British Journal of Nutrition

Transcription

1 British Journl of Nutrition (), 6, q The Authors doi:.7/s75 Tretment with oligonol, low-moleculr polyphenol derived from lychee fruit, ttenutes dietes-induced heptic dmge through regultion of oxidtive stress nd lipid metolism Jeong Sook Noh, Chn Hum Prk nd Tkko Yokozw* Institute of Nturl Medicine, University of Toym, 6 Sugitni, Toym 9-9, Jpn (Received July Revised Jnury Accepted 8 Jnury First pulished online April ) British Journl of Nutrition Astrct We hve identified the effects of oligonol, low-moleculr polyphenol derived from lychee fruit, on oxidtive stress nd lipid metolism in type dietic model. Oligonol ws orlly dministered t or mg per kg ody weight per d for 8 weeks to d/d mice, nd its effects were compred with those of the vehicle in d/d nd mice. Serum nd heptic iochemicl fctors, nd protein nd mrna expression relted to lipid metolism were mesured. In the oligonol-dministered group, there were significnt reductions of rective oxygen species (ROS), lipid peroxidtion, nd the TAG nd totl cholesterol concentrtions in oth the serum nd liver. Additionlly, oligonol ttenuted oxidtive stress through the inhiition of dvnced glyction endproduct formtion nd its receptor expression. Furthermore, ugmented expressions of NF-kBp65 nd inducile NO synthse were down-regulted to the levels of mice in the group treted with oligonol t mg/kg. Regrding lipid metolism, lower heptic lipid resulted from the down-regultion of sterol regultory element-inding protein- nd its trget gene of lipogenic enzymes in the liver of d/d mice. The present results suggest tht oligonol hs protective effects ginst ROS-relted inflmmtion nd excess lipid deposition in the type dietic liver. Key words: Oligonol: Type dietes: Oxidtive stress: Dyslipidemi: Stetosis Type dietes is ssocited with oxidtive stress nd norml lipid metolism due to hyperglycemi nd hyperlipidemi. Incresed rective oxygen species (ROS) genertion nd lipid peroxidtion ctivte stress-sensitive intrcellulr signlling pthwys such s the trnscription of NF-kB, which plys centrl role in inflmmtion-relted disese (). In ddition, hyperglycemi ccelertes the formtion of dvnced glyction endproducts (AGE), which re proteins produced from non-enzymic glyction rections (). AGE nd their inding with receptors, such s the receptor for AGE (RAGE), glectin- nd CD6, induce free rdicl formtion. They ccumulte during the norml geing process nd t ccelerted rtes during the course of dietes, nd re ssocited with the pthogenesis of chronic diseses such s rthritis, therosclerosis, liver cirrhosis nd dietic nephropthy (). Therefore, the ttenution of oxidtive stress during the initition nd propgtion of type dietes is importnt to prevent vicious cycle of inflmmtory responses nd tissue dmge. Moreover, insulin resistnce in type dietes leds to mrked disruption of lipid dynmics, often reflected y elevted levels of circulting NEFA nd TAG, together with excess ft deposition in vrious tissues (). Lipid homeostsis is regulted y trnscription fctor, sterol regultory elementinding protein (SREBP), which is highly expressed in the presence of metolic disorders such s oesity nd dietes. In prticulr, up-regulted SREBP- hs een suggested to ply centrl role in the development of heptic stetosis in n insulin-resistnt niml model (5). Accordingly, to prevent dietic heptic dmge induced y inflmmtion nd/or excess lipid ccumultion, it is importnt to reduce oxidtive stress nd inhiit lipid synthesis in the liver. Currently, functionl food nd/or dietry ingredients with helth enefits re eing given much ttention due to the sence of dverse effects, undnt production nd ppliction to vrious commercil goods (6). Oligonol is phenolic product derived from lychee fruit extrct contining ctechin-type monomers nd oligomers of pronthocynidins, produced y mnufcturing process which converts Arevitions: ACC, cetyl-coa croxylse; AGE, dvnced glyction endproduct; CEL, N -(croxyethyl)lysine; CML, N -(croxymethyl)lysine; COX-, cyclo-oxygense-; FAS, ftty cid synthse; GSH, reduced glutthione; GSSG, oxidised glutthione; HMGR, -hydroxy--methylglutryl-coa reductse; inos, inducile NO synthse; RAGE, receptor for dvnced glyction endproduct; ROS, rective oxygen species; SREBP, sterol regultory elementinding protein; TBARS, thiorituric cid-rective sustnce. * Corresponding uthor: Dr Tkko Yokozw, fx þ , emil yokozw@inm.u-toym.c.jp Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

2 J. S. Noh et l. British Journl of Nutrition polyphenol polymers into oligomers (7,8). Oligonol is produced y the oligomeristion of polyphenol polymers, typiclly pronthocynidins; thus, oligonol delivers higher levels of oligomeric pronthocynidins compred with fruit nd plnt sources tht generlly contin high-moleculr-weight pronthocynidins. There is ccumulting evidence tht oligonol cn exert some iologicl effects in vitro nd in vivo: nticncer (9), s well s ntioxidnt nd nti-inflmmtory effects (), eneficil ctivity for NO iovilility () nd regultory effect on lipid metolism (,). Indeed, dietry feeding with pronthocynidins, which comprise oligonol, hs een reported to induce significnt ttenution of tissue ft levels, without chnging the totl ody mss of the nimls compred with non-pronthocynidin-fed nimls (). However, there is no evidence to support whether or not oligonol hs ny effect on oxidtive stress-induced inflmmtion nd norml lipid ccumultion in the liver of oesity-induced type dietes. Therefore, we investigted the effects of oligonol on heptic dmge induced y hyperglycemi, norml lipid synthesis nd NF-kB-relted inflmmtion, using typicl type dietic niml, the C57BLKS/J d/d mouse. Mterils nd methods Oligonol Oligonol ws generted y oligomerising polyphenol polymers derived from lychee fruit. The sfety of oligonol s food or dietry supplement nd s phrmceuticl dditive hs lredy een confirmed, s descried previously (8). Oligonol comprises polyphenol mixture of 6 % monomers (ctechin, epictechin, epictechin gllte nd epiglloctechin gllte) nd 9 % dimers (procynidin A, A, B nd B), while lychee fruit polyphenols comprise mixture of 6 % monomers nd 9 8 % dimers. Oligonol is commercilly ville (Amino Up Chemicl Co., Ltd, Spporo, Jpn). Mterils Protese inhiitor mixture solution,,6-dihydroxy-- mercptopyrimidine (-thiorituric cid), EDTA, reduced glutthione (GSH) nd oxidised glutthione (GSSG) were purchsed from Wko Pure Chemicl Industries, Ltd (Osk, Jpn).,7 -Dichlorofluorescein dicette ws purchsed from Moleculr Proes (Eugene, OR, USA). The Bio-Rd protein ssy kit nd pure nitrocellulose memrne were purchsed from Bio-Rd Lortories (Tokyo, Jpn). -Actin, o-phthlldehyde, phenylmethylsulfonyl fluoride nd N-ethylmleimide were purchsed from Sigm Chemicl Co. (St Louis, MO, USA). Rit polyclonl ntiodies ginst PPAR, SREBP-, SREBP-, NF-kBp65 nd RAGE, nd mouse monoclonl ntiody ginst cyclo-oxygense- (COX-) nd inducile NO synthse (inos) were purchsed from Snt Cruz Biotechnology, Inc. (Snt Cruz, CA, USA). Monoclonl nti-n -(croxyethyl)lysine (CEL) ntiody nd polyclonl nti-n -(croxymethyl)lysine (CML) ntiody were kindly provided y Dr R. Ngi (Kummoto University, Kummoto, Jpn). Got nti-rit nd got nti-mouse IgG horserdish peroxidse-conjugted secondry ntiodies were purchsed from Snt Cruz Biotechnology, Inc. ECL TM Western Blotting Detection Regents were purchsed from Amershm Bioscience (Pisctwy, NJ, USA). Experimentl protocol The Guidelines for Animl Experimenttion pproved y the University of Toym were followed in the present study (registrtion no. S-6 INM-). Mle C57BLKS/J d/d nd ge-mtched mice, ged 5 weeks, were purchsed from Jpn SLC Inc. (Hmmtsu, Jpn). C57BLKS/J mice were used s norml control in the experiment. Mice were mintined under h light drk cycle, fed stndrd lortory pellet chow (comprising % protein, 5 % lipids nd 6 5 % crohydrte; CLEA Jpn Inc., Tokyo, Jpn) nd wter d liitum, nd housed in room with controlled temperture ( ^ 8C) nd humidity (out 6 %). Oligonol ( or mg/kg ody weight per d) ws orlly dministered to d/d mice (Oligo- or Oligo-, n, respectively), while vehicle-treted d/d (n ) nd non-dietic control (n 6) mice received wter every dy for 8 weeks. The ody weight, food intke nd wter intke were mesured every dy during the tretment period. After 8 weeks of oligonol tretment, lood smples were collected from nesthetised mice y crdic puncture. The serum ws immeditely seprted from lood smples y centrifugtion. Susequently, to remove the remining lood in the liver, ech mouse ws perfused with ice-cold physiologicl sline y syringe fter crdic puncture, nd the liver ws hrvested, plunged into liquid N nd stored t 88C until nlysis. Mesurement of serum prmeters Serum glucose, TAG, totl cholesterol nd NEFA levels were mesured using commercil kit (Glucose CII-Test, Triglyceride E-Test, Cholesterol E-Test nd NEFA C-Test from Wko Pure Chemicl Industries, Ltd, Osk, Jpn). The serum ROS level ws determined using the method of Ali et l. (5) nd the thiorituric cid-rective sustnce (TBARS) concentrtion ws exmined employing the method of Nito & Ymnk (6). Heptic functionl prmeters (lnine minotrnsferse nd sprtte minotrnsferse) were mesured using Wko kit (Trnsminse CII-Test). Mesurement of heptic TAG nd totl cholesterol contents Heptic tissues were homogenised in ice-cold 9 % NCl uffer. Then the homogente ws extrcted with mixture of chloroform nd methnol (:, v/v) ccording to the method of Folch et l. (7), nd the mixture ws centrifuged t 67 g for 5 min. The orgnic lyer ws collected nd dried, nd the residue ws dissolved in isopropnol. Determintions for TAG nd totl cholesterol contents were performed using the Wko kit. Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

3 Attenution y oligonol of heptic dmge 5 British Journl of Nutrition Assessment of heptic rective oxygen species genertion nd thiorituric cid-rective sustnce levels ROS genertion ws mesured using the method of Ali et l. (5). Heptic tissues were homogenised on ice with mm-edta 5 mm-sodium phosphte uffer (ph 7 ), nd then 5 mm-,7 -dichlorofluorescein dicette ws dded to homogentes. After incution for min, the chnges in fluorescence vlues were determined t n excittion wvelength of 86 nm nd emission wvelength of 5 nm. The heptic TBARS content, n oxidtive stress iomrker, ws determined employing the method of Mihr & Uchiym (8). Determintion of heptic reduced glutthione nd oxidised glutthione levels GSH nd GSSG ssys were crried out pplying the method of Hissin & Hilf (9). Heptic tissues were homogenised on ice with mm-edta 5 mm-sodium phosphte uffer (ph 7 ). Then, 5 % metphosphoric cid ws dded for protein precipittion. The homogente ws centrifuged t 8C t g for min to otin the superntnt frction for the ssys of GSH nd GSSG. To ssy GSH, mm-edta 5 mm-sodium phosphte uffer (ph 7 ) ws dded to the superntnt frction, followed y the ddition of o-phthlldehyde. After min t room temperture, fluorescence ws estimted t n excittion wvelength of 6 nm nd emission wvelength of 6 nm. GSSG ws ssyed fter pre-incution with N-ethylmleimide for min, nd M-NOH ws sustituted for the phosphte uffer. After incution for min t room temperture, the fluorescence vlue ws estimted t n excittion wvelength of 6 nm nd emission wvelength of 6 nm. Protein ssys were crried out ccording to the method of Itzhki & Gill () using ovine serum lumin s stndrd. Preprtion of nucler nd post-nucler frctions To prepre nucler frctions, heptic tissues were homogenised with ice-cold lysis uffer contining 5 mm--mino- -hydroxymethyl-propne-,-diol (Tris)-HCl (ph 7 5), mm-mgcl,5mm-ccl nd M-sucrose, nd then M- dithiothreitol (DTT) nd protese inhiitor cocktil were dded. After centrifugtion ( 5 g for min t 8C), the pellet ws suspended with extrction uffer contining mm--[-(-hydroxyethyl)--piperzyl] ethnesulfonic cid (ph 7 9), mm-mgcl, M-NCl, mm-edta nd 5 % (v/v) glycerol, nd then M-DTT nd protese inhiitor cocktil were dded. The mixture ws plced on ice for min. The nucler frction ws prepred y centrifugtion t 5 g for 5 min t 8C. The post-nucler frction ws extrcted from the liver of ech mouse, s descried elow. In rief, heptic tissue ws homogenised with ice-cold lysis uffer (ph 7 ) contining 7 mm-ncl, mm-tris-hcl, % Tween, % glycerol, mm-phenylmethylsulfonyl fluoride nd protese inhiitor mixture solution. The homogente ws then centrifuged t g for min t 8C. The protein concentrtion of ech frction ws determined using commercil kit (Bio-Rd Lortories, Hercules, CA, USA). Western lot nlyses For the determintion of NF-kB, PPAR, SREBP- nd SREBP-, mg protein of ech nucler frction ws electrophoresed through 8 % SDS-PAGE. Seprted proteins were trnsferred to nitrocellulose memrne, locked with 5 % (w/v) skimmed milk solution for h, nd then incuted with primry ntiodies to NF-kBp65, PPAR, SREBP-, SREBP- nd -ctin, respectively, overnight t 8C. After the lots were wshed, they were incuted with nti-rit or ntimouse IgG horserdish peroxidse-conjugted secondry ntiody for h t room temperture. Also, mg of protein of ech post-nucler frction for COX-, inos, RAGE, CEL nd CML were electrophoresed through 8 % SDS-PAGE. Ech ntigen ntiody complex ws visulised using ECL Western Blotting Detection Regents nd detected y chemiluminescence with LAS- (Fujifilm, Tokyo, Jpn). Bnd densities were determined using ATTO Densitogrph Softwre (ATTO Corportion, Tokyo, Jpn) nd quntified s the rtio to -ctin. These protein levels of groups re expressed reltive to those of mice (represented s ). Quntittive rel-time PCR Totl RNA ws isolted from heptic tissue using Trizol regent (Invitrogen Life Technologies, Crlsd, CA, USA) nd quntified with NnoDrop (Thermo Scientific, Wilmington, DE, USA). The cdna were synthesised from 5 mg of RNA using RT (QIAGEN, Tokyo, Jpn). For the rel-time PCR, triplicte smples of serilly diluted cdna smples were used in rection mixture tht contined mm of ech primer in rection volume of 5 ml using the SYBR Green Rel-time PCR kit (QIAGEN, Tokyo, Jpn) nd fluorometric therml cycler (MxP TM ; Strtgene, L Joll, CA, USA). Rection mixtures were incuted for n initil denturtion t 958C for 5 min, followed y forty-five cycles t 98C for 5 s, 68C for s nd 78C for s. Primers used were s follows: cetyl- CoA croxylse (ACC; sense: CCCAGCAGAATAAAGCTACT- TTGG, ntisense: TCCTTTTGTGCAACTAGGAACGT), ftty cid synthse (FAS; sense: CCTGGATAGCATTCCGAACCT, ntisense: AGCACATCTCGAAGGCTACACA) nd -hydroxy-- methylglutryl-coa reductse (HMGR; sense: AGCCGAAGCA- GCACATGAT, ntisense: CTTGTGGAATGCCTTGTGATTG). Glycerldehyde -phosphte dehydrogense (GAPDH) ws employed s n endogenous control. The DC T method ws used for reltive quntifiction. The DC T vlue for ech smple ws determined y clculting the difference etween the C T vlue of the trget gene nd tht of the GAPDH reference gene. The normlised trget gene expression level in the smple ws clculted using the formul DDCT s the fold chnge over the control. Histology The excised prts of livers were immeditely fixed with % neutrl-uffered formlin nd, fter emedding in prffin, they were cut into 5 mm-thick sections. After oil red O stining, these sections were exmined with light microscope. Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

4 6 J. S. Noh et l. Sttisticl nlysis Dt re expressed s men vlues with their stndrd errors. Sttisticl comprisons were performed y one-wy ANOVA followed y Duncn s multiple-rnge test. Sttisticl nlysis ws conducted using SAS (relese 9.; SAS Institute, Inc., Cry, NC, USA) nd P, 5 ws considered significnt. those of mice, wheres these enhnced levels were significntly reduced y oligonol tretment in dosedependent mnner. Concerning the heptic GSH, GSSG nd GSH:GSSG rtio, there were significnt ltertions etween vehicle d/d nd groups. Oligonol dministrtion significntly ugmented the GSH:GSSG rtio due to mrked decrese in the GSSG level in the liver of d/d mice. British Journl of Nutrition Results Generl chrcteristics Type dietic chrcteristics such s excessive ody-weight gin, food intke nd wter intke were exhiited in d/d mice t ge 7 weeks compred with norml mice (Tle ). The liver weight ws higher in d/d thn mice; however, oligonol dministrtions led to no significnt differences in d/d groups. In serum nlyses, glucose nd lipid concentrtions were incresed in d/d compred with mice; however, except for serum glucose, oligonol dministrtion significntly reduced serum concentrtions of TAG, totl cholesterol nd NEFA t mg/kg doses (Tle ). In ddition, oxidtive stress-relted prmeters, ROS nd TBARS, were enhnced in vehicle d/d compred with mice. However, oligonol tretment t mg/kg significntly reduced the ROS level nd inhiited lipid peroxidtion in the serum of d/d mice (Tle ). Regrding heptic functionl prmeters, serum lnine minotrnsferse nd sprtte minotrnsferse levels in vehicle d/d mice were elevted compred with mice, while, in oligonoldministered d/d mice, only the lnine minotrnsferse level ws significntly decresed (Tle ). Heptic iomrkers ssocited with oxidtive stress As shown in Fig., the heptic levels of ROS nd TBARS in vehicle-treted d/d mice were pprently higher thn Heptic NF-kBp65, cyclo-oxygense- nd inducile NO synthse expressions At the end of the experiment, heptic NF-kBp65- nd NF-kBmedited trget protein expression levels in the vehicletreted d/d group were significntly up-regulted compred with those in the group (Fig. ). The dministrtion of oligonol suppressed the trnscription of NF-kB in the liver. Also, up-regulted heptic inos expression levels were reduced on oligonol tretment t mg/kg. Concerning heptic COX- protein expression, oligonol tretment showed reducing tendency, ut this ws not significnt. Heptic receptor for dvnced glyction endproducts, N -(croxyethyl)lysine nd N -(croxymethyl)lysine expressions In Fig., protein expressions of AGE-relted proteins were enhnced in the d/d mouse liver t 7 weeks. The d/d mice showed up-regulted protein expressions of RAGE nd CML, ut the orl dministrtion of oligonol ttenuted these protein levels. Heptic CEL protein expression remined unchnged in ll experimentl groups. Heptic TAG nd totl cholesterol contents The heptic contents of TAG nd totl cholesterol in vehicletreted d/d mice were significntly elevted compred Tle. Generl chrcteristics nd serum nlyses fter 8 weeks tretment with oligonol (Men vlues with their stndrd errors) d/d Veh Oligo- Oligo- Item Men SE Men SE Men SE Men SE Body-weight gin (g/8 weeks) Food intke (g/d) Wter intke (ml/d) Liver weight (g/ g ody weight) Glucose (mg/l) TAG (mg/l) Totl cholesterol (mg/l) NEFA (meq/l) ROS (fluorescence/min per ml) TBARS (nmol MDA/ml) 5 7 c ALT (IU/l) 66 6 c AST (IU/l) c d/d, Dietic;, Misty; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; ROS, rective oxygen species; TBARS, thiorituric cid-rective sustnces; MDA, mlondildehyde; ALT, lnine minotrnsferse; AST, sprtte minotrnsferse.,,c Men vlues within row with unlike superscript letters were significntly different (P, 5; Duncn s test). Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

5 Attenution y oligonol of heptic dmge 7 (A) ROS (fluorescence/min per mg protein) c (B) TBARS (nmol MDA/mg protein) c,c 5 Veh Oligo- Oligo- Veh Oligo- Oligo- d/d d/d British Journl of Nutrition (C) (D) (E) 5 c GSH (µmol/mg protein) Veh Oligo- Oligo- d/d with mice (Fig. ). In the oligonol-treted group, heptic TAG nd totl cholesterol contents were mrkedly decresed on oligonol dministrtion. Heptic lipogenic enzyme mrna expressions To exmine the effects of oligonol dministrtion on the heptic mrna levels of genes involved in ftty cid nd GSSG (µmol/mg protein) GSH:GSSG rtio Veh Oligo- Oligo- Veh Oligo- Oligo- d/d d/d Fig.. Biomrkers ssocited with oxidtive stress in the liver: (A) rective oxygen species (ROS); (B) thiorituric cid-rective sustnces (TBARS); (C) reduced glutthione (GSH); (D) oxidised glutthione (GSSG); (E) GSH:GSSG rtio., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; MDA, mlondildehyde. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs.,,c Men vlues with unlike letters were significntly different (P, 5; Duncn s test). c cholesterol synthesis, quntittive rel-time PCR ws performed (Fig. 5). mrna expressions of lipogenic enzymes for TAG synthesis (ACC nd FAS) nd cholesterol synthesis (HMGR) were over-expressed in the heptic tissue of vehicle d/d mice compred with the group. However, oligonol-treted d/d mice exhiited significntly lower expressions of ACC, FAS nd HMGR thn d/d vehicle mice. (A) (B) (C) NF-κBp65 (65 kd) COX- (7 kd) inos ( kd) NF-κB (fold of ) 5 COX- (fold of ) 5 inos (fold of ) Veh Oligo- Oligo- d/d Veh Oligo- Oligo- d/d Veh Oligo- Oligo- d/d Fig.. NF-kBp65 (A), cyclo-oxygense- (COX-) (B) nd inducile NO synthse (inos) (C) expressions in the liver., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

6 8 J. S. Noh et l. (A) (B) (C) RAGE (6 kd) 5 RAGE (fold of ) 5 CEL (65 kd) CEL (fold of ) 5 CML (5 kd) CML (fold of ), British Journl of Nutrition Heptic PPAR, sterol regultory element-inding protein- nd sterol regultory element-inding protein- expressions As shown in Fig. 6, heptic expressions of trnscriptionl fctors relted to lipid regultion, PPAR, SREBP- nd SREBP-, were exmined y Western lotting. There ws no ltertion in PPAR nd SREBP- expressions in the livers of ll experimentl groups of mice. SREBP- protein expression ws higher in vehicle d/d thn mice, ut, in the group treted with oligonol t mg/kg, heptic SREBP- expression ws significntly decresed (Fig. 6). Histologicl exmintions Veh Oligo- Oligo- d/d Fig. 7 shows the results of histologicl exmintions using oil red O stining, which detects ft deposits. The level of lipid deposition ws higher in the liver of d/d control mice compred with tht of mice. However, oligonol-treted d/d mice clerly showed decresed ft ccumultion. Veh Oligo- Oligo- d/d Discussion Veh Oligo- Oligo- d/d Fig.. Receptor for dvnced glyction endproduct (RAGE) (A), N -(croxyethyl)lysine (CEL) (B) nd N -(croxymethyl)lysine (CML) (C) expressions in the liver., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). Hyperglycemi nd elevted NEFA levels result in the genertion of ROS, nd, consequently increse oxidtive stress (). ROS re elieved to ply direct, key role in the pthogenesis of dietic complictions, ecuse of their ility to directly oxidise nd dmge DNA, protein nd lipids, consequently resulting in cell dysfunction nd poptosis (,). In the present results, the experimentl type dietes model mice exhiited higher oxidtive stress levels cused y incresed ROS nd lipid peroxidtion, long with lower heptic GSH:GSSG rtio, compred with norml mice. Conversely, oligonol tretment significntly reduced ROS nd TBARS levels in oth the serum nd liver of d/d mice. In ddition, the reduced GSH:GSSG rtio of vehicle d/d mice ws incresed y oligonol dministrtion due to reduction of the GSSG concentrtion in the liver. Actully, oligonol comprises ctechin-type monomers nd oligomers, which hve well-recognised ntioxidnt nd rdicl-scvenging effects (A) TAG (mg/g tissue) (B) Totl cholesterol (mg/g tissue) Veh Oligo- Oligo- d/d 8 6 Veh Oligo- Oligo- Fig.. Heptic TAG (A) nd totl cholesterol (B) contents., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6 or n ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). d/d Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

7 Attenution y oligonol of heptic dmge 9 (A) 6 (B) 6 (C) 5 5 5, 5 ACC (fold of ) FAS (fold of ) HMGR (fold of ) Veh Oligo- Oligo- d/d Veh Oligo- Oligo- d/d Veh Oligo- Oligo- Fig. 5. Heptic mrna expressions of cetyl-coa croxylse (ACC) (A), ftty cid synthse (FAS) (B) nd -hydroxy--methylglutryl-coa reductse (HMGR) (C)., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). d/d British Journl of Nutrition in vitro nd in vivo (,5). Consequently, these results demonstrte tht oligonol effectively ttenuted oxidtive stress, t lest in prt, through the direct inhiition of ROS nd lipid peroxidtion rther thn the improvement of hyperglycemi. In type dietes, the redox-sensitive intrcellulr signlling pthwy is ltered. In prticulr, one mjor intrcellulr trget of hyperglycemi nd oxidtive stress is the trnscription fctor NF-kB. NF-kB cn e ctivted y wide rry of exogenous nd endogenous stimuli including hyperglycemi, elevted NEFA, ROS, TNF-, IL-, other proinflmmtory cytokines, AGE-inding RAGE nd p8 mitogen-ctivted protein kinse. The ctivtion of NF-kB induces the inflmmtion-relted proteins COX- nd inos, nd susequent production of PG nd NO, respectively. NO rects very rpidly with superoxide to form peroxynitrite nd other NO-derived oxidnts cple of dmging DNA nd proteins (6). There is vicious cycle involving NF-kB, oxidtive stress nd inflmmtion under the dietic condition. Therefore, the inhiition of NF-kB trnscription plys centrl role in regulting the pthophysiology of dietic complictions. In the present study, elevted protein expressions of NF-kBp65 nd inos in the liver of d/d mice were mrkedly down-regulted y oligonol dministrtion. Oligonol dministrtion could djust inflmmtion through the inhiition of the NF-kB pthwy. Hyperglycemi in dietes ccelertes the synthesis nd tissue deposition of AGE, n normlity contriuting to the pthogenesis of morid complictions. The progression of AGE genertion ws lso stimulted y enhnced oxidtive stress ecuse ROS induce the uto-oxidtion of Amdori products, nd decrese in GSH levels impirs the ctivity of glyoxlse, the mjor AGE-detoxifying enzyme (7). Two distinctive AGE, CEL nd CML, re formed on proteins y glycoxidtion nd/or lipid peroxidtion pthwys. AGEmodified molecules interct with specific cell-surfce receptors (RAGE), ctivting severl intrcellulr signl trnsduction pthwys such s the induction of NF-kB trnscription nd mitogen-ctivted protein kinse followed y the further stimultion of oxidtive stress nd inflmmtory responses (8). (A) (B) (C) PPARα (55 kd) SREBP- (68 kd) SREBP- (7 kd) PPARα (fold of ) 5 Veh Oligo- Oligo- Veh Oligo- Oligo- d/d SREBP- (fold of ) 5 d/d SREBP- (fold of ) 5 5 Veh Oligo- Oligo- Fig. 6. PPAR (A), sterol regultory element-inding protein (SREBP)- (B) nd SREBP- (C) expressions in the liver., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). d/d Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

8 J. S. Noh et l. (A) (C) (E) (G) (B) (D) (F) (H) Fig. 7. Oil red O stining of the liver. Upper pnel (A, C, E, G), ; lower pnel (B, D, F, H),. (A nd B) Misty () mice; (C nd D) dietic (d/d) vehicle-treted mice; (E nd F) d/d mice treted with oligonol t mg/kg ody weight; (G nd H) d/d mice treted with oligonol t mg/kg ody weight. British Journl of Nutrition Moreover, up-regulted RAGE expression is relted to heptic firogenesis through prllel increse in trnsforming growth fctor- nd procollgen, which ply centrl roles in firosis progression (9). The present study showed tht oligonol ws effective t ttenuting oxidtive stress nd inhiiting NF-kB trnscription. Therefore, oligonol ws ssumed to down-regulte AGE-relted protein expression in the liver. In Western lot nlysis, heptic RAGE, CEL nd CML expressions in d/d mice were elevted, compred with those in mice. However, oligonol dministrtion significntly ttenuted RAGE nd CML expressions in the liver of d/d mice. Oligonol tretment more effectively ttenuted heptic CML compred with CEL, t lest in prt, ecuse CML formtion is linked with lipid peroxidtion nd peroxynitrite production induced y inos ctivity (). Dietes is chrcterised y hyperglycemi together with iochemicl ltertions of glucose nd lipid metolism, which is due to impired crohydrte utilistion resulting from deficient insulin secretion nd/or insulin resistnce. In prticulr, insulin resistnce elevtes the heptic output of TAG-rich prticles nd dipose relese of NEFA. When the NEFA supply exceeds utilistion, non-dipose tissues strt ccumulting TAG, which is ggrvted y the simultneous presence of hyperglycemi. In the present study, d/d mice represented oesity-induced dietes, long with hyperglycemi nd hyperlipidemi. The dministrtion of oligonol for 8 weeks to d/d mouse groups led to significnt decrese in the serum lipid profile, such s TAG, totl cholesterol nd NEFA levels, without chnges in serum glucose (Tle ). These results indicte tht oligonol cn meliorte dietic pthologicl conditions relted to norml lipid metolism in type dietes. Hyperglycemi nd normlities in serum lipids cn contriute to diverse lipid metolic chnges occurring in the liver, which re strongly ssocited with the progression of dietic liver disese. Oesity-induced insulin resistnce, which is typicl chrcteristic of type dietes, leds to reduced heptic ftty cid oxidtion nd incresed de novo lipogenesis, nd, consequently, excess ft ccumultion in the liver (). Consistent with the results for serum lipids, the oligonol-dministered group showed significnt reduction in heptic TAG nd totl cholesterol contents compred with the vehicle group (Fig. ). Next, we nlysed the effect of oligonol on heptic mrna levels of lipid-synthesising enzymes such s ACC, FAS nd HMGR. ACC is n importnt rte-controlling enzyme involved in the synthesis of mlonyl- CoA, which is oth criticl precursor for the iosynthesis of ftty cids nd potent inhiitor of mitochondril ftty cid oxidtion. The phosphoryltion nd inhiition of ACC y AMP-ctivted protein kinse led to fll in the mlonyl-coa content nd susequent decrese in TAG synthesis, concomitnt with n increse in -oxidtion (). In the present study, oligonol mrkedly lowered the mrna expression of heptic ACC nd FAS, key enzyme tht ctlyses the synthesis of sturted long-chin ftty cids, compred with control d/d mice. Also, mrna expression of HMGR, key enzyme in cholesterol synthesis, ws significntly down-regulted y oligonol tretment. It ws confirmed tht oligonol inhiited heptic lipid synthesis nd ccumultion vi the suppression of lipogenic enzyme ctivity. Lipid metolism is regulted y severl nucler trnscription fctors such s SREBP. In the present study, heptic SREBP- in d/d mice ws significntly down-regulted y the dministrtion of oligonol. However, oligonol dministrtion led to no significnt ltertion of PPAR nd SREBP-. These findings were relted to the inhiition of heptic TAG nd cholesterol ccumultion. HMGR is the min trget gene regulted y SREBP- nd lso y SREBP-, nd, therefore, up-regulted SREBP- is relted to cholesterol synthesis (,). This my explin why the reduced heptic cholesterol content cused y oligonol tretment ws medited y the down-regultion of SREBP- without ny chnge in SREBP- expression. In summry, the present results show tht oligonol meliorted oxidtive stress nd dyslipidemi in type dietic d/d mouse model. Oligonol dministrtion inhiited oxidtive stress nd inflmmtion through the reduction of ROS genertion, lipid peroxidtion, nd, in turn, the downregultion of NF-kB nd inos protein. Furthermore, the 8-week dministrtion of oligonol prevented dyslipidemi Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

9 Attenution y oligonol of heptic dmge British Journl of Nutrition compred with the vehicle group, which, in turn, reduced the expression of SREBP- protein nd its trget genes ACC, FAS nd HMGR, leding to the low-level heptic lipid deposition of TAG nd cholesterol. Consistent with nother report (5), the ody weight, food intke nd wter intke of d/d mice in our present study were mrkedly higher thn those of mice due to ugmented food consumption in the former. However, the dministrtion of oligonol for 8 weeks led to no difference in these items. There ws no hypoglycemic effect of oligonol dministrtion in d/d mice. Accordingly, the present study suggests tht the nti-dietic effects of oligonol re ssocited with meliortions of oxidtive stress nd norml lipid metolism in type dietes. Acknowledgements The present study ws supported in prt y grnt-in-id (C) from the Ministry of Eduction, Culture, Sports, Science, nd Technology, Jpn (no to T. Y.). T. Y. designed the experiment nd wrote the mnuscript. All the uthors red, commented on nd pproved the sumitted version. The uthors declre tht there re no conflicts of interest. References. Hotmisligil GS (6) Inflmmtion nd metolic disorders. Nture, Ahmed N (5) Advnced glyction endproducts role in pthology of dietic complictions. Dietes Res Clin Prctice 67,.. Goh SY & Cooper ME (8) The role of dvnced glyction end products in progression nd complictions of dietes. J Clin Endocrinol Met 9, 5.. Delrue J & Mgnn C (7) Free ftty cids nd insulin resistnce. Curr Opin Clin Nutr Met Cre, Browning JD & Horton JD () Moleculr meditors of heptic stetosis nd liver injury. J Clin Invest, Jones PJ & Vrdy KA (8) Are functionl foods redefining nutritionl requirements? Appl Physiol Nutr Met, Tnk T, Yoshitke N, Zho P, et l. (7) Production of oligomeric pronthocynidins y frgmenttion of polymers. Jpn J Food Chem, Fujii H, Nishiok H, Wkme K, et l. (8) Acute, suchronic nd genotoxicity studies conducted with oligonol, n oligomerized polyphenol formulted from lychee nd green te extrcts. Food Chem Toxicol 6, Jo EH, Lee SJ, Ahn NS, et l. (7) Induction of poptosis in MCF-7 nd MDA-MB- rest cncer cells y oligonol is medited y Bcl- fmily regultion nd MEK/ERK signling. Eur J Cncer Prev 6, 7.. Kundu JK, Chng EJ, Fujii H, et l. (8) Oligonol inhiits UVB-induced COX- expression in HR- hirless mouse skin AP- nd C/EBP s potentil upstrem trgets. Photochem Photoiol 8, Zhng XH, Yokoo H, Nishiok H, et l. () Beneficil effect of the oligomerized polyphenol oligonol on high glucose-induced chnges in enos phosphoryltion nd dephosphoryltion in endothelil cells. Br J Phrmcol 59, Skuri T, Nishiok H, Fujii H, et l. (8) Antioxidtive effects of new lychee fruit-derived polyphenol mixture, oligonol, converted into low-moleculr form in dipocytes. Biosci Biotechnol Biochem 7, Ogswr J, Kitdte K, Nishiok H, et l. (9) Oligonol, new lychee fruit-derived low-moleculr form of polyphenol, enhnces lipolysis in primry rt dipocytes through ctivtion of the ERK/ pthwy. Phytother Res, Mittl A, Elmets CA & Ktiyr SK () Dietry feeding of pronthocynidins from grpe seeds prevents photocrcinogenesis in SKH- hirless mice: reltionship to decresed ft nd lipid peroxidtion. Crcinogenesis, Ali SF, LeBel CP & Bondy SC (99) Rective oxygen species formtion s iomrker of methylmercury nd trimethyltin neurotoxicity. Neurotoxicology, Nito C & Ymnk T (978) Lipid peroxides in therosclerotic diseses. Nippon Ronen Igkki Zsshi 5, Folch J, Lees M & Slone Stnley GH (957) A simple method for the isoltion nd purifiction of totl lipides from niml tissues. J Biol Chem 6, Mihr M & Uchiym M (978) Determintion of mlonldehyde precursor in tissues y thiorituric cid test. Anl Biochem 86, Hissin PJ & Hilf R (976) A fluorometric method for determintion of oxidized nd reduced glutthione in tissues. Anl Biochem 7, 6.. Itzhki RF & Gill DM (96) A micro-iuret method for estimting proteins. Anl Biochem 9,.. Brownlee M () Biochemistry nd moleculr cell iology of dietic complictions. Nture, Rösen P, Nwroth PP, King G, et l. () The role of oxidtive stress in the onset nd progression of dietes nd its complictions: summry of Congress Series sponsored y UNESCO-MCBN, the Americn Dietes Assocition nd the Germn Dietes Society. Dietes Met Res Rev 7, 89.. Newsholme P, Her EP, Hirr SM, et l. (7) Dietes ssocited cell stress nd dysfunction: role of mitochondril nd non-mitochondril ROS production nd ctivity. J Physiol 58, 9.. Higdon JV & Frei B () Te ctechins nd polyphenols: helth effects, metolism, nd ntioxidnt functions. Crit Rev Food Sci Nutr, Perron NR & Brumghim JL (9) A review of the ntioxidnt mechnisms of polyphenol compounds relted to iron inding. Cell Biochem Biophys 5, Surh YJ, Chun KS, Ch HH, et l. () Moleculr mechnisms underlying chemopreventive ctivities of ntiinflmmtory phytochemicls: down-regultion of COX- nd inos through suppression of NF-kB ctivtion. Mutt Res 8 8, Vnder Jgt DL, Hsserook RK, Hunsker LA, et l. () Metolism of the -oxoldehyde methylglyoxl y ldose reductse nd y glyoxlse-i: roles for glutthione in oth enzymes nd implictions for dietic complictions. Chem Biol Interct, Yeh CH, Sturgis L, Hidcher J, et l. () Requirement for p8 nd p/p mitogen-ctivted protein kinses in RAGE-medited nucler fctor-kb trnscriptionl ctivtion nd cytokine secretion. Dietes 5, Lohwsser C, Neureiter D, Popov Y, et l. (9) Role of the receptor for dvnced glyction end products in heptic firosis. World J Gstroenterol 5, Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t

10 J. S. Noh et l.. Ngi R, Unno Y, Hyshi MC, et l. () Peroxynitrite induces formtion of N -(croxymethyl)lysine y the clevge of Amdori product nd genertion of glucosone nd glyoxl from glucose: novel pthwys for protein modifiction y peroxynitrite. Dietes 5, Khn SE, Hull RL & Utzschneider KM (6) Mechnisms linking oesity to insulin resistnce nd type dietes. Nture, Velsco G, Geelen MJ & Guzmán M (997) Control of heptic ftty cid oxidtion y 5 -AMP-ctivted protein kinse involves mlonyl-coa-dependent nd mlonyl-coaindependent mechnism. Arch Biochem Biophys 7, Bennett MK, Seo YK, Dtt S, et l. (8) Selective inding of sterol regultory element-inding protein isoforms nd co-regultory proteins to promoters for lipid metolic genes in liver. J Biol Chem 8, Kpln M, Kerry R, Avirm M, et l. (8) High glucose concentrtion increses mcrophge cholesterol iosynthesis in dietes through ctivtion of the sterol regultory element inding protein (SREBP): inhiitory effect of insulin. J Crdiovsc Phrmcol 5,. 5. Lee YA, Cho EJ & Yokozw T (8) Effects of pronthocynidin preprtions on hyperlipidemi nd other iomrkers in mouse model of type dietes. J Agric Food Chem 56, British Journl of Nutrition Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t