Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Transcription

1 Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG Interleukin 6 (Il6) hemokine (-X- motif) ligand 10 (xcl10) Interleukin 1 beta (Il1b) Interleukin 18 (Il18) GGGGTTT G TGGTTGT GGT GTGTGTTTGTG TGGGTGTTGT G GTTGGTGT GTTGGGTTTTT GGGGGTGT T aspase-1 (asp1) GTGTGTGTGG TTGGGTTTGT NLR family, pyrin domain containing 3 (Nlrp3) GTGGTGTTGTGGGT TTTTGGGGTTT PYD and RD domain containing (sc/ Pycard) GTGTTGTGGT TTTTGTTTGGTGGTG Thioredoxin interacting protein (Txnip) TTGTGTGGTT TTGGTTGTTGTTGT NLR family, pyrin domain containing 1 (Nlrp1) TGGTTGT TTTGG NLR family, RD domain containing 4 (Nlrc4) TTTGTGTGTTGG TGTTGTG bsent in melanoma 2 (im2) GTGGGGGGG TTTGGTTTGGTTT rginase 1 (rg1) TGGTTTG G GGGTGTTTGGG T -type lectin domain family 7,member a (lec7a) TTTGGTG TGGGGGTGTTTTTG Programmed cell death 1 ligand 2 (Pdc1lg2) GTGGTTTGTTTT TTTGGGGTTTTG Interleukin 1 receptor anagonist (Il1rn) TTGTGGTTGGGTG TTTGGGGTGGGT Mannose-6-phosphate receptor (M6pr) ion channel, 1 (P2X 1) ion channel, 2 (P2X 2) ion channel, 3 (P2X 3) ion channel, 4 (P2X 4) ion channel, 5 (P2X 5) GTGGGGTTTTT T GTTTGTG TTTTGGTG TTTTGGGGTGT GTGTGTGGTTGT T GGGGTGGG TTTTTTTGT T TGGGTGGT GTTGTGTTT TGGTGTGGGTT G TTTGTGGTGGT GTGTGGTTTGTTG TTTGTGTGTGT GTGGGTTGGGGTG

2 ion channel, 6 (P2X 6) ion channel, 7 (P2X 7) TGTGTGTTGTTGT TTGGTTTTG Forkhead box P3 (Foxp3) TGTGTTGTTT GGGTTGGGTTGTTG coupled 1 (P2Y 1) coupled 2 (P2Y 2) coupled 4 (P2Y 4) coupled 6 (P2Y 6) coupled 10 (P2Y 10) coupled 12 (P2Y 12) coupled 13 (P2Y 13) coupled 14 (P2Y 14) Ribosomal protein L32 (L32) GGTGGGG GGTGTGTTGTGGTG GGGGGTTG GTGTTTGGTT GTTGTGGGGTTTT GGTTTGGGTTTG GTGGTTTT TTGTGTG GGGG TTGGTGG GGGGTTTG TTGGGG G GTTTGTTGT TTGTTGTGTTTG GGTGGTTTGGTGGGT G GTGTGTTGGTGT GGTTGGG TGGTTT Supplementary Figure 1. Upregulation of the Nlrp1 and Nlrc4 transcripts in WT with HFD. Quantitative-PR (q-pr) analysis of Nlrp1 and Nlrc4 mrn levels in epididymal WT from HFD-fed WT mice for the indicated time periods, compared to WT mice on LFD. N=5 mice per group. Mice were plated on HFD at age of 6w old, and the LFD mice were age-matched with 12w HFD. Values represent mean ± s.e.m. *, P<0.05, **, P<0.01 and ***, P<0.001.

3 Supplementary Figure 2. Morphological changes of epididymal WT with HFD feeding. Representative images of H&E stained WT sections from LFD and HFD male WT mice. The LFD mice were age-matched with 6w HFD mice. Note the increase of adipose-infiltrating cells upon long-term HFD. Supplementary Figure 3. Liver and pancreas morphology in mice with whole body P2X 7 - ablation. Representative images of H&E stained liver and pancreas sections from agematched LFD-fed WT, 12w HFD-fed WT and P2X 7 (KO) mice.

4 Supplementary Figure 4. Microarray analysis and the expression of P2 receptors in WT of WT and P2X 7 mice. () Heat-map showing the fold-changes of genes in WT of WT or P2X 7 (KO) mice on LFD or 12w HFD. Only genes that are upregulated (red) or downregulated (blue) by HFD in WT of WT mice (using the criteria of q < and fold change > 1.5), a total of 3097 genes, shown. The fold-changes shown as signal log ratio. Each column represents an independent sample (n=3-4 mice each). (B) Q-PR analyses of P2X and P2Y genes in 12w HFD-fed WT and P2X 7 WT, n=10 mice per group. Of note, P2X 2, P2X 6, P2Y 4, P2Y 13 and P2Y 14 were not detected in WT in Q-PR. () RT-PR analysis of various P2Y genes in purified primary adipocytes, SV, epididymal WT, liver and peritoneal macrophages (Mac) of WT mice. L32, a loading control. No RT, negative controls with no reverse transcription.

5 Supplementary Figure 5. Whole body P2Y 2 -ablation does not affect metabolic status of obese mice nor inflammatory status of obese WT. () Growth curve of age-matched male WT and P2Y 2 mice upon HFD feeding. (B-E) Metabolic phenotypes of 21w-old male mice upon 15w HFD: Glucose tolerance test with 1g glucose/kg BW following a 16 h fast (B), insulin tolerance test with 36 μg insulin/kg BW following a 5 h fast (), epididymal WT weight (D), serum glycerol level following a 4 h fast (E). (F) Q-PR analysis of inflammatory and inflammasome genes in 15w HFD-fed WT and P2Y 2 WT. (G-H) Western blot analysis (G) and quantification (H) of pro-caspase-1 p45, cleaved caspase-1 intermediate p35, IκB, rg1, phosphorylated (p-s473) and total KT protein levels in 15w-HFD-fed WT and P2Y 2 WT following a 4 h fast. For all, n=5-13 mice per group. Values represent mean ± s.e.m.

6 Supplementary Figure 6. Reconstitution of adipose tissue SV fractions following congenic bone marrow transplantation (BMT) between D and D mice. BMT was performed between congenic D and D male 57BL/6 mice. 4w post recovery, flow cytometry analysis was used to determine the ratio of engraftment in spleen and SV, as indicated by D45.1 and D45.2 cell surface markers. Briefly, cells were incubated with 20 μl of antibodies diluted at optimal concentrations for 20 min at 4. ells were washed three times with PBS and then resuspended in 200 μl PBS for analysis using the FSalibur Flow ytometer (BD Biosciences). PerP-D45.1, biotin-d45.2, FIT-avidin and isotype control antibodies were purchased from Biolegend, ebioscience and BD Biosciences. Note that the majority of SV cells are D in D mice after BMT, as shown in the bottom right panel. Supplementary Figure 7. Morphology of the liver and pancreas in 16w HFD-fed chimeric mice. Representative images of H&E stained liver and pancreas sections from 28w-old chimeric BMT mice after 16w HFD feeding (the same mice as shown in Fig. 5-6).

7 Supplementary Figure 8. Western blot analyses of caspase-1 p20 in WT of () WT mice under LFD and 12w HFD with a negative control from asp1 mice, showing the specificity of the antibody, (B) WT and P2X 7 mice under 12w HFD, and () chimeric BMT mice under 16w HFD. For all, samples were the same as the ones shown in the Figures 1D, 4 and 6. Upon electrophoresis on 12% SDS-PGE and transfer, the PVDF membranes were blocked in 5% milk for 40 minutes and then incubated with rat anti-mouse caspase-1 p20 antibody overnight. Only a weak signal indicating p20 at 20kD could be detected, together with a strong nonspecific band at 25kD. Nonetheless, these data are consistent with the data for the caspase-1 intermediate p35 shown in Figures 1, 4 and 6.