b 0.50 Synonymous Subtype

Transcription

1 omatic mutation count Mutations per Mb a 80 * b 0.50 ynonymous Non-synonymous c 0 Fibroadenoma Phyllodes 0.00 ubtype Benign Borderline MAL upplementary Figure 1 Landscape of somatic mutations in phyllodes tumors (a) omatic mutation counts in fibroadenoma and phyllodes tumor. *p< (b) Frequency of mutations per case in 22 phyllodes tumors, expressed as number of mutations per megabase (Mb) of covered target sequence. Histological subtypes of each patient are reported at the bottom (Green, benign; orange, borderline; red, malignant). (c) Mutational signature in 22 pairs phyllodes tumors.

2 A b e rra tio n c o u n ts * *** *** n.s. *** ** 5 0 F ib ro a d e n o m a B e n ig n B o rd e rlin e M a lig n a n t upplementary Figure 2 Pattern of copy number alterations (CNAs) in fibroepithelial tumors Copy number aberration counts of the 50 targeted genes in 100 fibroepithelial tumors. In general, higher grade tumors tend to harbor more CNAs compared to their lower grade counterparts. N.., non significant. *p<0.05, **p<0.01, ***p<0.001.

3 B-allele frequency B-allele frequency a ample 1011 ample 1016 chr3 TD2 chr3 TD2 b ample 1019 chr13 RB1 chr17 TP53 chr17 NF1 upplementary Figure 3 Loss-of-heterozygosity (LOH) of tumor suppressor genes in fibroepithelial tumors Mutations in TD2, TP53, NF1 and RB1 are associated with LOH in higher-grade phyllodes tumors (borderline/malignant). B-allele frequency plots were generated using the Control-FRC. These samples (1011, 1016, 1019) contained an extremely high stromal compartment (>90%), which is characteristic of higher-grade phyllodes tumors (Ref 1) and it is not unusual to observe near-homogeneous tumors at these grades.

4 Number of variants % 30% 29% 16% 13% 4% 6% 7% 4% 4% 4% 3% 3% 4% 3% 1% 3% 2% 2% 1% Missense In-frame Frameshift Nonsense plice site Loss Gain FA (16) Phyllodes tumor(53) ubtype Fibroadenoma Benign (26) Borderline (21) MAL(6) MD12 RARA FLNA TD2 MLL2 BCOR MAP3K1 NF1 RB1 PIK3CA GFR TP53 RBB4 PCLO DNAH11 YN1 RUNX1 CHD8 PCNXL4 RO1 upplementary Figure 4 Genomic landscapes of breast fibroepithelial tumors in 69 matched tumornormal pairs Distribution of recurrently mutated genes identified by targeted sequencing in 69 fibroepithelial tumors with matched normal, including 16 fibroadenomas and 53 phyllodes tumors. Top, Colored rectangles indicate mutation categories (somatic mutations and copy number alterations) observed in the cohort. Histological subtypes of each patient are reported at the upper panel (Light green, fibroadenoma; light blue, benign phyllodes tumor; light red, borderline phyllodes tumor; brown, malignant phyllodes tumor). Center, recurrently mutated genes grouped with colored frames. Black, mutations common to all fibroepithelial tumors; blue, mutations in phyllodes tumors of all grades; red, mutations specific to high-grade phyllodes tumors. Colored dots indicate additional mutations or copy number alterations in the same patient.

5 ample1020 ample1002 ample1015 Number of mutations V298G 329K F370Y V528M D605N V711A 657fs 878K D1504N D1571H D1586G G1623V I1722V Y L R2288fs K2515fs a b FLNA p. Y1235H, c.3703t>c FLNA p. A1191T, c.3571g>a FLNA p. G1578C, c.4732g>t upplementary Figure 5 Distribution of somatic mutations in FLNA in breast cancer and cdna anger sequencing of FLNA in phyllodes tumors (a) Domain structure of the FLNA protein and the alterations identified in breast cancer from published data sets available from cbioportal (TCGA, ref. 40). CH, Calponin homology domain. IG-FLMN, Filamin-type immunoglobulin domains. FLNA clustering mutations in fibroepithelial tumors are highlighted in blue rectangles. (b) cdna anger sequencing of FLNA variants in 3 fresh frozen phyllodes tumors.

6 Log(normalized read count) ample 1076 GFR gain -2-1 IHC (GFR) a ample 1056 GFR gain b ample 1056 upplementary Figure 6 GFR Amplification in Borderline/Malignant phyllodes tumors (a). Pattern of GFR amplification in borderline (sample 1056) and malignant (sample 1076) phyllodes tumors. (b). Representative image of IHC staining of GFR indicates the protein level and location of GFR in borderline phyllodes tumors (sample 1056). GFR protein is exclusively localized in stromal cells and absent from epithelial cells.cale bar, 100 μm.

7 pithelium troma Bulk a ample 1007 troma pithelium b MD12 p. G44V, c.131g>t RARA p.n299, c.896a>g BRCA1 p. T1249P, c.3745a>c upplementary Figure 7 Laser Capture Microdissection (LCM) and anger sequencing (a) Hematoxylin and eosin (H&) stain of a section of ample pithelial compartments are marked in green. : troma; : pithelium. (b) anger sequencing of MD12, RARA and BRCA1 in bulk tissue, epithelial and stromal compartments, showing that mutations are exclusive to the stromal compartment.

8 pithelium troma c ample1001 MD12 Aberrant splice site, c. 100T>A RARA p. M406fs, c. 926delGCCGCCTCTC pithelium troma upplementary Figure 7 Continued (c) Left Hematoxylin and eosin (H&) stain of a section of ample1001. pithelial compartments are marked in green. : troma; : pithelium. Right, anger sequencing of MD12 and RARA in epithelial and stromal compartments, showing that mutations are exclusive to the stromal compartment rather than epithelium.

9 pithelium troma MD12 p.vkqgfnnq41del, c.121deltaaaacaaggtttcaataaccagc pithelium troma pithelium troma d ample1002 FLNA p.a1191t c.3571g>a TD2 p.r1710fs, c. 5130delC upplementary Figure 7 Continued (d) Left Hematoxylin and eosin (H&) stain of a section of ample1002. pithelial compartments are marked in green. : troma; : pithelium. Right, anger sequencing of MD12, FLNA and TD2 in epithelial and stromal compartments, showing that mutations are exclusive to the stromal compartment rather than epithelium.

10 pithelium troma e ample1011 PIK3CA p. H1047L, c. 3297A>T uppementary Figure 7 Continued (e) Left Hematoxylin and eosin (H&) stain of a section of ample pithelial compartments are marked in green. : troma; : pithelium. Right, anger sequencing of PIK3CA in epithelial and stromal compartments, showing that mutations are exclusive to the stromal compartment rather than epithelium.

11 f ample 1012 MD12 p.g44d, c.131g>a pithelium troma upplementary Figure 7 Continued (f) Left, Hematoxylin and eosin (H&) stain of a section of ample1012. pithelial compartments are marked in green. : troma; : pithelium. Right, anger sequencing of MD12 in epithelial and stromal compartments, showing that mutations are exclusive to the stromal compartment rather than epithelium.

12 pithelium troma pithelium troma pithelium troma g ample1015 MD12 p.37_45talnvkqgf>i, c. 110delGGCCTTGAATGTAAAACAAGGTTT (24bp) RARA p.g289r, c.865g>a FLNA p.g1578c c.4732g>t upplementary Figure 7 Continued (g) Left, Hematoxylin and eosin (H&) stain of a section of ample pithelial compartments are marked in green. : troma; : pithelium. Right, anger sequencing of MD12, RARA and FLNA in epithelial and stromal compartments, showing that mutations are exclusive to the stromal compartment rather than epithelium.

13 M D 1 2 R A R A F L N A T D 2 K M T 2 D R B 1 R B B 4 G F R N F 1 B C O R P C L O D N A H 1 1 Y N 1 R U N X 1 C H D 8 P C N X L 4 R O 1 M A P 3 K 1 T P 5 3 P I K 3 C A G A T A 3 C D H 1 F re q u e n c y o f m u ta tio n (% ) F ib r o a d e n o m a ( 2 1 ) P h y llo d e s tu m o r ( 7 9 ) B re a s t c a r c in o m a (5 0 7 ) upplementary Figure 8 Comparison of the mutation spectra in fibroadenoma, phyllodes tumor and breast carcinoma hown are genes that were recurrently mutated in fibroadenomas and phyllodes tumors based on targeted-sequencing analysis, as well as representative genes known to be significantly mutated in breast carcinomas (TP53, PIK3CA, MAP3K1, GATA3 and CDH1). The bar graph in red shows the frequency of mutations collected from a recent report (Ref. 18).

14 IHC (GFR) H& FA Malignant PT FA Borderline PT FA Benign PT FA Borderline PT FA Borderline PT ample 1021 ample 1052 ample 1129 ample 1166 ample 1150 a ample 1052 b Concurrent Longitudinal FA RBB4 mutation GFR Amp PT FA Gene MD12 MD12 MD12 MD12 RARA RARA FLNA MAP3K1 Alteration p.g44d p.g44 p.g44r plice_ite p.a104v p.t186n p.gh1607_1608d p.637t NF1 P.Y1106H RB1 p.l649fs RB1 p.p796fs RB1 plice_ite TP53 p.c97fs TP53 p.v11m RBB4 p.1168x GFR Gain Missense Nonsense In-frame plice site Frameshift upplementary Figure 9 Targeted-sequencing in concurrent and longitudinal fibroadenomas and phyllodes tumors (a) xample of fibroadenoma and phyllodes tumor used for macrodissection and targeted sequencing. H&-stained section of concurrent fibroadenoma and phyllodes tumor selected for macrodissection from one patient in whom mutations and gain of cancerassociated genes are exclusively localized in fibroadenoma s. cale bar, 100 μm. Bottom, IHC-staining with GFR showing the protein in phyllodes tumor area but not in fibroadenoma -like areas. phyllodes tumor areas are marked in green and FA-like areas are marked in Red. cale bar, 50 μm. (b) pectrum of somatic mutations in concurrent and longitudinal fibroadenomas/phyllodes tumors. Histological subtypes of each patient are reported at the upper panel (Yellow, concurrent fibroadenoma/phyllodes tumor; orange, longitudinal fibroadenoma/phyllodes tumor ). Bottom, colored rectangles indicate mutation/copy number alteration categories Gain

15 RB1 p.k63*, c.187 G>T GFR p.t263p, c.784 A>C upplementary Figure 10 anger sequencing of RB1 and GFR in tumor and matched normal of ample 004

16 upplementary Table 1: Clinical characteristics of fibroepithelial tumor patients. No. pecimen ID AG (yr) thnicity ize of Histological Tumour Type of urgery Diagnosis (mm) 1 ample001* 42 Chinese 25 xcision FA 2 ample Chinese 35 xcision FA 3 ample Malay 25 xcision FA 4 ample Chinese 25 xcision FA 5 ample Others 50 xcision FA 6 ample Chinese 40 xcision FA 7 ample Others 80 xcision FA 8 ample Chinese 40 xcision FA 9 ample Chinese 40 xcision FA 10 ample013* 50 Chinese 70 Wide xcision FA 11 ample014* 25 Indian 30 xcision FA 12 ample015* 17 Malay 65 xcision FA 13 ample016* 42 Indian 37 xcision FA 14 ample Malay 15 xcision FA 15 ample Chinese 11 xcision FA 16 ample Chinese 25 xcision FA 17 ample Chinese 13 xcision FA 18 ample Chinese 39 xcision FA 19 ample Chinese 20 xcision FA 20 ample Chinese 30 xcision FA 21 ample Chinese 45 xcision FA 22 ample Chinese 180 xcision Benign PT 23 ample Others 140 xcision Benign PT 24 ample Chinese 120 xcision Benign PT 25 ample Others 63 Wide xcision Benign PT 26 ample Chinese 35 xcision Benign PT 27 ample Indian 650 xcision Benign PT 28 ample Chinese 90 xcision Benign PT 29 ample Malay 45 xcision Benign PT 30 ample Malay 67 xcision Benign PT 31 ample Chinese 80 MAC Benign PT 32 ample Chinese 95 xcision Borderline PT 33 ample Chinese 28 xcision Borderline PT 34 ample Indian 20 Wide xcision Borderline PT 35 ample Chinese 48 xcision Borderline PT 36 ample Chinese 190 Mastectomy Borderline PT 37 ample Others 50 Wide xcision Borderline PT 38 ample Chinese 44 MAC Borderline PT 39 ample Malay 32 Wide xcision Borderline PT 40 ample Malay 63 Wide xcision Malignant PT 41 ample Malay 220 Mastectomy Malignant PT 42 ample Chinese 80 MAC Malignant PT 43 ample Others 200 Total Mastectomy Malignant PT

17 44 ample1024* 44 Chinese 50 Mastectomy Benign PT 45 ample1025* 41 Indian 80 xcision Benign PT 46 ample Indian 55 xcision Benign PT 47 ample Malay 60 xcision Benign PT 48 ample Malay 60 xcision Benign PT 49 ample Indian 40 xcision Benign PT 50 ample Others 35 xcision Benign PT 51 ample Malay 220 MAC Benign PT 52 ample Chinese 25 xcision Benign PT 53 ample Chinese 50 xcision Benign PT 54 ample Others 60 xcision Benign PT 55 ample Malay 55 xcision Benign PT 56 ample Chinese 250 Total Mastectomy Benign PT 57 ample Malay 40 Wide xcision Benign PT 58 ample Malay 120 Total Mastectomy Benign PT 59 ample1039* 55 Malay 55 MAC Benign PT 60 ample1040* 46 Chinese 220 MAC Benign PT 61 ample1041* 55 Chinese 60 Wide xcision Benign PT 62 ample1042* 20 Chinese 48 xcision Benign PT 63 ample1043* 48 Indian 25 Wide xcision Benign PT 64 ample1044* 31 Others 95 Wide xcision Benign PT 65 ample Malay 28 xcision Benign PT 66 ample Chinese 53 xcision Benign PT 67 ample Chinese 40 xcision Benign PT 68 ample Others 90 Mastectomy Borderline PT 69 ample1047* 63 Malay 150 Mastectomy Borderline PT 70 ample1048* 51 Chinese 100 Mastectomy Borderline PT 71 ample Chinese 40 Wide xcision Borderline PT 72 ample Malay 180 Wide xcision Borderline PT 73 ample Chinese 50 Wide xcision Borderline PT 74 ample Chinese 80 Mastectomy Borderline PT 75 ample Malay 200 Mastectomy Borderline PT 76 ample Chinese 190 MAC Borderline PT 77 ample Chinese 120 MAC Borderline PT 78 ample Malay 120 xcision Borderline PT 79 ample Chinese 100 MAC Borderline PT 80 ample1058* 61 Chinese 40 xcision Borderline PT 81 ample1059* 52 Malay 45 Wide xcision Borderline PT 82 ample1060* 47 Chinese 125 Mastectomy Borderline PT 83 ample1061* 55 Malay 250 MAC Borderline PT 84 ample1062* 57 Chinese 82 Mastectomy Borderline PT 85 ample1063* 35 Chinese 190 Mastectomy Borderline PT 86 ample1064* 57 Malay 120 MAC Borderline PT 87 ample1065* 55 Malay 85 Wide xcision Borderline PT 88 ample1066* 36 Others 250 MAC Borderline PT 89 ample1067* 43 Chinese 30 xcision Borderline PT 90 ample1068* 37 Others 100 Mastectomy Borderline PT

18 91 ample1069* 58 Chinese 30 xcision Borderline PT 92 ample Chinese 50 xcision Borderline PT 93 ample Chinese 40 xcision Borderline PT 94 ample Chinese 45 Wide xcision Borderline PT 95 ample1073* 39 Chinese 50 Mastectomy Malignant PT 96 ample Chinese 250 Mastectomy Malignant PT 97 ample1075* 51 Chinese 135 Mastectomy Malignant PT 98 ample Chinese 50 Total Mastectomy Malignant PT 99 ample1077* 47 Malay 40 Mastectomy Malignant PT 100 ample1078* 41 Chinese 165 Mastectomy Malignant PT Note: Whole exome-sequenced samples are highlighted in green. MAC: imple Mastectomy and Axillary Clearance * amples without matched normals (31 cases)

19 upplementary Table 2: ummary of whole-exome sequencing of phyllodes tumors and matched normal ample ID ample Type Reads Mapped to Target Region Average Coverage Targeted Bases with Depth at Least 20X (%) Candidate somatic mutations ample1001n ample1002n ample1003n ample1004n ample1005n ample1006n ample1007n ample1008n ample1009n ample1010n ample1011n ample1012n ample1013n ample1014n ample1015n ample1016n ample1017n ample1018n ample1019n ample1020n ample1021n ample1022n 151,553, ,185, ,478, ,906, ,071,108 86,296, ,971, ,755, ,178, ,540, ,214, ,714, ,022, ,165, ,396, ,426, ,561, ,260, ,981, ,401, ,145, ,826, ample1001t ample1002t ample1003t ample1004t ample1005t ample1006t ample1007t ample1008t ample1009t ample1010t ample1011t ample1012t ample1013t ample1014t ample1015t ample1016t ample1017t ample1018t ample1019t ample1020t ample1021t ample1022t 106,089, ,052, ,795, ,979, ,666, ,022, ,574, ,081, ,123, ,025, ,898, ,118, ,892, ,811, ,693, ,554, ,815, ,830, ,992, ,581, ,861, ,726, Average

20 upplementary Table 4: List of genes selected for targeted sequencing No. Gene FA* PT** BC# 1 DNAH11 2 MD12 3 PCLO 4 RARA 5 NOTCH2 6 YN1 7 FLNA 8 KMT2D 9 TD2 10 RB1 11 TP53 12 BCOR 13 GFR 14 RBB4 15 NF1 16 PIK3CA 17 ADAMT18 18 AXL1 19 BRCA1 20 CHD4 21 CHD8 22 COL27A1 23 FGFBP1 24 JAK2 25 PCNXL4 27 PIK3CG 28 RBM6 30 TAT3 31 TT3 32 MAD4 29 RO1 26 PHOX2B 33 AKT1 34 CBFB 35 CDH1 36 CDKN1B 37 CTCF 38 FOXA1 39 GATA3 40 MAP2K4 41 MAP3K1 42 MLL3 43 NCOR1 44 PIK3R1 45 PTN

21 46 RUNX1 47 F3B1 48 TBX3 49 UH2A 50 ZBD4 * Genes selected from our previous study of FA are highlighted in yellow (Ref 2) ** Genes selected from PTs are highlighted in blue and recurently mutated genes in discovery cohort of PTs in bold # The genes are selected from publications in red (Refs 18-21)

22 upplementary Table 6: Copy number alterations of the 50 targeted genes in 100 fibroepithelial tumors pecimen ID Gene ymbol Transcript ID Chromosome tart nd Copy Number P-value Q-value ample1076 GFR CCD chr ample1056 GFR CCD chr ample1076 NF1 CCD chr ample1078 NF1 CCD chr ample1078 NF1 CCD chr ample1074 PTN CCD chr ample1011 TD2 CCD chr ample1078 TP53 CCD chr Note: Genes with copy number estimates less than 1.5 or more than 10 were considered to have copy number losses or gains. For copy number alterations, only loss of tumor supressor genes and amplification of oncogenes are included. P-values and q-values are generated by the OncoCNV algorithm.

23 upplementary Table 7: pithelial hyperplasia in phyllodes tumors Number of phyllodes tumors pithelial with assessable epithelial hyperlasia compartment (total Percentage(%) number=65) Nil Mild Moderate Florid Note: Nil= No epithelial hyperlasia

24 upplementary Table 8: omatic mutations detected by targeted sequencing in 3 concurrent and 2 longitudinal fibroepithelial tumors Gene ymbol pecimen ID Transcript ID Nucleotide (genomic) Nucleotide (cdna) Amino acid (protein) Mutation type Total Read Depth Variant Read Depth Variant Allele Frequency (%) In COMIC? IFT POLYPHN2 NF1 ample 1021_PT CCD g.chr17: T>C c.3316 T>C p.tyr1106his Missense_Mutation No Tolerated Possibly damaging RB1 ample 1021_PT CCD g.chr13: delt c.1947delt p.leu649fs Frameshift No NA NA RB1 ample 1021_PT CCD g.chr13: instt c.2388instt p.pro796fs Frameshift No NA NA TP53 ample 1021_PT CCD g.chr17: delac c.289_290deltg p.cys97fs Frameshift Yes NA NA RBB4 ample 1052_PT CCD g.chr2: C>A c.3502 G>T p.glu1168* Nonsense_Mutation No NA NA MD12 ample 1129_FA CCD g.chrx: T>A c.100 T>A plice_ite plice_ite Yes Damaging NA MD12 ample 1129_PT CCD g.chrx: T>A c.100 T>A plice_ite plice_ite Yes Damaging NA RARA ample 1129_PT CCD g.chr17: C>A c.557 C>A p.thr186asn Missense_Mutation No Damaging Probably damaging MD12 ample 1150_FA CCD g.chrx: G>C c.130 G>C p.gly44arg Missense_Mutation Yes Damaging Probably damaging FLNA ample 1150_PT CCD g.chrx: delggc c.4822delggc GlyHis1607_1608A Inframe No NA NA MD12 ample 1150_PT CCD g.chrx: G>A c.130 G>A p.gly44er Missense_Mutation Yes Damaging Probably damaging TP53 ample 1150_PT CCD g.chr17: C>T c.427 G>A p.val143met Missense_Mutation Yes Damaging Probably damaging MAP3K1 ample1166_fa CCD g.chr5: G>C c.1910 G>C p.er637thr Missense_Mutation No Damaging Benign MD12 ample1166_fa CCD g.chrx: G>A c.131 G>A p.gly44asp Missense_Mutation Yes Damaging Probably damaging RARA ample1166_fa CCD g.chr17: C>T c.311 C>T p.ala104val Missense_Mutation No Damaging Benign MAP3K1 ample1166_pt CCD g.chr5: G>C c.1910 G>C p.er637thr Missense_Mutation No Damaging Benign MD12 ample1166_pt CCD g.chrx: G>A c.131 G>A p.gly44asp Missense_Mutation Yes Damaging Probably damaging RARA ample1166_pt CCD g.chr17: C>T c.311 C>T p.ala104val Missense_Mutation No Damaging Benign RB1 ample1166_pt CCD g.chr13: A>C c.1961 plice_ite plice_ite No NA NA Note: Variant allele frequency threshold for FFP samples was set at 15%. Concurrent FA/PT cases are highlighted in yellow and two longitudinal cases are highlighted in orange

25 upplementary Table 10: Primers used in FLNA cdna sequencing Primer Forward-sequence 5' -->3' Reverse-sequence 5' -->3' FLNA-A1191+Y1235 CTCTTCGCTGACACCCACATCC TCCACACTGAACTCAGTGGTGG FLNA-G1578 CCCAGACCGTCAATTATGTGCC GGGATCTCGTCACCACCGTACT