Arabidopsis phospholipase Dβ1 modulates defense responses to bacterial and fungal pathogens
|
|
- Beatrix Hill
- 5 years ago
- Views:
Transcription
1 This is the uthor s finl, peer-reviewed mnusript s epted for pulition. The pulisher-formtted version my e ville through the pulisher s we site or your institution s lirry. Aridopsis phospholipse Dβ1 modultes defense responses to teril nd fungl pthogens Jin Zho, Shivkumr P. Devih, Cunxi Wng, Ruth Welti, Xuemin Wng How to ite this mnusript If you mke referene to this version of the mnusript, use the following informtion: Zho, J., Devih, S. P., Wng, C., Welti, R., & Wng, X. (213). Aridopsis phospholipse Dβ1 modultes defense responses to teril nd fungl pthogens. Retrieved from Pulished Version Informtion Cittion: Zho, J., Devih, S. P., Wng, C., Welti, R., & Wng, X. (213). Aridopsis phospholipse Dβ1 modultes defense responses to teril nd fungl pthogens. New Phytologist, 199(1), Copyright: 213 The Authors. New Phytologist 213 New Phytologist Trust Digitl Ojet Identifier (DOI): doi:1.1111/nph Pulisher s Link: This item ws retrieved from the K-Stte Reserh Exhnge (K-REx), the institutionl repository of Knss Stte University. K-REx is ville t
2 Running title: PLD 1 in defense response Title: pthogens Aridopsis phospholipse D 1 modultes defense responses to teril nd fungl Jin Zho 1,3,*, Shivkumr P. Devih 1, Cunxi Wng 1, Ruth Welti 2, Xuemin Wng 1,4,* 1 Deprtment of Biohemistry nd 2 Division of Biology, Knss Stte University, Mnhttn, KS, 6656 USA; 3 College of Plnt Siene nd Tehnology, Ntionl Key Lortory of Crop Geneti Improvement, Huzhong Agriulturl University, Wuhn, Chin; 4 Deprtment of Biology, University of Missouri, St. Louis, MO nd Dnforth Plnt Siene Center, St. Louis, MO USA * Corresponding uthor emil: swng@dnforthenter.org & jinzho@mil.hzu.edu.n Summry: Pthogen infetion of higher plnts often indues rpid prodution of phosphti id (PA) nd hnges in lipid profiles, ut the enzymti sis nd the funtion of the lipid hnge in pthogen-plnt intertions re not well understood. Infetion of PLD 1 defiient plnts y Pseudomons syringe pv. DC3 resulted in less teril growth thn in wild-type plnts, nd the effet ws more profound in virulent Pst DC3 thn virulent Pst DC3 (vrrpt2) infetion. The expression levels of sliyli id (SA)-induile genes were higher, ut those induile y jsmoni id (JA) were lower in PLD 1 mutnts thn in wildtype plnts. However, PLD 1-defiient plnts were more suseptile thn wild-type plnts to the fungus Botrytis inere. The PLD 1-defiient plnts hd lower levels of PA, JA nd JA-relted defense gene expression fter B. inere inoultion. PLDβ1 plys positive role in pthogen-indued JA prodution nd plnt resistne to nerotrophi fungl pthogen B. inere, ut negtive role in the SA-dependent signling pthwy nd plnt tolerne to the infetion of iotrophi Pst DC3. PLDβ1 is responsile for the mjor prt of PA 1
3 inresed in response to nerotrophi B. inere nd virulent Pst DC3 infetion, ut ontriutes less to the virulent Pst DC3 (vrrpt2)-indued PA prodution. Key words: Botrytis inere, Pseudomons syringe, Aridopsis thlin, phospholipse D 1, pthogeneses, phosphtidi id, lysophospholipids, lipid signling. Arevitions: ABA, sisi id; HR-hypersensitive response; JA-jsmoni id; ROS-retive oxygen speies; PA- phosphtidi id; PLD-phospholipse D; PR-pthogenesis-relted protein; SA-sliyli id; SAR-systemi quired resistne; ISR-indued systemi resistne; Pst-Pseudomons syringe pv. tomto; Pst (vrrpt2)-pseudomons syringe pv. tomto rrying the vrrpt2 gene; MAMP/PAMPmiroe or pthogen-ssoited moleulr pttern; PTI-PAMP-triggered immunity; ETI- effetortriggered immunity. Introdution Plnts develop different ut inter-relted defense systems to ttle ginst invsion of pthogeni miroorgnisms (Durrnt & Dong, 24; Armovith et l., 26; Jones & Dngl, 26). One system reognizes nd responds to moleules ommon to mny lsses of miroes, inluding nonpthogens. This defense response is initited y reognition of miroe or pthogen-ssoited moleulr pttern (MAMP/PAMP) y the orresponding pttern reognition reeptor, whih is typilly n integrl plsm memrne protein. Another system of defense responds to pthogen virulene effetors, either diretly or through their effets on host trgets. The effetor-triggered defense response involves resistne (R) proteins, usully polymorphi NB-LRR proteins tht speifilly reognize prtiulr pthogen effetors nd lunh speifi defense response, suh s the Aridopsis R protein RPS2 eing reognized s the Pseudomons syringe effetor AvrRpt2 (Glzerook, 25; Jones & Dngl, 26). The PAMP-triggered immunity (PTI) nd effetortriggered immunity (ETI) re losely relted nd intert in n rry of defense responses, suh s hypersensitive response, iosynthesis of signling moleules sliyli id (SA), jsmonte (JA), nd ethylene, nd the prodution of pthogenesis-relted proteins nd phytolexins (Durrnt & Dong, 24; Armovith et l., 26;). Severl prllel, yet ross-tlking signling pthwys nd defense strtegies exist, suh s SA-dependent systemi quired resistne in virulent teril infetions 2
4 nd JA/ethylene-dependent induile systemi resistne during nerotrophi fungl pthogen infetions (Glzerook 25; Spoel et l., 23, Trumn et l., 27). However, the iohemil pthwys mediting the ross-tlk of different defense responses re not well understood (Glzerook, 25; Jones & Dngl, 26). Different spets of lipid metolism nd signling ply importnt roles in disese resistne nd suseptiility. For exmple, suppression of α-dox1, 16- nd 18-C ftty id dioxygense, onfers enhned suseptiility to P. syringe (De León et l., 22). Muttion of DIR1, puttive lipid trnsfer protein, renders plnt defiient in systemti quired resistne (SAR; Mldondo et l., 22). Muttion of plstidi steroyl yl-rrier protein desturse, SSI2, results in n inresed SA-medited SAR (Nndi et l., 24). Muttion of phospholipse A (PLA) SOBER1 (Suppressor of AvrBsT Eliited Resistne1) inreses the resistne of Aridopsis eotype Pi- ginst Pst DC3 (vrbst). This study lso indites potentil rosstlk etween the lysophospholipidproduing PLA nd the phosphtidi id (PA)-produing phospholipse D (PLD) pthwys in plnt teril pthogen intertion (Kirik & Mudgett, 29). PLD, whih hydrolyzes memrne phospholipids to generte PA nd free-hed group, is involved in ellulr proesses inluding retive oxygen speies (ROS) genertion (Sng et l., 21; Prk et l., 24); hormone signling (Zhng et l., 24), nd disese resistne (den Hrtog et l., 23; Brgmnn et l., 26; Andersson et l., 26; Ymguhi et l., 29). Plnt PLD is omposed of fmily of heterogeneous enzymes with distinguishle tlyti nd regultory properties (Wng et l., 26). PLD from Aridopsis inds to C 2+ nd phosphtidylinositol-4,5-isphosphte (PIP 2 ) nd hydrolyzes phosphtidylethnolmine (PE) preferentilly over phosphtidylholine (PC) (Pppn et l., 1997). The expression of Aridopsis PLDβ1 ws indued y oth teril nd fungl pthogen infetions (Zel et l., 22). Tomto LePLDβ1 ws indued y fungl eliitors nd RNAi knokdown of LePLDβ1 resulted in n inresed defense response in response to fungl eliitors (Lxlt et l., 21; Brgmnn et l., 26). Knokdown of PLDß1 in rie inresed resistne ginst Pyriulri grise nd Xnthomons oryze pv oryze. These results indite tht PLDβ1 plys n importnt role in plnt pthogen intertions nd lso rise further questions. As phospholipidhydrolyzing enzyme, wht effet would PLDß1 hve on memrne glyerolipid speies without nd with pthogen infetion? How would gene-knokout of PLDß1 ffet SA- nd JA-medited defense 3
5 response? In this study, we used PLDβ1-knokout nd RNAi-suppressed Aridopsis plnts to investigte the effet of PLDβ1 on Aridopsis intertion with the teril pthogen Pseudomons syringe nd fungl pthogen Botrytis inere. The results indite tht PLD 1 plys role in promoting PA prodution fter pthogen infetion. PLD plys negtive role in plnt resistne to teril pthogens ut positive role in plnt response to the nerotrophi fungl pthogen B. inere. Mterils nd Methods PLDβ1 T-DNA-Insertion Knokout Isoltion nd Complementtion A T-DNA insertion mutnt in PLDβ1 (At2g421), designted pldβ1-1, ws identified from the Slk Aridopsis thlin (L.) Heynh T-DNA knokout olletion (Slk_79133) nd seeds were otined from the ABRC t Ohio Stte University. A PLDβ1 homozygous T-DNA insert mutnt ws isolted y PCR sreening using PLDβ1gene speifi primers, 5 -ATA CCC TCC ACC TGA AAC TAA ACC GCA-3 (forwrd primer) nd 5 -TGTGGCTTATTGTGGAATGCATTACGA-3 (reverse primer) nd the T-DNA left order primer, 5'-GCG TGG ACCGCT TGC TGCAACT-3'. The positive T-DNA insertion lines were onfirmed y sequening. The F3 genertion shows homozygous muttion, nd defiieny of PLDβ1 trnsripts ws onfirmed y northern lotting. pldβ1-1 showed o-segregtion with knmyin resistne in 3:1 rtio, inditing tht the mutnt hd single T-DNA insertion. For omplementtion of the PLDβ1 knokout mutnt, the ntive PLDβ1 gene, inluding its own promoter region, ws mplified from 1 p upstrem of the strt odon nd 3 p fter the stop odon nd then ws loned into the pec291 vetor. The primers for PLDβ1 omplementtion were 5 - ATGGCGCGCCAGATTCTCGTCCACTGAGGA-3 (forwrd) nd 5 - ATGGCGCGCCTAGAGATGGGCTCTGGAGAT-3 (reverse). The onstrut, pec291-pldg 3, ws trnsformed into Agroterium tumfiens strin GV311 vi eletroportion. Homozygous pld 1-1 plnts were trnsformed (Clough nd Bent, 1998), the seeds were olleted, nd trnsformnts were seleted on medium ontining 1/2MS medi, 5 g -1 ml -1 knmyin, nd 1% gr. PLDβ1 RNAi Construt nd Genertion of RNAi Suppression Lines The sense DNA exon (492 p, the lst exon plus prt of 3 -UTR, from 2784 to 3276 p in PLDβ1 mrna, GeneBnk ession numer U84568 ) followed y n intron (11 p, the lst intron, from p in Aroidopsis BAC lone T6D2, GeneBnk ession numer U ) ws mplified y using PCR with forwrd primer BIR51: 5-4
6 CCCAAGCTTATTTAGAGTGATAATATATC-3 (Hind III site underlined) nd reverse primer BIR31: 5 -CCGGAATTCAGATCTATGGATACAG AAT-3 (EoRI site underlined). Antisense DNA (492 p) (the lst exon plus 3 -UTR from 2784 to 3276 p in PLDβ1 mrna, GeneBnk ession numer U84568) ws mplified with forwrd primer BIR52: 5 - CCGGAATTCTGGTCAGGTAAATCCCGCAAAC-3 (EoR1 site underlined), nd the reverse primer BIR32: 5 -CCGCTCGAGATTTAGAGTGATAATATATC-3 (XhoI site underlined). Two PCR produts were digested with EoRI nd then ligted into frgment of 11 p ontining two inverse DNA repets seprted y n intron. This frgment ws further digested with XhoI nd Hnd III restrition enzymes, nd the resulting frgment ws purified nd then ligted into pkylx71-35s 2 vetor in XhoI nd Hnd III sites. The resulting RNAi vetor ws onfirmed y omplete sequening nd trnsformed into Aridopsis y the florl dipping method. F1 nd F2 seeds were sreened using oth knmyin pltes nd PCR. Two homozygous lines RNAi1 nd RNAi2 were finlly otined with drmtilly deresed PLDβ1 trnsripts in leves s heked y northern lotting. Pthogen Growth nd Inoultion Aridopsis thlin Col-, pldβ1-1, RNAi mutnts, nd pldβ1-1 omplemented with PLDβ1 (PLD β1 omplementtion) plnts were grown in soil in growth hmers t 23/21 C nd 6-8% reltive humidity under 8/16 h dy/night photoperiods (85 µmol m 2 s 1 ) for pthogen inoultion, or 16/8 h dy/night photoperiods (12 µmol m 2 s 1 ) for physiologil nd geneti nlysis. The virulent strin Pseudomons syringe tomto (Pst) DC3 nd n virulent strin Pst DC3 rrying the virulene gene vrrpt2, Pst DC3 (vrrpt2) were grown in King's medium B t 28 C with pproprite ntiiotis (5 mg/l of rifmpiin for Pst DC3 nd 25 mg/l of rifmpiin plus 5 mg/l of knmyin for Pst DC3 (vrrpt2). Five week-old, soil-grown plnts were inoulted with Pst DC3 nd Pst DC3 (vrrpt2). Bteril inoultions were performed s previously desried (Nndi et l., 24). The fully expnded leves of eh plnt were infiltrted with suspension ontining 1 7 olony-forming units (fu) per milliliter of Pst DC3 or Pst DC3 (vrrpt2). In prllel, plnts similrly infiltrted with 1 mm MgCl 2 served s the ontrols. At, 3, nd 5 dys post inoultion, six infeted leves were olleted per genotype to mesure the growth of the pthogen. Bteril ounts re expressed s olony-forming units per lef dis. The rte of the lesion re is ording to methods desried efore (Nndi et l., 24). Eh dt point represents three replites, 5
7 with three lef diss per replite. Approximtely 5 plnts of eh genotype nd more thn 3 leves were treted. Botrytis inere IMI ws ultivted on in potto dextrose roth medium t 22 C in growth hmer. Spores were hrvested nd infetions performed s desried previously (Nndi et l., 24). Briefly, 1 µl drop of freshly hrvested B. inere onidil spore suspension (5 x 1 7 spores /ml) ws pled on three leves of 4 week-old soil-grown plnts priked with 23-guge needle. The inoulum ws llowed to ir dry; plnts were overed with trnsprent plsti dome nd ultivted t 18 C (8-1% humidity) in growth hmer progrmmed for 14 h/1 h light-drk yle. Control plnts were inoulted with potto dextrose roth medium lone. The numer of leves showing different levels of lesion ws sored t 5 dys post inoultion (Nndi et l., 24). Approximtely 5 plnts of eh genotype nd more thn 3 leves were tested. Extrtion nd Quntifition of SA Aout.3 g fresh leves were hrvested nd quikly frozen in liquid N 2. SA extrtion nd determintion were performed ording to method desried y Nndi et l. (24). Briefly, frozen smples were ground nd extrted one with 3 ml of 9% methnol nd one with 3 ml of 1% methnol. The omined extrts were dried under N 2 gs nd suspended in 2.5 ml of 5% trihloroeti id. The smples were id hydrolyzed y dding 2 µl of HCl nd inuting t 95 C for 3 min. SA ws extrted with 5 ml of mixture ontining ylohexne: ethylette: isopropnol (5:5:1). The smple ws dried under N 2 gs nd dissolved in.5 ml of the moile phse (69:27:4 mix of wter: methnol: glil eti id). Smples were filtered through.22-µm filter, nd 7.5 to 2 µl were used for high performne liquid hromtogrphy. Smples were pssed over 4.6 x 25-mm C18 reverse-phse olumn, nd SA ws eluted with the moile phse t flow rte of.8 ml/min. Asorne of the eluted smples ws reorded t 31 nm, nd SA onentrtions were determined y omprison with SA stndrds. RNA Blotting nd Immunolotting Five week-old Aridopsis seedlings tht were treted with pthogens or ontrol solution (wter or 1 mm MgSO 4 ) were used for gene expression nlysis. Whole plnts were tken for extrtion of RNA (Zho et l., 211). Twenty mirogrms of RNA ws loded nd seprted y formldehyde- 6
8 grose gel eletrophoresis nd trnsferred to hyridiztion memrne. 32 P-leled DNA proes for pthogenesis-relted genes, PR-1 (At2g1461) nd PDF1.2 (At5g4442), PLDα1 (At3g1573), PLDβ1 (At2g421), LOX2 (At3g4514), AOS (At5g4265), PR-5(At1g754), were generted using fulllength DNA of these genes. The immunolotting for PLDβ1 ws performed s desried previously (Zheng et l., 22). Proteins were extrted from Aridopsis leves nd equl mounts of proteins were sujeted to 8% SDS-PAGE, followed y immunolotting using ntiodies ginst PLDβ1 nd PLDα1. The PLD ntiodies were rised ginst the C-terminl 13-mino id residue peptide (Zheng et l., 22). Rel-Time qrt-pcr Rosette leves of indited ge were inoulted with pthogens. Leves were hrvested efore infetion nd mok tretments (time point ) nd t the indited time points fter tretment. Totl RNA ws isolted with the RNesy plnt mini kit (Qigen, USA). RNA ws reverse trnsried using M-MLV Reverse Trnsriptse kit (Life Tehnologies, Invitrogen) ording to the mnufturer s instrutions. Primer pirs listed in Supplementl Tle 1 (Tle S1) online were used for rel-time quntifition y n iq 5 multiolor rel-time PCR detetion system (Bio-Rd). Individul PCR retion mixtures ontined 1 μl of diluted DNA, 1 μl of SYBR Green Mstermix (Thermo Sientifi), nd 25 μm of eh primer in finl volume of 1 μl. In ll experiments, three iologil replites of eh smple nd two tehnil (PCR) replites were performed. Dt were nlyzed with iq 5 Optil System Softwre y the omprtive ΔΔCT method. The mount of trget genes ws normlized over the undne of the onstitutive UBQ5 nd Tuulin8 genes. Three iologil replites were nlyzed, eh onsisting of 8 individully infeted leves. Detetion of O 2 nd Mesurement of H 2 O 2 After inoultion with teril or fungl pthogens for the indited time, inoulted leves were dethed nd infiltrted with nitrolue tetrzolium (NBT) for 2 h. The purple formzn preipitte indites the lotion nd extent of O - 2 umultion. For quntittive mesurement of H 2 O 2, frozen leves (out.2 g) were ground to powder under liquid nitrogen nd homogenized with.5 ml of.2 M HClO 4 in pre-ooled mortr nd pestle. The extrt ws entrifuged t 1,g for 1 min t 4 C. The superntnt ws olleted nd neutrlized to ph 7. to 8. with.8 M NH 4 OH, nd riefly entrifuged t 3 x g for 5 min to sediment the insolule mteril. After 8-fold dilution, H 2 O 2 7
9 onentrtion ws mesured with n Amplex Red hydrogen peroxide / peroxidse ssy kit (Moleulr Proes, Ct. No. A22188, Eugene, OR). Lipid Profiling nd JA Mesurement The proess of lipid extrtion, nlysis, nd quntifition ws performed s desried (Welti et l., 22). Briefly, oth teril nd fungl inoulted leves were olleted t the smpling time nd immersed immeditely into 3 ml 75 C isopropnol with.1% utylted hydroxytoluene (BHT) for 15 min to inhiit lipolyti tivities. This ws followed y the ddition of 1.5 ml of hloroform nd.6 ml of wter. After shking for 1 h, the extrting solvent ws trnsferred to len tue. The tissues were extrted with hloroform-methnol five times with 3-min gittion eh time. The extrts were omined nd wshed with 1 M KCl, followed y nother wsh with wter. The solvent ws evported with strem of nitrogen. The remining plnt tissues were dried in n oven t 15 C overnight nd then weighed for dry weight, whih here refers to the dry weight minus the lipid ontent. Lipid smples were nlyzed with n eletrospry ioniztion triple qudruple mss spetrometer (API 4, Applied Biosystems). The moleulr speies of eh lipid lss were quntified in omprison to two internl stndrds s previously desried (Welti et l., 22; Devih et l., 26). Five replites of eh tretment for eh phenotype were proessed nd nlyzed. The Q-test for disordnt dt ws done on the replites of the totl lipid. Pired vlues were sujeted to t-test to determine sttistil signifine. JA nlysis in B. inere-inoulted nd ontrol plnts ws rried out ording to the method desried previously (Yng et l., 27; Pn et l., 28). Lef smples were hrvested t, 12 nd 24 h post inoultion. Aout 1 mg of fresh Aridopsis leves were seled in 1.5 ml snp-p vils nd quikly frozen in liquid N 2. The lef tissues were ground into powder nd 5 µl of 1- propnol/h 2 O/onentrted HCl (2:1:.2, vol/vol/vol) with internl stndrds (5 ng) were dded, nd the smples were gitted for 3 min t 4 C. One ml of CH 2 Cl 2 ws dded, nd the smples were gitted for nother 3 min nd then entrifuged t 13,g for 5 min. The lower phse (25 µl) ws diretly infused into hyrid triple qudrupole/liner ion trp mss spetrometer (ABI 4 Q-TRAP, Applied Biosystems, Foster City, CA) outfitted with n eletrospry (ESI) ion soure. Sttistil Anlysis 8
10 For most experimentl dt, inluding SA nd H 2 O 2 mesurements, three independent experiments were performed; lipid profiling ws performed with 5 repets. The dt were nlyzed using Students t test. The differenes etween two tils of dt with the error rs represent 95% onfidene limits. Results PLDβ1 deletion inresed defense response nd resistne to Pst DC3 To hrterize the funtion of PLD 1, we generted RNAi mutnts; two lines, RNAi1 nd RNAi2, with PLD expression eing suppressed to different degrees, were isolted nd used in this study (Fig. 1A). RNA lotting indited tht RNAi1 hd out 2-25% of the wild-type level of PLD 1 trnsript, wheres RNAi2 hd less thn 1% of the wild-type level of PLD 1 trnsript (Fig. 1B). Immunolotting using PLD 1 ntiody lso onfirmed tht oth RNAi1 nd RNAi2 hd deresed level of PLD 1 protein (Fig. 1C). We lso isolted one knokout line (pld 1-1) with the T-DNA inserted in the first exon of PLD 1, 877 p downstrem of the strt odon (Fig. 1D). Elimintion of the PLD 1 trnsript in pld 1-1 ws onfirmed y RNA lotting (Fig. 1D). The three PLD 1 mutnt lines with vried levels of dereses in PLD trnsripts were used for further study. Under norml growth onditions, the PLD defiient plnts displyed no pprent morphologil ltertions. We exmined the expression of PLD 1 in leves treted with severl ompounds ssoited with stresses to gin insights into its funtion. PLD 1 trnsript level ws inresed in leves with.1 mm methyl jsmonte (MeJA), ut deresed with.1 mm SA or methyl sliylte (MeSA) (Supplementl dt Fig. S1A, B). When leves were treted with 2 mm H 2 O 2, the expression of PLD 1 ws suppressed in the erly phse (3 h) ut inresed lter (2 h). On the other hnd, sisi id (ABA) tretments indued trnsient inrese in PLD 1 expression t 6 h. When Aridopsis leves were inoulted with pthogens, the expression of PLD 1 ws indued y oth virulent (Pst DC3) nd virulent [Pst DC3 (vrrpt2)] teril pthogens (Fig. 2A, left pnel). Fungl pthogen B. inere infetion lso mrkedly indued PLD 1 expression (Fig. 2A, right pnel). In ontrst, PLDβ2 ws not indued y the teril or fugl pthogens, When Col-, RNAi1 nd RNAi2 plnts infeted with pthogen B. inere, the PLDβ1 trnsript ws inresed in Col- plnts, ut only smll mount of PLDβ1 trnsripts were deteted in the RNAi lines (Supplementl dt Fig. S2). 9
11 To investigte the role of PLD 1, in plnt response to pthogens, we inoulted PLD 1 mutnt nd wild-type Aridopsis plnts with virulent Pst DC3 or Pst DC3 (vrrpt2). Most plnts displyed lef ell ollpse in the pthogen-inoulted leves within 24 h (Fig. 2B). However, the lef ell ollpse ws more evident in the two RNAi lines nd pldβ1-1 plnts thn in wild-type plnts, with PLDβ1 mutnts displying oth erlier development of ell ollpse nd lrger ollpse re (Fig. 2B). The elerted ell ollpse in PLDβ1 mutnts ourred with oth Pst DC3 nd Pst DC3 (vrrpt2) (Fig. 2B). Geneti omplementtion of pldβ1-1 with ntive PLDβ1 restored the mutnt s ollpses to the wild-type phenotype, suggesting tht ltion of PLD 1 results in n enhned resistne to iotrophi pthogen Pst DC3 (Fig. 2B). No symptoms ourred with ontrol plnts treted only with 1 mm MgSO 4. A teril growth ssy showed tht PLDβ1 mutnt plnts were suppressed in teril pthogen growth, nd the differene in pthogen growth etween pldβ1-1 nd wild-type fter virulent Pst DC3 infetion ws greter thn tht fter virulent Pst DC3 (vrrpt2) infetion (Fig. 2C). Both RNAi mutnts nd pldβ1-1 produed higher levels of totl SA (free SA nd SA glyoside) in response to Pst DC3 infetions (Fig. 3A) nd Pst DC3 (AvrRpt2) infetions (Supplementl dt Fig. S3). These differenes were evident in oth inoulted (lol) leves nd neighoring (distl) leves, suggesting systemti indution of SA prodution (Fig. 3B). Both quntittive RT-PCR nd RNA lotting were used to evlute defense-relted gene expression in treted/non-treted smples. Consistent with the higher level of SA, the SA-induile pthogenesis-relted (PR) gene PR1 ws upregulted in PLDβ1 mutnts (Fig. 3C; Supplementl dt Fig. S4). However, PLDβ1 mutnts displyed lower level of expression of JA iosyntheti genes llene oxide synthse (AOS), lipoxygense 2 (LOX2), nd JA/ethylene-regulted defensive gene plnt defensin 1.2 (PDF1.2) thn wild-type (Fig. 3C; Supplementl dt Fig. S4). PLDβ1 mutnts inresed suseptiility to Botrytis inere. When plnts were inoulted with spores of B. inere, PLD 1 mutnts displyed elerted nd lrger neroti lesions thn did wild-type plnts, s indited y lesion res mesured t dy 5 post inoultion (Fig. 4A). In ddition, more infeted leves hd neroti lesions with hloroti hlos (Fig. 4B). qrt-pcr nd RNA lotting nlyses showed tht PLD 1 mutnts hd lower levels of expression 1
12 of LOX2, AOS, nd PDF1.2, ut higher levels of PR1 expression thn did wild-type in response to B. inere (Fig. 4C; Supplementl dt Fig. S5). We then mesured endogenous JA nd SA levels in PLDβ1-KO, wild-type, nd PLDβ1- omplementted plnts with or without pthogen inoultion. JA levels in these plnts inresed gretly 24 h fter B. inere spore inoultion, ut the JA level of pldβ1-1 ws signifintly lower thn tht of wild-type nd the PLDβ1-omplemented plnts (Fig. 4D). Menwhile, SA mesurement results suggest tht PLDβ1-KO nd knokdown mutnts ll hd slightly higher levels of totl SA fter 3 dys of spores-inoultion (Fig. 4E), whih is onsistent with higher PR1 expression. These results suggest tht olishing PLDβ1 impirs fungl pthogen-indued JA prodution, rendering plnts more sensitive to pthogen. PLD 1 muttion inresed ROS prodution in response to pthogens We exmined if there ws differene etween PLD 1 mutnts nd wild-type in ellulr ROS umultion during the defense response. When O - 2 rets with nitro lue tetrzolium (NBT), preipitte of purple formzn forms (Ro et l., 2) (Fig. 5A). Pthogen-treted leves of the PLD 1-defiient mutnts displyed more intense lue stining thn those of wild-type. The intensity of lue stining ws inversely ssoited with the level of PLD 1 trnsript in the two RNAi mutnts nd pld 1-1 (Fig. 5A, B). To verify the ssoition of PLD 1 defiieny with ROS prodution, we mesured H 2 O 2 levels in infeted leves. PLD 1 mutnts generted more H 2 O 2 thn wild-type plnts in response to oth teril pthogens, Pst DC3 nd Pst DC3 (AvrRpt2), nd fungl (B. inere) pthogen infetions (Fig. 5C, D, Supplementl dt Fig.S6). The enhned ROS prodution in PLD 1-defiient plnts ws orrelted with stronger defensive response nd more severe neroti responses thn oserved in wild-type plnts. PLDβ1 ltion deresed virulent pthogen-indued prodution of phosphtidi id. To determine whether ltion of PLDβ1 hnged the ellulr level of PA, we quntittively profiled phospholipids nd gltolipids in Col-, pldβ1-1, nd omplementtion plnts with or without pthogen tretments. There ws no differene in PA levels etween Col-, pldβ1-1, nd omplementtion plnts without tretment. Inoultion with B. inere spores indued signifint inreses in PA in ll three genotypes, ut the PA inrese in pldβ1-1 ws signifintly lower thn tht 11
13 in Col- nd omplementtion plnts (Fig. 6). Levels of the mjor PA speies, 34:2-, 34:3-, 36:4-, 36:5-, nd 36:6-PA, in pldβ1-1 were signifintly lower thn those in wild-type plnts fter the fungl pthogen tretment (Supplementl dt Fig. S7).. The PA inrese ws lso oserved when the plnts were treted with virulent pthogen Pst DC3 (Fig. 6). Pst DC3 infetion signifintly inresed PA prodution 24 h post inoultion, ut pldβ1-1 hd lower PA levels thn wild-type nd PLDβ1-omplemented plnts fter Pst DC3 infetion (Fig. 6). The mjor PA speies suh s 34:2-, 34:3-, 36:4-, 36:5- nd 36:6-PA were signifintly lower in pldβ1-1 thn wild-type nd PLDβ1-omplementtion plnts treted with virulent teril pthogens (Supplementl dt Fig. S7). Inoultion with virulent pthogen Pst DC3 (vrrpt2) indued more PA prodution thn did Pst DC3 nd B. inere infetions, ut pldβ1-1 did not show muh differene from wild-type or PLDβ1-omplemented plnts in PA levels (Fig. 6). These results suggest tht PLDβ1 plys different role in virulent nd virulent teril pthogen-indued PAPA prodution: wheres it ontriutes signifintly to the virulent pthogen-indued PA prodution, ut less to the virulent pthogen-indued PA under this ssy ondition. The level of totl PC, PE, PI, PG, nd DGDG, were omprle in wild-type nd pldβ1-1 with or without pthogen infetion (Fig. 6). However, infetions resulted in different hnges etween wildtype nd pldβ1-1 when lipid moleulr speies were nlyzed (Supplementl dt Fig. S8). Tretment with B. inere tended to rise levels of 34:3, 36:5, 36:6 PCs nd 34:3 PE, nd tretment with Pst DC3 resulted in higher levels of 36:5 nd 36:6 PC in the PLDβ1 mutnt (Supplementl dt Fig S8). These higher levels of PC nd PE moleules in PLDβ1 mutnts versus wild-type plnts fter pthogen tretments re ssoited with the lower levels of PA prodution in PLDβ1 thn wild-type. These dt might suggest tht PC nd PE re potentil in vivo sustrtes of PLDβ1. PLDβ1-KO hd elevted lysophospholipid levels in virulent pthogen-infeted leves. In ontrst to the lesser inrese in PA in pldβ1-1, higher levels of totl LPC, LPE, nd LPG levels were found r in pldβ1-1 thn in wild-type nd omplemented plnts fter B. inere infetions, wheres without infetion, pldβ1-1 nd wild-type displyed no signifint differene (Fig. 7, top pnel). After virulent Pst DC3 infetion, pldβ1-1 plnts lso hd higher levels of LPE nd LPG tht wild-type (Fig. 7, middle pnel). However, fter the virulent pthogen Pst DC3 (vrrpt2) 12
14 infetion, only LPG ws signifintly higher in pldβ1-1 thn wild-type, nd the differene in LPG etween wild-type nd pldβ1-1 ws lso smller thn tht of virulent Pst DC3-infeted plnts (Fig. 7, ottom pnel). In ddition, the virulent Pst DC3 (vrrpt2) infetion showed n inrese in lysophospholipid levels in wild-type, pldβ1-1, nd omplementtion plnts (Fig. 7, ottom pnel). However, no suh inrese ws oserved in wild-type nd omplementtion plnts fter virulent Pst DC3 or B. inere infetions (Fig. 7, top nd middle pnels). The mjor LPC nd LPE speies were 18:3-, 18:2-, nd 16:- speies (Supplementl dt Fig. S9A, B), wheres 18:3-, 16:1-, nd 16:- were the mjor LPG speies (Fig. 7D). At 24 h post inoultion with Pst DC3, oth 18:3-LPC nd 18:2-LPC were higher in pldβ1-1 thn in wild-type nd omplemented plnts (Supplementl dt Fig. S9C). In the pldβ1-1 plnts, the formtion of 16:1-LPG fter pthogen inoultion ws prtiulrly pprent (Supplementl dt Fig. S9C). Disussion Our results show tht PLDβ1 is negtive regultor of the SA-dependent resistne to Pseudomons syringe, Pst DC3, ut positive regultor of the JA-dependent pthwy nd resistne to B. inere. The negtive role of PLDβ1 ws indited y the inresed prodution of SA, SA-induile genes, nd deresed dmge of virulent teril infetion. The positive effet of PLDβ1 on the JAdependent signling pthwy ws indited y the deresed expression in JA-iosyntheti nd responsive genes, deresed JA prodution, nd inresed dmge in response to B. inere inoultion. B. inere inoultion hs een reported to indue sustntil inrese in JA (Trumn et l., 27, Yng et l., 27). On the other hnd, the expression of PLDβ1 is indued y JA nd lso y wounding (Wng et l 21). Of the four PLDs (α1, γ1, γ2, nd β1) exmined, the gretest inrese for PLDβ1 mrna ourred 3 min fter wounding, wheres tht for PLDγ1 nd γ2 trnsripts ws t 6 min fter wounding nd for PLDα mrna ws t 3 to 6 hr fter wounding (Wng et l., 21). However, the wounding-indued JA prodution in Aridopsis peked one hour fter wounding (Wng et l., 21). These results ould men tht PLDβ1 is involved in pthogen- nd woundingindued JA prodution. The SA-dependent nd JA/ethylene-dependent signling pthwys in Aridopsis ontriute to resistne ginst distint miroil pthogens (Durrnt & Dong, 24; Spoel et l., 23; Trumn et l., 27). Yet, lose interply exists etween the two pthwys. For exmple, NPR1 (NON-EXPRESSOR OF PR GENES1) mutnt tht is impired in SA signling 13
15 produes higher level of JA nd shows n inresed suseptiility to pthogens (Spoel et l., 23). The effets of PLDβ1 on plnt pthogen intertions indite tht PLDβ1 nd ssoited lipid hnges re involved in the SA-dependent nd JA/ethylene-dependent plnt defenses ginst teril nd fungl pthogens. Tretment of plnts with P. syringe with or without AvrRpm1 or AvrRpt2, rhizoium, fungl pthogen, or eliitors ll hve een reported to indue PA prodution (vn der Luit et l., 2; de Jong et l., 24; Brgmnn et l., 26; Andersson et l., 26). However, the speifi PLD tht is responsile for the pthogen-indued PA prodution ws unknown. The urrent study shows tht knokout of PLDβ1 dereses the PA prodution indued y B. inere nd virulent Pst DC3 infetion, ut the loss of PLDβ1 hd no mjor impt on the virulent pthogen Pst DC3 (vrrpt2) indued PA prodution. The results indite tht PLDβ1 is responsile for mjor portion of the PA generted during virulent teril nd fungl pthogen ttk, ut it ontriuted less to the virulent pthogen-indued PA prodution under the present ssy ondition. It is possile tht other PLDs, suh s PLDα1 nd PLDδ, esides PLDβ1, re tivted in the plnt-virulent DC3 (vrrpt2) intertion, thus msking the differene in PA prodution etween pldβ1-1 nd wild-type plnts. Speifilly, PLDδ hs een shown to e responsile for most H 2 O 2 -indued PA prodution (Zhng et l., 23). The virulent infetion indued more H 2 O 2 prodution thn virulent infetion (Fig. S6 vs Fig. 5D), whih my result in inresed PLDδ tivity under the DC3 (vrrpt2) infetion. Thus, these dt indite tht other PLDs, esides PLDβ1, re involved in the pthogenindued PA prodution, nd under virulent infetion the other PLDs ontriute more, thus overwhelming the effet of PLDβ1 rogtion. However, pldβ1-1 still displyed inresed resistne to virulent DC3 (vrrpt2) infetion even though differene in PA levels ws undeteted etween pldβ1-1 nd wild-type plnts. One of the explntions for this is tht the PA produed y other PLDs my ply less (or different) role in heightening disese sensitivity, thn does PLDβ1-derived PA. Different PLDs nd their derived PA hve een shown to ply distinguishle roles in plnt response to different stresses (Zhng et l., 23; 29). Unlike the ttenuted inrese in PA, the levels of lysophospholipids, LPC, LPE, nd LPG in the pthogen-infeted PLDβ1-defiient plnts were higher thn those of wild-type plnts. This inverse reltionship etween PA nd lysophospholipids in teril infetion ws lso oserved with nother 14
16 mutnt, SOBER1, whih ffeted Aridopsis-Pst DC3 (vrbst) intertions (Kirik & Mudgett, 29). SOBER1 is PLA 2 tht negtively regultes pthogen-indued PA umultion. Both SOBER1 nd PLDβ1 re negtive regultors in Pst DC3 (AvrBst) nd virulent Pst DC3 defense, respetively. The dt ould men ross-tlk etween PLD nd PLA pthwys in plntpthogen intertion. Suh n intertion hs een lso proposed to our in plnt response to wounding nd senesene (Ryu & Wng, 1996; Ryu et l., 1997). LPE ws reported to inhiit PLDα to derese PA prodution nd dely senesene (Ryu et l., 1997). It is oneivle tht lysophospholipids my inhiit PLDβ nd other PLDs to suppress PA prodution (Kirik & Mudgett, 29). The present findings suggest tht the ltion of PLDβ1 results in n inrese in PLA tivity. It would e of interest in future studies to determine how PLDβ nd its derived PA suppress PLA nd the prodution of lysolipids. PLD nd PA re oth involved in ROS prodution nd response (Sng et l., 21; Prk et l., 24; Andersson et l., 26). PLDα1-derived PA hs een shown to diretly intert with NADPH oxidse on the plsm memrne nd promote ROS prodution (Zhng et l., 29). However, the present study shows tht PLDβ1-defiient plnts produed lower level of PA, yet higher level of ROS in response to virulent teril nd fungl pthogen. The sme trend hs lso een oserved in PLDβ1- defiient rie nd tomto (Brgmnn et l., 26; Ymguhi et l., 29). These results suggest tht PLDβ1 nd its derived PA re unlikely to promote ROS prodution, nd insted they my ply role in mediting ROS response, similr to tht of PLDδ where ltion of PLDδ rendered plnts more sensitive to ROS-promoted ell deth (Zhng et l., 23). PLDβ1 mutnts showed n inresed HR phenotype in response to virulent or virulent Pst DC3 infetions. The effets my result from inresed ROS dmge in PLDβ1 mutnts ompred to wild-type plnts. The inresed level of ROS in PLDβ1-defiient mutnts my inrese SA iosynthesis, whih in turn enhnes ROS level euse SA inhiits tlse tivity (Durner & Klessig, 1995; Mrtinez et l., 2). Rpid iosynthesis of SA is importnt for plnt to estlish systemti resistne to Pst DC3 (Durrnt & Dong, 24). Conlusion The present dt indite PLDβ1 plys positive role in pthogen-indued PA prodution, JA umultion, JA-dependent defense gene expression, nd plnt resistne to pthogenesis of nerotrophi fungl pthogen B. inere. On the other hnd, PLDβ1 suppresses SA-dependent 15
17 signling pthwy nd defense gene expression, thus, negtively ffeting plnt resistne to the infetion of iotrophi Pst DC3. In ddition, the results suggest tht PLDβ1 my suppress the prodution of lysolipids, implying ross-tlk etween the PLDβ1- nd PLA-medited signling in plnt response to teril nd fungl pthogens. Further study is needed to determine whether the inverse reltionship etween PA nd lysophospholipid prodution my underlie hemil mehnism tht modultes plnt-pthogen intertions. Aknowledgements We thnk Mry Roth for lipid nlysis nd Moyin Li for hormone nlysis. The work ws supported y grnts from Ntionl Siene Foundtion (IOS-81874; MCB ) nd the US Deprtment of Agriulture to XW. Equipment quisition nd method development t the Knss Lipidomis Reserh Center were funded y Ntionl Siene Foundtion (EPS , MCB nd 92663, DBI ), Knss Tehnology Enterprise Corportion, K-IDeA Networks of Biomedil Reserh Exellene (INBRE) of Ntionl Institute of Helth (P2RR16475), nd Knss Stte University. Referenes Armovith RB, Anderson JC, Mrtin GB. 26. Bteril eliittion nd evsion of plnt innte immunity. Nture Review of Moleulr Cell Biology 7: Andersson MX, Kourthenko O, Dngl JL, Mkey D, Ellerström M. 26. Phospholipsedependent signlling during the AvrRpm1- nd AvrRpt2-indued disese resistne responses in Aridopsis thlin. Plnt Journl 47: Brgmnn BO, Lxlt AM, Riet BT, Shouten E, vn Leeuwen W, Dekker HL, de Koster CG, Hring MA, Munnik T. 26. LePLDet1 tivtion nd reloliztion in suspension-ultured tomto ells treted with xylnse. Plnt Journl 45: Clough SJ, Bent AF Florl dip: simplified method for Agroterium-medited trnsformtion of Aridopsis thlin. Plnt Journl 16: de Jong CF, Lxlt AM, Brgmnn BO, de Wit PJ, Joosten MH, Munnik T. 24. Phosphtidi id umultion is n erly response in the Cf-4/Avr4 intertion. Plnt Journl 39:
18 De León IP, Snz A, Hmerg M, Cstresn C. 22. Involvement of the Aridopsis lph- DOX1 ftty id dioxygense in protetion ginst oxidtive stress nd ell deth. Plnt Journl 29: den Hrtog M, Verhoef N, Munnik T. 23. Nod ftor nd eliitors tivte different phospholipid signling pthwys in suspension-ultured lflf ells. Plnt Physiology 132: Devih SP, Roth MR, Bughmn E, Li M, Tmur P, Jennotte R, Welti R, Wng X. 26. Quntittive profiling of polr glyerolipid speies nd the role of phospholipse D 1 in defining the lipid speies in Aridopsis tissues. Phytohemistry 67: Durner J, Klessig DF Inhiition of sorte peroxidse y sliyli id nd 2,6- dihloroisoniotini id, two induers of plnt defense responses. Proeedings of the Ntionl Ademy of Sienes, USA 92: Durrnt WE, Dong X. 24. Systemi quired resistne. Annul Review of Phytopthology 42: Jones JDG, Dngl JL. 26. The plnt immune system. Nture 444: Kirik A, Mudgett MB. 29. SOBER1 phospholipse tivity suppresses phosphtidi id umultion nd plnt immunity in response to teril effetor AvrBsT. Proeedings of the Ntionl Ademy of Sienes, USA 16: Lxlt AM, ter Riet B, Verdonk JC, Prigi L, Tmeling WI, Vossen J, Hring M, Musgrve A, Munnik T. 21. Chrteriztion of five tomto phospholipse D DNAs: rpid nd speifi expression of LePLDet1 on eliittion with xylnse. Plnt Journl 26: Mldondo AM, Doerner P, Dixon RA, Lm CJ, Cmeron RK. 22. A puttive lipid trnsfer protein involved in systemi resistne signling in Aridopsis. Nture 419: Mrtinez C, Bou JC, Bresson E, Biss Y, Dniel JF, Jlloul A, Montillet JL, Geiger JP, Assigetsé K, Niole M. 2. Sliyli id medited y the oxidtive urst is key moleule in lol nd systemi responses of otton hllenged y n virulent re of Xnthomons mpestris pv mlverum. Plnt Physiology 122: Nndi A, Welti R, Shh J. 24. The Aridopsis thlin dihydroxyetone phosphte redutse gene SUPPRESSSOR OF FATTY ACID DESATURASE DEFICIENCY1 is required for glyerolipid metolism nd for the tivtion of systemi quired resistne. Plnt Cell 16:
19 Pn X, Welti R, Wng X. 28. Simultneous quntifition of mjor phytohormones nd relted ompounds in rude plnt extrts y liquid hromtogrphy eletrospry tndem mss spetrometry. Phytohemistry 69: Pppn K, Qin W, Dyer JH, Zheng S, Wng X Moleulr loning nd funtionl nlysis of polyphospho inositide-dependent phospholipse D, PLD, from Aridopsis. Journl of Biologil Chemistry 272: Prk J, Gu Y, Lee Y, Yng Z, Lee Y. 24. Phosphtidi id indues lef ell deth in Aridopsis y tivting the Rho-relted smll G protein GTPse-medited pthwy of retive oxygen speies genertion. Plnt Physiology 134: Ro MV, Lee H, Creelmn RA, Mullet JE, Dvis KR. 2. Jsmoni id signling modultes ozone-indued hypersensitive ell deth. Plnt Cell 12: Ryu SB, Krlsson BH, Ozgen M, Plt JP Inhiition of phospholipse D y lysophosphtidylethnolmine, lipid-derived senesene retrdnt. Proeedings of the Ntionl Ademy of Sienes, USA 94: Ryu SB, Wng X Ativtion of phospholipse D nd the possile mehnism of tivtion in wound-indued lipid hydrolysis in stor en leves. Biohim Biophys At 133: Sng Y, Cui D, Wng X. 21. Phospholipse D- nd phosphtidi id-medited genertion of superoxide in Aridopsis. Plnt Physiology 126: Spoel SH, Koornneef A, Clessens SM, Korzelius JP, Vn Pelt JA, Mueller MJ, Buhl AJ, Métrux JP, Brown R, Kzn K, Vn Loon LC, Dong X, Pieterse CM. 23. NPR1 modultes ross-tlk etween sliylte- nd jsmonte-dependent defense pthwys through novel funtion in the ytosol. Plnt Cell 15: Trumn W, Bennett MH, Kuigsteltig I, Turnull C, Grnt M. 27. Aridopsis systemi immunity uses onserved defense signling pthwys nd is medited y jsmontes. Proeedings of the Ntionl Ademy of Sienes USA 14: Vn der Luit A, Pitti T, vn Doorn A, Musgrve A, Felix G, Boller T, Munnik T. 2. Eliittion of suspension-ultured tomto ells triggers the formtion of phosphtidi id nd diylglyerol pyrophosphte. Plnt Physiology 123: Wng C, Zien CA, Afitlhile M, Welti R, Hildernd DF, Wng X. 21. Involvement of phospholipse D in wound-indued umultion of jsmoni id in Aridopsis. Plnt Cell 12:
20 Wng X, Devih SP, Zhng W, Welti R. 26. Signling funtions of phosphtidi id. Progress in Lipid Reserh 45: Welti R, Li W, Li M, Sng Y, Biesid H, Zhou HE, Rjshekr CB, Willims TD, Wng X. 22.Profiling memrne lipids in plnt stress responses: role of phospholipse D lph in freezingindued lipid hnges in Aridopsis. Journl of Biologil Chemistry 277: Ymguhi T, Kurod M, Ymkw H, Ashizw T, Hirye K, Kurimoto L, Shiny T, Shiuy N. 29. Suppression of phospholipse D gene, OsPLDet1, tivtes defense responses nd inreses disese resistne in rie. Plnt Physiology 15: Yng W, Devih SP, Pn X, Is G, Welti R, Wng X. 27. AtPLAI is n yl hydrolse involved in sl jsmoni id prodution nd Aridopsis resistne to Botrytis inere. Journl of Biologil Chemistry 282: Zel MD, Fernndez-Delmond I, Niittyl T, Snhez P, Grnt M. 22. Differentil expression of genes enoding Aridopsis phospholipses fter hllenge with virulent or virulent Pseudomons isoltes. Moleulr Plnt Miroe Intertion 15: Zhng W, Qin C, Zho J, Wng X. 24. Phospholipse Dα1-derived phosphtidi id interts with ABI1 phosphtse 2C nd regultes sisi id signling. Proeedings of the Ntionl Ademy of Sienes USA 11: Zhng W, Wng C, Qin C, Wood T, Olfsdottir G, Welti R, Wng X. 23.The olete-stimulted phospholipse D, PLDdelt, nd phosphtidi id derese H 2 O 2 -indued ell deth in Aridopsis. Plnt Cell 15: Zhng Y, Zhu H, Zhng Q, Li M, Yn M, Wng R, Wng L, Welti R, Zhng W, Wng X. 29. Phospholipse Dα1 nd phosphtidi id regulte NADPH oxidse tivity nd prodution of retive oxygen speies in ABA-medited stomtl losure in Aridopsis. Plnt Cell 21: Zho J, Wng C, Bedir M, Welti R, Sumner LW, Bxter I, Xuemin Wng X Suppression of phospholipse Dγs onfers inresed luminum resistne in Aridopsis thlin PLoS ONE 6: e2886. doi: Zheng L, Krishnmoorthi R, Zolkiewski M, Wng X. 2. Distint lium inding properties of novel C2 domins of plnt phospholipse Dα nd β. Journl of Biologil Chemistry 275:
21 Zheng L, Shn J, Krishnmoorthi R, Wng X. 22. Ativtion of plnt phospholipse D y phosphtidylinositol 4,5-isphosphte: hrteriztion of inding site nd mode of tion. Biohemistry 41: Supporting Informtion Fig. S1-S9: Fig. S1. PLDβ1 Expression Pttern (A) Expression of PLDβ1 in response to vrious stresses. Aridopsis Col- eotype (3 week old) leves were dethed nd floted on wter without (Control) or with indited hemils: 2 mm H 2 O 2,.1 mm sliyli id (SA),.1 mm methyl sliyli id (MeSA),.1 mm sisi id (ABA), or.1 mm methyl jsmonte (MeJA) in growth hmer t 22 ºC. Leves were olleted t the indited times for RNA extrtion nd northern lotting. All smple RNAs from different tretments t different time points were eqully loded s indited y ethidium romide-stined 28S RNA. One representtive photo from three repets ws shown. (B) Quntifition of PLDβ1 in response to stresses. Dt were verge ±SD using softwre to mesure nd intensity ompred with ontrol. Fig. S2. PLDβ1 expression in Aridopsis leves indued y Botrytis inere infetion in Col- nd PLDβ1 mutnts. Equl mounts of RNAs from leves were loded s indited y ethidium romidestined 28S RNA, one representtive 28S RNA from three experiments ws shown here. Fig. S3. Sliyli id in pthogen-inoulted Aridopsis leves. Smples were hrvested fter inoultion of Pst DC3 (vrrpt2) (2 x 17 fu/ml.. Totl SA (free SA + SA glyosides) in the wild-type, pldβ1-1, RNAi1, RNAi2, nd pldβ1-1 omplementtion plnts were determined y HPLC. Dt re presented s mens ± SD (n = 3). Different letters indite smple groups with signifint differenes (p <.5) from eh other. Fig. S4. Bteril infetion indued defense gene expression in wild-type nd pldβ1-1 Aridopsis leves. Quntifition of expression levels of defense-relted genes in Pst DC3 (A), nd Pst DC3 (vrrpt2) (B) ( ll teril suspension re 2 x 1 7 fu/ml) inoulted plnts with ltered 2
22 PLDβ1 expression in Fig. 3C. The nd intensity ws mesured y densitometry from three seprte experiments. Dt re presented s mens ± SD (n = 3). Fig. S5. Defense-relted gene expression indued y Botrytis inere infetion in Aridopsis Col- nd PLDβ1 mutnts. Equl mounts of RNAs from leves were loded. RNAs from lef smples were eqully loded s indited y ethidium romide-stined 28S RNA, one representtive 28S RNA from three experiments ws shown here. Fig. S6. H 2 O 2 quntifition in Pst DC3 (vrrpt2)-infeted Aridopsis leves. The wild-type (Col-), pldβ1-1, nd RNAi2 plnts were inoulted with Pst DC3 (2 x 1 7 fu/ml) nd leves were olleted t different time post inoultion. Dt re presented s mens ± SD (n = 5). Different letters indite smple groups with signifint differenes (p <.5) from eh other. Fig. S7. Profiling of phosphotidi id speies in Col-, pldβ1-1, nd pldβ1-1 omplementtion Aridopsis plnts inoulted with ontrol solutions (-C) or with pthogens (-T). Control solutions were wter for Botrytis inere spores nd 1 mm MgSO 4 for virulent strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2) (ll pthogen suspensions re 2 x 1 7 fu/ml). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens SE (n = 5). Different letters indite smple groups with signifint differenes (P <.5) from eh other. Fig. S8. Profiling of PC (A) nd PE (B) speies in Col-, pldβ1-1, nd pldβ1-com Aridopsis plnts inoulted with ontrol solutions (-C) or with pthogens (-T). Control solutions were wter for Botrytis inere spores nd 1 mm MgSO 4 for virulent strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2) (ll pthogen suspensions re 2 x 1 7 fu/ml). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens SE (n = 5). Different letters indite smple groups with signifint differenes (p <.5) from eh other. Fig. S9. Profiling of LPG speies from Aridopsis leves of Col-, pldβ1-1, nd pldβ1-com plnts with nd without inoultion of B. inere, Pst DC3, or virulent Pst DC3 (vrrpt2). Col-, pldβ1-1, nd pldβ1-com plnt were inoulted with ontrol solutions (-C) or with pthogens (-T). Control solutions were wter for Botrytis inere nd 1 mm MgSO 4 for virulent 21
23 strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2) (ll pthogen suspensions re 2 x 1 7 fu/ml). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens SE (n = 5). Different letters indite smple groups with signifint differenes (P <.5) from eh other. (A) LPC speies from Col-, pldβ1-1, nd pldβ1omplementtion (COM) plnts under different tretments. (B) LPE speies from Col-, pldβ1-1, nd pldβ1omplementtion (COM) plnts under different tretments. (B) LPG speies from Col-, pldβ1-1, nd pldβ1omplementtion (COM) plnts under different tretments. Supplementl dt Tle S1. Rel time PCR primers Primer Nmes 5-3 sequenes Genes PLDβ1 Forwrd PLDβ1 Reverse PR1 F PR1 R UBQ5 F UBQ5 R PDF12 F PDF12 R LOX2 F LOX2 R AOS F AOS R Tuulin8 F Tuulin8 R PLDβ2F PLDβ2R CGGAGGTAACATTGTCGGATC TCTCCCACCCTCTTATTATCA TTCTTCCCTCGAAAGCTCAA AAGGCCCACCAGAGTGTATG ACCAAGCCGAAGAAGATCA GTAAACGTAGGTGAGTCCA CTT GTT CTC TTT GCT GCT TTCG CAT GTT TGG CTC CTT CAA G TGAAAGATTCAAAGGCAAGCT GAACACCCATTCCGGTAACA CATGTGTTGTGGTCGAATGGA ATTAACGGAGCTTCCTAACG GACATTTGGCTATGTGTGATG CAGATGGAATCACCAACGTTT CTGCTAGATGATTGCTTTGT CTCCGACACTTCCTCACTC Frgment size (p) AT2G AT2G AT3G AT5G AT3G AT5G AT5G AT4G
24 FIGURE LEGENDS Figure 1. Prodution nd Confirmtion of PLDβ1 RNAi Knokdown nd T-DNA Insertion Knokout Aridopsis Lines. () Constrution of PLDβ RNAi vetor. Inverted repets of exons (gry oxes) nd n intron (empty oxes) with restrition sites were loned in tndem, nd their expression ws driven y doule CMV 35S promoters nd terminted y n NOS termintor. () RNA lotting of PLDβ1 nd PLDα1 expression in RNAi lines. Equl mounts of totl RNA from Aridopsis leves were loded nd rrna deteted with ethidium romide (EtBr) ws used s loding ontrol. PLDα1 protein levels were lso used s loding ontrols. The density of the PLDβ1 RNA nd ws quntified from three experiments. Dt rs represent the men (±SD) of three repets. () Immunolotting of PLDβ1 nd PLDα1 protein levels in RNAi lines. Equl mounts of Aridopsis lef proteins were sujeted to SDS-PAGE, followed y immunolotting using ntiodies ginst PLDβ1 nd PLDα1. The nd density of PLDβ1 ws quntified from three experiments. Dt rs represent the men (±SD) of three repets. (d) T-DNA insertionl knokout of PLDβ1. Left pnel, T-DNA insertion position in PLDβ1 with exons (gry oxes) nd introns (rs etween exons). Right pnel, northern lot showing the sene of the PLDβ1 trnsript in T-DNA insertion knokout. PLDα1 expression nd 28S RNA (deteted with ethidium romide) were used s loding ontrols. Figure 2. Responses of PLDβ1 Aridopsis Mutnts to Bteril Pthogens Fully expnded leves of Col-, pldβ1-1, RNAi mutnts, nd pldβ1-1 omplementtion (COM) plnts were infiltrted with suspension ontining Pst DC3 with or without vrrpt2. () Expression of PLDβ1 nd PLDβ2 in Col- plnts infeted with Pst DC3 pthogens or Pst DC3(vr Rpt2) pthogens (2 x 17 fu/ml) for 12 h. Leves treted with 1 mm MgSO4 were used s ontrol (mok). The reltive expression level of PLDβ1 nd PLDβ2 ws nlyzed y quntittive PCR. Expression levels were normlized with respet to the housekeeping genes UBQ nd Tuulin. Dt rs represent the men (±SD) of three repets. () Defensive response of Aridopsis plnts with ltered PLDβ1 expression to virulent nd virulent Pst DC3 (2 x 1 7 fu/ml). The photogrphs show representtive leves inoulted with teril pthogen for 12 h. 23
25 () Prolifertion of the virulent Pst DC3 (left pnel) nd virulent Pst DC3 (vrrpt2) (2 x 1 5 fu/ml ) (right pnel) pthogens in Col-, pldβ1-1, RNAi plnts. Bteril growth in five lef diss ws mesured. The teril numers expressed s the inrese of olony-forming units (fu) per lef dis fter teril inoultion (i.e. Log fu post inoultion Log fu t time zero). Dt represent the verge of three smples ± SD. Different letters indite smple groups with signifint differenes (p <.5) from eh other. Figure 3. Sliyli Aid in Pthogen-Inoulted PLDβ1 Aridopsis Mutnts Totl SA (free SA + SA Glyosides) in the wild-type, pldβ1-1, RNAi1, nd RNAi2 were determined y HPLC. Dt re presented s mens ± SD (n = 3). Different letters indite smple groups with signifint differenes (p <.5) from eh other. () SA levels in inoulted leves s funtion of time post Pst DC3 inoultion (2 x 1 7 fu/ml). () SA levels in leves from lol nd distl leves from Pst DC3-inoulted plnts for 12 h. () Expression of defense-relted genes in Col-, pldβ1-1, RNAi1, RNAi2, nd pldβ1-1- omplementtion (COM) plnts infeted with Pst DC3 pthogens (pst) or Pst DC3(Avr Rpt2) (Rpt) pthogens (2 x 17 fu/ml) for 12 h. Leves treted with 1 mm MgSO4 (m) were used s ontrol. The reltive expression level of PR-1 ws nlyzed y quntittive PCR. Expression levels were normlized with respet to the housekeeping genes. Dt rs represent the men (±SD) of three repets. Figure 4. Responses of PLDβ1 Aridopsis Mutnts to B. inere () Leves of three week-old Col-, pldβ1-1, RNAi, nd pldβ1-1-omplementtion (COM) plnts were inoulted with B. inere spores (5 x 1 7 spores /ml) or wter (ontrol). The photogrphs show representtive leves 5 dys post-inoultion. () Lesions sored t 5 dys post inoultion. The lesion developing rte ws the numer of leves with neroti re mong the inoulted leves in eh line. Dt re presented s men ± SD (n = 25). Different letters indite smple groups with signifint differenes (p <.5) from eh other. () Expression of defense-relted genes in Col- nd PLDβ1 mutnts infeted with fungl pthogens y quntittive PCR. Expression levels were normlized with respet to uiquitin 5 (UBQ5). Dt rs represent the men (±SD) of three repets. Leves treted with wter were used s ontrol. 24
26 (d) JA levels in wild-type (Col-), pldβ1-1, nd pldβ1-omplementtion (COM) plnts t vrious hours post inoultion (hpi) with B. inere. C indites ontrol (i.e. mok-inoulted) nd T indited treted (i.e. pthogen-inoulted). Three week-old soil-grown seedlings were treted with B. inere spores. Vlues re mens ± SE of three independent replite experiments. (e) Sliyli id in Botrytis inere spore-inoulted PLDβ1 mutnts. Smples were hrvested fter inoultion Botrytis inere spores (5 x 1 7 fu/m1) for different time. Totl SA (free SA + SA Glyosides) in the wild-type, pldβ1-1, RNAi1, RNAi2, nd pldβ1-1 omplementtion plnts were determined y HPLC. Dt re presented s mens ± SD (n = 3). Figure 5. ROS Genertion in Aridopsis Response to Pthogen Infetion. The wild-type (Col-), pldβ1-1, RNAi1, nd RNAi2 plnts were inoulted with Pst DC3 (2 x 1 7 fu/ml) or Botrytis inere spores. Dt re presented s mens ± SD (n = 5). () Nitrolue tetrzolium stining of 5-week old Aridopsis leves 12 h post inoultion with Pst DC3 teril pthogen (2 x 1 7 fu/ml). () H 2 O 2 quntifition in Pst DC3-infeted leves 12 h post inoultion. () Nitrolue tetrzolium stining of 5-week old Aridopsis leves 12 h post inoultion with B. inere. (d) H 2 O 2 quntifition in B. inere spore-inoulted leves. Different letters indite smple groups with signifint differenes (p <.5) from eh other. Figure 6. Phospholipid nd Gltolipid Content from Leves of Wild-type nd pldβ1-1 Aridopsis s ffeted y B. inere, Pst DC3, or Avirulent Pst DC3 (vrrpt2) Infetion. Col-, pldβ1-1, nd pldβ1 omplementtion (COM) plnt were inoulted with ontrol solutions (-C) or with pthogens (-T). Control solutions were wter for Botrytis inere spores (5 x 1 7 spores /ml) nd 1 mm MgSO 4 for virulent strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2) (2 x 1 7 fu/ml). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens SE (n = 5). Different letters indite smple groups with signifint differenes (p <.5) from eh other. 25
27 Figure 7. Levels of totl LPC, LPE, nd LPG from Leves of Wild-type nd pldβ1-1 Aridopsis with nd without Inoultion of B. inere, Pst DC3, or virulent Pst DC3 (vrrpt2). Col-, pldβ1-1, nd pldβ1-com plnt were inoulted with ontrol solutions (-C) or with pthogens (- T). Control solutions were wter for Botrytis inere nd 1 mm MgSO 4 for virulent strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens of SE (n = 5). Different letters indite vlues with signifint differenes (P <.5) from eh other. 26
28 () Hnd III Exon Exon Xho1 EoR1 Intron () () (d) ATG 2 x 35S NOS PLDβ1 trns sripts (% wild-ty ype) PLDβ1 pro oteins (% wild-ty ype) LB T DNA PLD 1 PLD 1 EtBr Col- RNAi2 RNAi1 RB PLD 1 PLD 1 Col- RNAi1 RNAi2 TGA PLD PLD DNA 3252 p EtBr Figure 1
29 Figure 1. Prodution nd Confirmtion of PLDβ1 RNAi Knokdown nd T-DNA Insertion Knokout Aridopsis Lines. () Constrution of PLDβ RNAi vetor. Inverted repets of exons (gry oxes) nd n intron (empty oxes) with restrition sites were loned in tndem, nd their expression ws driven y doule CMV 35S promoters nd terminted y n NOS termintor. () RNA lotting of PLDβ1 nd PLDα1 expression in RNAi lines. Equl mounts of totl RNA from Aridopsis leves were loded nd rrna deteted with ethidium romide (EtBr) ws used s loding ontrol. PLDα1 expression levels l were lso used s loding ontrols. The density of the PLDβ1 RNA nd ws quntified from three repet experiments. () Immunolotting of PLDβ1 nd PLDα1 protein levels in RNAi lines. Equl mounts of Aridopsis lef proteins were sujeted to SDS-PAGE, followed y immunolotting using ntiodies ginst PLDβ1 nd PLDα1. The nd density of PLDβ1 ws quntified from three repet experiments. (d) T-DNA insertionl knokout of PLDβ1. Top pnel, T-DNA insertion position in PLDβ1 with exons (gry oxes) nd introns (rs etween exons). Bottom pnel, northern lot showing the sene of the PLDβ1 trnsript in T-DNA insertion knokout. PLDα1 expression nd 28S RNA (deteted with ethidium romide) were used s loding ontrols.
30 () R e ltive express s io n PLDβ1 PLDβ2 MgSO4 Pst DC3 Pst DC3 (vrrpt2) sion Reltive expres PLDβ1 PLDβ Time fter inoultion(hr) () RNAi1 RNAi2 Col- pld 1-1 COM Pst DC3 Pst DC3 (vrrpt2) Col- MgSO 4 () Bter prolifertion (inrese in Log fu/lef) RNAi1 RNAi2 PLDβ1-1 Col- Pst DC Dys postinoultion prolifertion n Log fu/lef) Bter p (inrese in RNAi1 Pst DC3 RNAi2 (vrrpt2) PLDβ1-1 Col Dys post inoultion Figure 2
31 Figure 2. Responses of PLDβ1 Aridopsis Mutnts to Bteril Pthogens Fully expnded leves of Col-, pldβ1-1, RNAi mutnts, nd pldβ1-1 omplementtion (COM) plnts were infiltrted with suspension ontining Pst DC3 with or without vrrpt2. () Expression of PLDβ1 nd PLDβ2 in Col- plnts infeted with Pst DC3 pthogens or Pst DC3(vrRpt2) )pthogens (2 x 17 fu/ml) for 12 h (left penl). Time-ourse expression of PLDβ1 nd PLDβ2 infeted with Botrytis inere spores (2 1 7 fu/ml)(right pnel). Leves treted with 1 mm MgSO4 were used s ontrol (mok). The reltive expression level of PLDβ1 nd PLDβ2 ws nlyzed y quntittive PCR. Expression levels were normlized with respet to the housekeeping genes UBQ5 nd Tuulin. Dt rs represent the men (±SD) of three repets. () Defensive response of Aridopsis plnts with ltered PLDβ1 expression to virulent nd virulent Pst DC3 (2 x 1 7 fu/ml). The photogrphs show representtive leves inoulted with teril pthogen for 12 h. () Prolifertion of the virulent Pst DC3 (left pnel) nd virulent Pst DC3 (vrrpt2) (right pnel) (2 1 5 fu/ml) pthogens in Col-, pldβ1-1, RNAi plnts. Bteril growth in five lef diss ws mesured. The teril numers expressed s the inrese of olonyforming units (fu) per lef dis fter teril inoultion (i.e. Log fu post inoultion Log fu t time zero). Dt represent the verge of three smples ± SD. Different letters indite smple groups with signifint differenes (p <.5) from eh other.
32 Tot l SA (μg/g FW) ( ) 25 Col- 2 pldβ1-1 RNAi2 15 RNAi1 1 5 () PR1 expression (relt ive to UBQ5) Time post inoultion (hr) Col- RNAi1 RNAi2 pldβ1 COM Mok Pst3 Pst3 (vrrpt2) () tl SA (μg/g FW) Tot expression ve to UBQ5) AOS (reltiv Col- pldβ1-1 RNAi2 RNAi1 mok distl lol Col- RNAi1 RNAi2 pldβ1 COM Mok Pst3 Pst3 (vrrpt2) PDF F1.2 expression (re ltive to UBQ5) Col- RNAi1 RNAi2 pldβ1 COM Mok Pst3 Pst3 (vrrpt2) LO OX2 expression (re eltive to UBQ5) Col- RNAi1 RNAi2 pldβ1 COM Mok Pst3 Pst3 (vrrpt2) Figure 3
33 Figure 3. Sliyli Aid in Pthogen-Inoulted PLDβ1 Aridopsis Mutnts Totl SA (free SA + SA Glyosides) in the wild-type, pldβ1-1,rnai1, nd RNAi2 were determined y HPLC. Dt re presented s mens ± SD (n = 3). Different letters indite smple groups with signifint differenes (p <.5) from eh other. (A) SA levels in inoulted leves s funtion of time post Pst DC3 inoultion (2 1 7 fu/ml). (B) SA levels in leves from lol nd distl leves from Pst DC3-inoulted plnts for 12 h. (C) Expression of defense-relted genes in Col-, pldβ1-1, RNAi1, RNAi2, nd pldβ1-1 omplementtion (COM) plnts infeted with Pst DC3 pthogens or Pst DC3(vr Rpt2) pthogens (2 x 17 fu/ml) for 12 h. Leves treted with 1 mm MgSO 4 were used s ontrol. The reltive expression level of PR-1ws nlyzed y quntittive PCR. Expression levels were normlized with respet to the housekeeping genes UBQ5. Dt rs represent the men ± SD of three repets.
34 () () (d) B. inere spores Control Control B. inere spores LOX2 expressio on (reltive to UBQ Q) PDF1.2 ex xpression (reltive to UBQ) JA (n ng/mg FW) Figure Col RNAi1 RNAi2 Col pld 1 1 COM Col- RNAi1 RNAi2 pldβ1 COM 1 3 Dys fter Inoultion Col- RNAi1 RNAi2 pldβ1 COM 1 3 Dys fter inoultion Col- pld 1-1 COM h 12 12t 24 24t Time (hpi) () Nerosis rte (% %) AOS express sion (reltive to UB BQ ) PR1 exp pression (reltive to UBQ) (e) (μg/g FW) Totl SA( Pthogen Control Col- RNAi1 RNAi2 pldβ1-1 Col- Col- RNAi1 RNAi2 pldβ1 RNAi1 RNAi2 pldβ1 COM COM Col- RNAi1 RNAi2 pldβ1 1 3 Dys fter inoultion COM 1 3 Dys fter inoultion dd 1 3 Dys fter inoultion
35 Figure 4. Responses of PLDβ1 Aridopsis Mutnts to B. inere () Leves of three week-old Col-, pldβ1-1, RNAi, nd pldβ1-1-omplementtion (COM) plnts were inoulted with B. inere spores (2 1 7 fu/ml). or wter (ontrol). The photogrphs p show representtive leves 5 dys post-inoultion. () Lesions sored t 5 dys post inoultion. The lesion developing rte ws the numer of leves with neroti re mong the inoulted leves in eh line. Dt re presented s men ± SD (n = 25). Different letters indite smple groups with signifint differenes (p <.5) from eh other. () Expression of defense-relted genes in Col- nd PLDβ1 mutnts infeted with fungl pthogens. Leves treted with wter were used s ontrol. The reltive expression level of PR-1ws nlyzed y quntittive PCR. Expression levels were normlized with respet to the housekeeping genes. Dt rs represent the men (±SD) of three repets. (d) JA levels in Aridopsis wild-type (Col-), pldβ1-1, nd pldβ1omplementtion (COM) plnts with infetion with B. inere for vrious hours post inoultion (hpi). C indites ontrol (i.e. mok-inoulted) nd T indited treted (i.e. pthogen-inoulted). Three weekold soil-grown seedlings were treted with B. inere spores. Vlues re mens ± SE of three independent d replite experiments. (e) Sliyli id in Botrytis inere spore-inoulted PLDβ1 mutnts. Smples were hrvested fter inoultion Botrytis inere spores (5 x 1 7 fu/m1) for different time. Totl SA (free SA + SA Glyosides) in the wild-type, pldβ1-1, RNAi1, RNAi2, nd pldβ1-1 omplementtion plnts were determined y HPLC. Dt re presented s mens ± SD (n = 3).
36 () Col pldβ1 1 1 RNAi2 RNAi1 () H 2 O 2 (nmol/g FW W) Col- pldβ1-1 RNAi2 RNAi1 2 8 Time post inoultion (hr) () (d) Col pldβ1 1 RNAi2 RNAi1 2O 2 (nmol/g FW) H Col- pldβ1-1 RNAi2 RNAi1 1 3 Dys post inoultion (dy) Figure 5. ROS Genertion in Aridopsis Responses to Pthogen Infetion. The wild-type (Col-), pldβ1-1, RNAi1, nd RNAi2 plnts were inoulted with Pst DC3 (2 x 1 7 fu/ml) or Botrytis inere spores. Dt re presented s mens ± SD (n = 5). () Nitrolue tetrzolium stining of 5-week old Aridopsis leves 12 h post inoultion with Pst DC3 teril pthogen. () H 2 O 2 quntifition in Pst DC3-infeted leves 12 h post inoultion. () Nitrolue tetrzolium stining of 5-week old Aridopsis leves 12 h post inoultion with B. inere. (d) H 2 O 2 quntifition in B. inere spores-inoulted leves. Different letters indite vlues with signifint differenes (p <.5) from eh other. Figure 5
37 2 1 Col- C pldβ1-1 C COM C Col- T pldβ1-1 T COM T B. inere g) ight (nmol/m Pst DC3 Lipid/Dry we Pst DC3 (vrrpt2) PC PE PI PA PS PG MGDG DGDG Lipid speies (totl yl rons: totl doule onds) Figure 6. Content of different phospholipid nd gltolipid lsses from leves of Col-, pldβ1-1, nd pldβ1-com Aridopsis plnts with nd without inoultion of B. inere, Pst DC3, or virulent Pst DC3 (vrrpt2). Col-, pldβ1-1, nd pldβ1 omplementtion (COM) plnt were inoulted with ontrol solutions (-C) or with pthogens (-T). Control solutions were wter for Botrytis inere nd 1 mm MgSO 4 for virulent strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens SE (n = 5). Different letters indite smple groups with signifint differenes (p <.5) from eh other.
38 .2.1 B. inere Col- C pld 1-1 C COM C Col- T pld 1-1 T COM T /Dry weight (n nmol/mg).2.1 Pst DC3 Lipid/ Pst DC3 (vrrpt2). LPC LPE LPG Lipid speies (totl yl rons: totl doule onds) Figure 7. Levels of totl LPC, LPE, nd LPG from leves of Col-, pldβ1-1, nd pldβ1-com Aridopsis plnts with nd without inoultion of B. inere, Pst DC3, or virulent Pst DC3 (vrrpt2). Col-, pldβ1-1, nd pldβ1-com plnt were inoulted with ontrol solutions (-C) or with pthogens (-T). Control solutions were wter for Botrytis inere nd 1 mm MgSO 4 for virulent strin Pst DC3 nd virulent strin Pst DC3 (vrrpt2). Lef smples were olleted for lipid profiling 24 h post inoultion. Vlues re mens of SE (n = 5). Different letters indite vlues with signifint differenes (P <.5) from eh other.
39 Supplementl figures () () 7 Control 6 2 mm H2O2 1.1 mm MSA 5.1 mm MeSA 3 h 4.1 mm ABA EtBr 3.1 mm MeJA 6 h 2 EtBr 1 2 h EtBr 3h 6h 2 h Expre ession ( % on ntrol) Time of tretment Figure S1. PLDβ1 Expression Pttern in Aridopsis Leves. () Expression of PLDβ1 in response to vrious stresses. Aridopsis Col- eotype (3 week old) leves were dethed nd floted on wter without (Control) or with indited hemils: 2 mm H 2 O 2,.1 mm sliyli id (SA),.1 mm methyl sliyli id (MeSA),.1 mm sisi id (ABA), or.1 mm methyl jsmonte (MeJA) in growth hmer t 22 ºC. Leves were olleted t the indited times for RNA extrtion nd northern lotting. All smple RNAs from different tretments t different time points were eqully loded s indited y ethidium romide-stined 28S RNA. One representtive photos from three repets ws shown. () Quntifition of PLDβ1 in response to stresses. Dt were verge with S.D. mde using softwre to mesure nd intensity ompred with ontrol.
40 Hours Dys Hours Dys RNAi1 RNAi2 Col- PLDβ1 RNA (EtBr) Figure S2. PLDβ1 expression indued y Botrytis inere infetion in Col- nd PLDβ1 Aridopsis mutnts. Equl mounts of RNAs from leves were loded s indited y ethidium romide-stined 28S RNA, one representtive 28S RNA from three experiments ws shown here.
Arabidopsis phospholipase Db1 modulates defense responses to bacterial and fungal pathogens
Reserh Aridopsis phospholipse D1 modultes defense responses to teril nd fungl pthogens Jin Zho 1,, Shivkumr P. Devih 1, Cunxi Wng 1, Moyin Li,5, Ruth Welti 3 nd Xuemin Wng 1,,5 1 Deprtment of Biohemistry,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationSupplementary Information
Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationPlant Physiology Preview. Published on February 21, 2017, as DOI: /pp
Plnt Physiology Preview. Pulished on Ferury 21, 217, s DOI:1.114/pp.16.1928 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 Running title: Spliing regultor STA1 in het stress dpttion Corresponding Author:
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationJournal of Integrative Agriculture 2017, 16(0): Available online at ScienceDirect. , ZHU Dan-shi
Journl of Integrtive griulture 17, 1(): 345-7 ville online t www.sienediret.om SieneDiret RESERCH RTICLE Effets of thimine on Trihotheium nd lternri rots of muskmelon fruit nd the possile mehnisms involved
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationToxicity effects of seven Cu compounds/nps in Lettuce (Lactuca sativa) and Alfalfa (Medicago sativa)
Toxiity effets of seven Cu ompounds/nps in Lettue (Ltu stiv) nd Alflf (Medigo stiv) Jie Hong, Lijun Zho, Cyren Rio, Jose R Perlt-Vide, Jorge Grde-Torresdey The University of Texs t El Pso UC-CEIN Theme
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationPoultry No The replacement value of betaine for DL-methionine and Choline in broiler diets
Poultry No. 1573 The replement vlue of etine for DL-methionine nd Choline in roiler diets Key Informtion In roiler diets defiient in sulfur mino ids ut dequtely supplemented with methyl groups vi dded
More informationCAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY
CAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY 1 1 2 R. K. Frnk, M. W. Vorhies, nd M. M. Chengpp Summry Cuses of dirrhe, pneumoni, nd
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationJOURNAL OF ENVIRONMENTAL SCIENCES 34 (2015) Available online at ScienceDirect
JOURNAL OF ENVIRONMENTAL SCIENCES 4 (5) 9 99 Aville online t www.sienediret.om SieneDiret www.journls.elsevier.om/journl-of-environmentl-sienes Effets of nitrogen dioxide nd its id mist on retive oxygen
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationLysine enhances methionine content by modulating the expression of S-adenosylmethionine synthase
The Plnt Journl (7) 5, 85 86 doi:./j.365-33x.7.384.x ine enhnes methionine ontent y modulting the expression of S-denosylmethionine synthse Yel Hhm,, Luhu Song, Gdi Shuster nd Rhel Amir,3, Lortory of Plnt
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationCombined biotic stresses trigger similar transcriptomic responses but contrasting resistance against a chewing herbivore in Brassica nigra
Bonnet et l. BMC Plnt Biology (217) 17:127 DOI 1.1186/s1287-17-174-7 RESEARCH ARTICLE Open Aess Combined bioti stresses trigger similr trnsriptomi responses but ontrsting resistne ginst hewing herbivore
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationEFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN. Research Report to Northarvest Bean Growers, January 19, 2009
EFFECT OF SOYBEAN CYST NEMATODE ON GROWTH OF DRY BEAN Reserh Report to Northrvest Ben Growers, Jnury 19, 29 Berlin D. Nelson, Susilo Poromrto, n Ruell Goswmi, Dept. Plnt Pthology, NDSU Ojetive: Determine
More informationGibberellins regulate iron deficiency-response by influencing iron transport and translocation in rice seedlings (Oryza sativa)
nnls of otny 119: 95 956, 17 doi:1.19/o/mw5, ville online t www.o.oxfordjournls.org Gierellins regulte iron defiieny-response y influening iron trnsport nd trnslotion in rie seedlings (Oryz stiv) oln Wng
More informationEffects of exogenous nitric oxide on cadmium toxicity and antioxidative system in perennial ryegrass
Journl of Soil Siene nd Plnt Nutrition, 218, 18 (1), 129-143 RESEARCH ARTICLE Effets of exogenous nitri oxide on dmium toxiity nd ntioxidtive system in perennil ryegrss Chen, Weifeng 1, Dong, Yunjie 1*,
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationEthylene treatment improves diosgenin accumulation in in vitro cultures of Dioscorea zingiberensis via up-regulation of CAS and HMGR gene expression
Eletroni Journl of Biotehnology ISSN: 0717-3458 http://www.ejiotehnology.info DOI: 10.2225/vol16-issue5-fulltext-9 RESEARCH ARTICLE Ethylene tretment improves diosgenin umultion in in vitro ultures of
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationPerception of Bradyrhizobium japonicum Nod factor by soybean [Glycine max (L.) Merr.] root hairs under abiotic stress conditions
Journl of Experimentl Botny, Vol. 55, No. 48, pp. 2641 2646, Deemer 4 doi:1.193/jx/erh265 Advne Aess pulition 1 Septemer, 4 RESEARCH PAPER Pereption of Brdyrhizoium jponium Nod ftor y soyen [Glyine mx
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationInfluence of arbuscular mycorrhizal fungi on uptake of Zn and P by two contrasting rice genotypes
Influene of rusulr myorrhizl fungi on uptke of Zn nd P y two ontrsting rie genotypes R. Hjiolnd 1, 3, N. Alisghrzd, R. Brzeghr 1 1 Plnt Siene Deprtment, University of Triz, Triz, Irn Soil Siene Deprtment,
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationWhangarei District Council Class 4 Gambling Venue Policy
Whngrei Distrit Counil Clss 4 Gmling Venue Poliy April 2013 Whngrei Distrit Counil Clss 4 Gmling Venue Poliy Tle of ontents Introdution... 3 1 Ojetives of the poliy in so fr s promoted y the Gmling At
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationThe effect of manure, zeolite and soil ageing in the dynamics of hexavalent chromium in Cichorium spinosum
1 3 4 6 7 8 9 1 11 1 13 14 1 16 17 18 19 1 3 4 6 7 8 9 3 31 3 33 34 3 The effet of mnure, zeolite nd soil geing in the dynmis of hexvlent hromium in Cihorium spinosum V. Antonidis, T. Polyzois, S. Petropoulos,
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationIntroduction to Study Designs II
Introdution to Study Designs II Commonly used study designs in publi helth & epidemiologi reserh Benjmin Rihrd H. Muthmbi, DrPH, MPH Stte HIV Epidemiologist HIV Epidemiology Investigtion Setion PA Deprtment
More informationA. B. C. Succiniclasticum. Paraprevotella. Control DPA EPA DHA Control DPA EPA DHA a b. a a. b c.
389 Session 2: Miroil eosystem nd herivore nutrition Effet of dietry ddition of EPA, DPA nd DHA on rumen teril ommunity in ows nd ewes. An in vitro pproh Dvid Crreño 1, Álvro Belenguer 1, Eri Pinlohe 2,
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationActivation of Akt as a Mechanism for Tumor Immune Evasion
The Amerin Soiety of Gene Therpy originl rtile Ativtion of Akt s Mehnism for Tumor Immune Evsion Kyung Hee Noh 1, Te Heung Kng 1, Jin Hee Kim 1, Sr I Pi 2, Ken Y Lin 3, Chien-Fu Hung 4, T-C Wu 4 7 nd Te
More informationSeedling treatments and phosphorus solution concentrations affect nodulation and nodule functions in soybean (Glycine max L.)
Seedling tretments nd phosphorus solution onentrtions ffet nodultion nd nodule funtions in soyen (Glyine mx L.) S.J. Mio 1, 2, 3, X.Z. Hn 1, X.B. Liu 1, Y.F. Qio 1 1 Northest Institute of Geogrphy nd Agrio-Eology,
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationIranian Food Science and Technology Research Journal Vol. 6, No. 3, Fall, 2010.
Irnin Food Siene nd Tehnology Reserh Journl Vol. 6, No. 3, Fll, 2010. rvghi.mrym@gmil.om C ( AOAC 920.87 AOAC 942.05 AOAC 962.09 AOAC 922.06 AOAC 925.10 AACC 1- Extrusion-Expelling 2- Protein Dispersiility
More informationARTICLE. I. Chopra & H. F. Li & H. Wang & K. A. Webster
Dietologi (212) 55:783 794 DOI 1.17/s125-11-247-y ARTICLE Phosphoryltion of the insulin reeptor y AMP-tivted protein kinse (AMPK) promotes lignd-independent tivtion of the insulin signlling pthwy in rodent
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationOther Uses for Cluster Sampling
Other Uses for Cluster Smpling Mesure hnges in the level of n ttriute Hypothesis testing versus intervl estimtion Type I n 2 errors Power of the test Mesuring ttriute t sme time in ifferent sites Exmple:
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationSalinity and drought represent serious problems worldwide negatively
PERIODICUM BIOLOGORUM UDC 57:61 VOL. 11, No 3, 93 99, 1 CODEN PDBIAD ISSN 31-536 Originl sientifi pper Effets of osmoti stress on ntioxidtive system of dukweed (Lemn minor L) SANDRA RADI] BRANKA PEVALEK-KOZLINA
More informationA AOAC Official Method Fat (Total, Saturated, Unsaturated, and Monounsaturated) in Cereal Products
32.2.02A AOAC Offiil Method 996.01 Ft (Totl, Sturted, Unsturted, nd Monounsturted) in Cerel Produts Aid Hydrolysis Cpillry Gs Chromtogrphi Method First Ation 1996 (Applile for determintion of ft in erel
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationResearch Article The Protection of Hepatocyte Cells from the Effects of Oxidative Stress by Treatment with Vitamin E in Conjunction with DTT
Hindwi Pulishing Corportion Journl of Biomediine nd Biotehnology Volume 21, Artile ID 486267, 7 pges doi:1.1155/21/486267 Reserh Artile The Protetion of Heptoyte Cells from the Effets of Oxidtive Stress
More informationBTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1
BTLA is lymphoyte inhiitory reeptor with similrities to CTLA-4 nd PD-1 Norihiko Wtne 1,5, My Gvrieli 1, John R Sedy 1, Jinfei Yng 1,5, Frnes Fllrino 2, Susn K Loftin 1, Mihelle A Hurhl 1, Ntlie Zimmermn
More informationAlleviation of oxidative stress induced by drought stress through priming by β- aminobutyric acid (BABA) in Rapeseed (Brassica napus L.
223 Allevition of oxidtive stress indued y drought stress through priming y β- minoutyri id (BABA) in Rpeseed (Brssi npus L.) plnts Ned Mohmdi 1,2, Amin Bghizdeh 3*, Sr Sdtmnd 1, Zhr Asrr 4 1. Deprtment
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationInterdependency of Reactive Oxygen Species generating and scavenging system in salt sensitive and salt tolerant cultivars of rice
Kur et l. BMC Plnt Biology (2016) 16:131 DOI 10.1186/s12870-016-0824-2 RESEARCH ARTICLE Interdependeny of Retive Oxygen Speies generting nd svenging system in slt sensitive nd slt tolernt ultivrs of rie
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationLesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationEvolution of metal hyperaccumulation required cis-regulatory changes and triplication of HMA4
Vol 453 15 My 28 doi:1.138/nture6877 LETTERS Evolution of metl hyperumultion required is-regultory hnges nd triplition of HMA4 Mr Hnikenne 1 {*, In N. Tlke 1 {*, Mihel J. Hydon 1 {, Christ Lnz 2, Andre
More informationPlant Growth and Photosynthesis Response to Low Potassium Conditions in Three Lettuce (Lactuca sativa) Types
The Hortiulture Journl 86 (2): 229 237. 217. doi: 1.253/hortj.OKD-8 JSHS The Jpnese Soiety for Hortiulturl Siene http://www.jshs.jp/ Plnt Growth nd Photosynthesis Response to Low Potssium Conditions in
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationIntestine specific MTP deficiency with global ACAT2 gene ablation lowers acute cholesterol absorption with chylomicrons and high density lipoproteins
Intestine speifi MTP defiieny with glol ACAT2 gene ltion lowers ute holesterol sorption with hylomirons nd high density lipoproteins 1,2 Jhngir Iql, 1,2 Mohmed Boutjdir, 3 Lwrene L. Rudel, 1,2 M. Mhmood
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationAdipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
Reeived 11 Jul 1 Aepted Fe Pulished 11 Mr DOI: 1.138/nomms795 OPEN Adipose tissue NAPE-PLD ontrols ft mss development y ltering the rowning proess nd gut miroiot Luie Geurts 1, Amndine Everrd 1,, Mtthis
More informationCONCENTATION OF MINERAL ELEMENTS IN CALLUS TISSUE CULTURE OF SOME SUNFLOWER INBRED LINES
CONCENTATION OF MINERAL ELEMENTS IN CALLUS TISSUE CULTURE OF SOME SUNFLOWER INBRED LINES M. Sri 1, Drgn Vsi, Lj. Vsiljevi, D. Skori, Snezn Mezei nd Sloodnk Pjevi 2 ABSTRACT Conentrtion of minerl elements
More informationEffects of Feeding Citrus Pulp or Corn Supplements With Increasing Levels of Added Undegraded Intake Protein on the Performance of Growing Cattle
Effets of Feeding Citrus Pulp or Corn Supplements With Inresing Levels of Added Undegrded Intke Protein on the Performne of Growing Cttle Deke Alkire Todd Thrift Willim Kunkle 1 Citrus pulp-sed supplements
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationAbortion frequency (%) Ovary position on ear Ovary volume (mm 3 )
ortion frequeny (%) 5 1 Ovry position on er 3 1 WW WD pex Bse Ovry volume (mm 3 ) Figure S1. Ovry volume (thik lines) n ortion frequeny (thin lines) s funtion of position long the er, 15 ys fter silk emergene
More informationPhytosphingosine-phosphate is a signal for AtMPK6 activation and Arabidopsis response to chilling
Reserh Phytosphingosine-phosphte is signl for AtMPK6 tivtion nd Arbidopsis response to hilling Christelle Dutilleul 1, Ghouziel Benhssine-Kesri 1, Chntl Demndre 1, Nthlie Rézé 1, Albn Luny 1, Sndr Pelletier
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationCHROMIUM ACCUMULATION BY PHYTOREMEDIATION WITH MONOCOT WEED PLANT SPECIES AND A HYDROPONIC SAND CULTURE SYSTEM
Journl of Environmentl Reserh And Development Vol. 4 No. 3, Jnury-Mrh 21 CHROMIUM ACCUMULATION BY PHYTOREMEDIATION WITH MONOCOT WEED PLANT SPECIES AND A HYDROPONIC SAND CULTURE SYSTEM Pntwt Smpnpnish *1,2,
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationOpen Access RESEARCH ARTICLE. Genetics Selection Evolution
DOI 10.1186/s12711-016-0222-0 Genetis Seletion Evolution RESEARCH ARTICLE Open Aess Comprison of host geneti ftors influening pig response to infetion with two North Amerin isoltes of porine reprodutive
More informationToll-Like Receptor Activation during Cutaneous Allergen Sensitization Blocks Development of Asthma through IFN-Gamma-Dependent Mechanisms
ORIGINAL ARTICLE See relted ommentry on pg 874 Toll-Like Reeptor Ativtion during Cutneous Allergen Sensitiztion Bloks Development of Asthm through IFN-Gmm-Dependent Mehnisms Rit Hpkoski 1, Pii Krisol 1,
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationRoles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells
ritish Journl of Cner (23) 89, 18 191 & 23 Cner Reserh UK All rights reserved 7 92/3 $2. www.jner.om Roles of the PI-3K nd MEK pthwys in Rs-medited hemoresistne in rest ner ells W Jin 1,LWu 1, K Ling 1,
More informationDHRS3, a retinal reductase, is differentially regulated by retinoic acid and lipopolysaccharide-induced inflammation in THP-1 cells and rat liver
Am J Physiol Gstrointest Liver Physiol 33: G78 G88, 212. First pulished July 12, 212; doi:1.112/jpgi.23.212. DHRS3, retinl redutse, is differentilly regulted y retinoi id nd lipopolyshride-indued inflmmtion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationCorresponding author: * ABSTRACT
The Afrin Journl of Plnt Siene nd Biotehnology 8 Glol Siene Books Reltive Suseptiility of Nine Potto (Solnum tuerosum L.) Cultivrs to Artifiil nd Nturl Infetion y Rhizotoni solni s Mesured y Stem Cnker
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationThioredoxin-interacting protein links oxidative stress to inflammasome activation
A rt i l e s Thioredoxin-interting protein links oxidtive stress to inflmmsome tivtion Rongin Zhou 1, Aury Trdivel 1, Bernrd Thorens 2, Inpyo Choi 3 & Jürg Tshopp 1 29 Nture Ameri, In. All rights reserved.
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More information