mihle NJ, Negron-Veg L, Nieves-Alice R, Cor EM. Shedding of epiderml growth fctor receptor is regulted process tht occurs with overexpression in mlignnt cells. Exp Cell Res. 2008; 314(16): Toms A, Futter CE, Eden ER. EGF receptor trfficking: consequences for signling nd cncer. Trends Cell Biol. 2014;24(1): Azimzdeh Irni M, Knnn S, Verm C. Role of N-glycosyltion in EGFR ectodomin lignd inding. Proteins. 2017;85(8):
11 Britin et l. Journl of Ovrin Reserch (2018) 11:12 Pge 11 of Fernndes H, Cohen S, Bishyee S. Glycosyltion-induced conformtionl modifiction positively regultes receptor-receptor ssocition: study with n errnt epiderml growth fctor receptor (EGFRvIII/DeltEGFR) expressed in cncer cells. J Biol Chem. 2001;276(7): Kszu K, Grzyek M, Orlowski A, Dnne R, Rog T, Simons K, et l. N- Glycosyltion s determinnt of epiderml growth fctor receptor conformtion in memrnes. Proc Ntl Acd Sci U S A. 2015;112(14): Tsud T, Iked Y, Tniguchi N. The Asn-420-linked sugr chin in humn epiderml growth fctor receptor suppresses lignd-independent spontneous oligomeriztion. Possile role of specific sugr chin in controllle receptor ctivtion. J Biol Chem. 2000;275(29): Whitson KB, Whitson SR, Red-Brewer ML, McCoy AJ, Vitli AA, Wlker F, et l. Functionl effects of glycosyltion t Asn-579 of the epiderml growth fctor receptor. Biochemistry. 2005;44(45): Gui T, Shen K. The epiderml growth fctor receptor s therpeutic trget in epithelil ovrin cncer. Cncer Epidemiol. 2012;36(5): Rymond E, Fivre S, Armnd JP. Epiderml growth fctor receptor tyrosine kinse s trget for nticncer therpy. Drugs. 2000;60(Suppl 1): discussion Slichenmyer WJ, Fry DW. Anticncer therpy trgeting the erb fmily of receptor tyrosine kinses. Semin Oncol. 2001;28(5 Suppl 16): Sumit your next mnuscript to BioMed Centrl nd we will help you t every step: We ccept pre-sumission inquiries Our selector tool helps you to find the most relevnt journl We provide round the clock customer support Convenient online sumission Thorough peer review Inclusion in PuMed nd ll mjor indexing services Mximum visiility for your reserch Sumit your mnuscript t
SUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationThe effects of trastuzumab on HER2-mediated cell signaling in CHO cells expressing human HER2
Mdi et l. BMC Cncer (2018) 18:238 https://doi.org/10.1186/s12885-018-4143-x RESEARCH ARTICLE Open Access The effects of trstuzum on HER2-medited cell signling in CHO cells expressing humn HER2 Hmid Mdi,
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationArachidonic acid induces ERK activation via Src SH2 domain association with the epidermal growth factor receptor
http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology originl rticle Archidonic cid induces ERK ctivtion vi Src SH2 domin ssocition with the epiderml growth fctor receptor LD Alexnder
More informationTMPYP4 exerted antitumor effects in human cervical cancer cells through activation of p38 mitogen activated protein kinase
Cheng nd Co Biol Res (27) 5:24 DOI.86/s4659-7-29-4 Biologicl Reserch RESEARCH ARTICLE Open Access TMPYP4 exerted ntitumor effects in humn cervicl cncer cells through ctivtion of p38 mitogen ctivted protein
More informationCheckMate 153: Randomized Results of Continuous vs 1-Year Fixed-Duration Nivolumab in Patients With Advanced Non-Small Cell Lung Cancer
CheckMte 53: Rndomized Results of Continuous vs -Yer Fixed-Durtion Nivolumb in Ptients With Advnced Non-Smll Cell Lung Cncer Abstrct 297O Spigel DR, McCleod M, Hussein MA, Wterhouse DM, Einhorn L, Horn
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationMicroRNA 17 5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling
DOI 1.1186/s479-15-35-2 RESEARCH Open Access MicroRNA 17 5p induces drug resistnce nd invsion of ovrin crcinom cells y trgeting PTEN signling Ying Fng 1,2, Chngyn Xu 3 nd Yn Fu 1* Astrct Bckground: The
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationPlatelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection
Vol 455 18 Septemer 28 doi:1.138/nture729 LETTERS Pltelet-derived growth fctor- receptor ctivtion is required for humn cytomeglovirus infection Lilin Sorocenu 1, Armin Akhvn 1 & Chrles S. Cos 1,2 Humn
More informationIrs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling
Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationRas enhances TGF-β signaling by decreasing cellular protein levels of its type II receptor negative regulator SPSB1
Liu et l. Cell Communiction nd Signling (2018) 16:10 https://doi.org/10.1186/s12964-018-0223-4 RESEARCH Open Access Rs enhnces TGF-β signling y decresing cellulr protein levels of its type II receptor
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationOvercoming EGFR T790M-based Tyrosine Kinase Inhibitor Resistance with an Allele-specific DNAzyme
Cittion: Moleculr Therpy Nucleic Acids (214) 3, e15; doi:1.138/mtn.214.3 214 The Americn Society of Gene & Cell Therpy All rights reserved 2162-2531/14 www.nture.com/mtn Overcoming T79M-sed Tyrosine Kinse
More informationEfficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
More informationNdfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells
Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher
More informationIGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
More informationAxl Promotes Cutaneous Squamous Cell Carcinoma Survival through Negative Regulation of Pro-Apoptotic Bcl-2 Family Members
ORIGINAL ARTICLE Axl Promotes Cutneous Squmous Cell Crcinom Survivl through Negtive Regultion of Pro-Apoptotic Bcl-2 Fmily Memers Emmnouil S. Ppdkis 1, Monik A. Cichoń 1, Jshmin J. Vys 1, Nkul Ptel 1,
More informationIGF-I and IGFBP-3 augment transforming growth factor-b actions in human renal carcinoma cells
originl rticle http://www.kidney-interntionl.org & Interntionl Society of Nephrology IGF-I nd IGFBP-3 ugment trnsforming growth fctor-b ctions in humn renl crcinom cells AH Rosendhl 1, nd G Forsberg 1
More informationJournal of Hainan Medical University.
132 Journl of Hinn Medicl University 2017; 23(11): 132-136 Journl of Hinn Medicl University http://www.hnykdxxb.com Assessment of the efficcy nd sfety of bronchil rtery perfusion chemotherpy combined with
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationMechanisms of Tanshinone II a inhibits malignant melanoma development through blocking autophagy signal transduction in A375 cell
Li et l. BMC Cncer (2017) 17:357 DOI 10.1186/s12885-017-3329-y RESEARCH ARTICLE Open Access Mechnisms of Tnshinone II inhiits mlignnt melnom development through locking utophgy signl trnsduction in A375
More informationLuteolin decreases IGF-II production and downregulates insulin-like growth factor-i receptor signaling in HT-29 human colon cancer cells
Lim et l. MC Gstroenterology 212, 12:9 http://www.iomedcentrl.com/1471-23x/12/9 RESERCH RTICLE Luteolin decreses IGF-II production nd downregultes insulin-like growth fctor-i receptor signling in HT-29
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationNovel microtubule inhibitor MPT0B098 inhibits hypoxia-induced epithelial-tomesenchymal transition in head and neck squamous cell carcinoma
Tsi et l. Journl of Biomedicl Science (2018) 25:28 https://doi.org/10.1186/s12929-018-0432-6 RESEARCH Novel microtuule inhiitor MPT0B098 inhiits hypoxi-induced epithelil-tomesenchyml trnsition in hed nd
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationA rt i c l e s. a Events (% of max)
Continuous requirement for the TCR in regultory T cell function Andrew G Levine 1,, Aron Arvey 1,,4, Wei Jin 1,,4 & Alexnder Y Rudensky 1 3 14 Nture Americ, Inc. All rights reserved. Foxp3 + regultory
More informationCD43-independent augmentation of mouse T-cell function by glycoprotein cleaving enzymes
IMMUNOLOGY ORIGINAL ARTICLE CD43-independent ugmenttion of mouse T-cell function y glycoprotein cleving enzymes Scott B. Berger 1 Amir A. Sdighi Akh 2 Richrd A. Miller 2,3,4 nd Gonzlo G. Grci 2 1 Deprtment
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationTargeting mir-21 for the Therapy of Pancreatic Cancer
originl rticle The Americn Society of Gene & Cell Therpy Trgeting mir-21 for the Therpy of Pncretic Cncer Flvie Sicrd 1,2, Mrion Gyrl 1,2, Huert Lulk 1,2, Louis Buscil 1,2 nd Pierre Cordelier 1,2 1 INSERM
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationSupplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More informationMolecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationNot for Citation or Publication Without Consent of the Author
Not for Cittion or Puliction Without Consent of the Author AN AUTOMATED SEX PHEROMONE TRAP FOR MONITORING ADULT CM AND OFM AND THE INFLUENCE OF TRAP COLOR ON MOTH AND NON-TARGET CAPTURES Brin L. Lehmn
More informationBreastDefend enhances effect of tamoxifen in estrogen receptor-positive human breast cancer in vitro and in vivo
Cheng et l. BMC Complementry nd Alterntive Medicine (217) 17:115 DOI 1.1186/s1296-17-1621-7 RESEARCH ARTICLE BrestDefend enhnces effect of tmoxifen in estrogen receptor-positive humn rest cncer in vitro
More informationStudy on the association between PI3K/AKT/mTOR signaling pathway gene polymorphism and susceptibility to gastric
JBUON 2017; 22(6): 1488-1493 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mil: editoril_office@jbuon.com ORIGINAL ARTICLE Study on the ssocition between PI3K/AKT/mTOR signling pthwy gene polymorphism
More informationInhibition of PI3K/Akt/mTOR overcomes cisplatin resistance in the triple negative breast cancer cell line HCC38
Gohr et l. BMC Cncer (2017) 17:711 DOI 10.1186/s12885-017-3695-5 RESEARCH ARTICLE Open Access Inhibition of PI3K/Akt/mTOR overcomes cispltin resistnce in the triple negtive brest cncer cell line HCC38
More informationCD160 inhibits activation of human CD4 + T cells through interaction with herpesvirus entry mediator
CD16 inhiits ctivtion of humn CD4 + T cells through interction with herpesvirus entry meditor Guifng Ci, Anuknth Anumnthn, Juli A Brown, Edwrd A Greenfield, Bogong Zhu & Gordon J Freemn CD16, glycosylphosphtidylinositol-nchored
More informationInterleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes
ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,
More informationDownregulation of Notch regulated Ankyrin Repeat Protein Exerts Antitumor Activities against Growth of Thyroid Cancer
Originl Article Downregultion of Notch regulted Ankyrin Repet Protein Exerts Antitumor Activities ginst Growth of Thyroid Cncer Bing Feng Chu 1,2, Yi Yu Qin 3, Sheng Li Zhng 2, Zhi Wei Qun 2, Ming Di Zhng
More informationA case of pulmonary adenocarcinoma showing rapid progression of peritoneal dissemination after immune checkpoint inhibitor therapy
Shinozki et l. BMC Cncer (2018) 18:620 https://doi.org/10.1186/s12885-018-4549-5 CASE REPORT A cse of pulmonry denocrcinom showing rpid progression of peritonel dissemintion fter immune checkpoint inhiitor
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationARTICLE. J. E. Bowe & A. Chander & B. Liu & S. J. Persaud & P. M. Jones
Dietologi (23) 56:783 79 DOI.7/s25-2-2828-2 ARTICLE The permissive effects of glucose on receptor-operted potentition of insulin secretion from mouse islets: role for ERK/2 ctivtion nd cytoskeletl remodelling
More informationThe endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages
The endoplsmic reticulum is the site of cholesterol-induced cytotoxicity in mcrophges Bo Feng 1, Pin Mei Yo 1, Ynkun Li 1, Cecili M. Devlin 1, Djun Zhng 1, Hether P. Hrding 2, Michele Sweeney 3, Jmes X.
More informationGinsenoside from Panax ginseng Meyer Enhances the Cytotoxic and Apoptotic Effect of Cisplatin in A549 Human Lung Cancer Cells
Ginsenoside from Pnx ginseng Meyer Enhnces the ytotoxic nd Apoptotic Effect of ispltin in A549 Humn Lung ncer ells J. K. PARK, V. ASTRO-AEITUNO, S. AHN, S. Y. SIMU 1, M. H. SIDDIQI 1, D. H. KIM, Y. J.
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationPolymer-Coated Metal-Oxide Nanoparticles Inhibit IgE Receptor Binding, Cellular Signaling, and Degranulation in a Mast Cell-like Cell Line
www.mterilsviews.com Polymer-Coted Metl-Oxide Nnoprticles Inhiit IgE Receptor inding, Cellulr Signling, nd Degrnultion in Mst Cell-like Cell Line Vn. Orteg, Jmes D. Ede, Dvid oyle, Jmes L. Stfford, nd
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationT-Cadherin Is an Auxiliary Negative Regulator of EGFR Pathway Activity in Cutaneous Squamous Cell Carcinoma: Impact on Cell Motility
OIGINAL ATICLE T-Cdherin Is n Auxiliry Negtive egultor of EGF Pthwy Activity in Cutneous qumous Cell Crcinom: Impct on Cell Motility Emmnouil Kyrikkis 1,4, Kseniy Mslov 1,4, Mri Philippov 1, Dennis Pfff
More informationIdentification of a tripartite interaction between the N terminus of HIV 1 Vif and CBFβ that is critical for Vif function
DOI 1.1186/s12977-17-346-5 Retrovirology RESEARCH Open Access Identifiction of triprtite interction etween the N terminus of HIV 1 nd CBFβ tht is criticl for function Belete A. Desimmie 1, Jessic L. Smith
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationFoxP3 + regulatory CD4 T cells control the generation of functional CD8 memory
Received Fe Accepted 6 Jul Pulished 7 Aug DOI:.8/ncomms99 FoxP + regultory CD T cells control the genertion of functionl memory M.G. de Goër de Herve,,, S. Jfour,,, M. Vllée, & Y. Toufik, During the primry
More informationPrognostic significance of pretreatment serum levels of albumin, LDH and total bilirubin in patients with nonmetastatic
Crcinogenesis, 2015, Vol. 36, No. 2, 243 248 doi:10.1093/crcin/bgu247 Advnce Access publiction December 18, 2014 Originl Mnuscript originl mnuscript Prognostic significnce of pretretment serum levels of
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationTjomsland et al. Journal of Experimental & Clinical Cancer Research (2016) 35:122 DOI /s
Tjomslnd et l. Journl of Experimentl & Clinicl Cncer Reserch (216) 35:122 DOI 1.1186/s1346-16-4-5 RESEARCH The TGFβ-SMAD3 pthwy inhiits IL-1α induced interctions etween humn pncretic stellte cells nd pncretic
More informationThe Effect of Substituting Sugar with Artificial. Sweeteners on the Texture and Palatability of Pancakes
The Effect of Sustituting Sugr with Artificil NUTR 453 Sweeteners on the Texture nd Pltility of Pnckes Jmie Wldron, Rquel Reyes, nd Reecc Legi 1 I. Astrct The effects of replcing sugr with Stevi nd Splend
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationNonpharmacologic Interventions for Treatment-Resistant Depression in Adults Executive Summary
Comprtive Effectiveness Review Numer 33 Effective Helth Cre Progrm Nonphrmcologic Interventions for Tretment-Resistnt Depression in Adults Executive Summry Bckground Mjor depressive disorder (MDD) is common
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationComparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages
Murk et l. Respirtory Reserch (2018) 19:126 https://doi.org/10.1186/s12931-018-0825-9 RESEARCH Comprison of pro- nd nti-inflmmtory responses in pired humn primry irwy epithelil cells nd lveolr mcrophges
More informationCalcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins
Clcineurin imposes T cell unresponsiveness through trgeted proteolysis of signling proteins Vigo Heissmeyer, Fernndo Mcián,5, Sin-Hyeog Im,5, Rjt Vrm 2, Stefn Feske, K Venuprsd 3, Hu Gu 4, Yun-Ci Liu 3,
More information