British Journal of Nutrition
|
|
- Merilyn Lawrence
- 5 years ago
- Views:
Transcription
1 British Journl of Nutrition (), 6, q The Authors doi:.7/s75 Tretment with oligonol, low-moleculr polyphenol derived from lychee fruit, ttenutes dietes-induced heptic dmge through regultion of oxidtive stress nd lipid metolism Jeong Sook Noh, Chn Hum Prk nd Tkko Yokozw* Institute of Nturl Medicine, University of Toym, 6 Sugitni, Toym 9-9, Jpn (Received July Revised Jnury Accepted 8 Jnury First pulished online April ) British Journl of Nutrition Astrct We hve identified the effects of oligonol, low-moleculr polyphenol derived from lychee fruit, on oxidtive stress nd lipid metolism in type dietic model. Oligonol ws orlly dministered t or mg per kg ody weight per d for 8 weeks to d/d mice, nd its effects were compred with those of the vehicle in d/d nd mice. Serum nd heptic iochemicl fctors, nd protein nd mrna expression relted to lipid metolism were mesured. In the oligonol-dministered group, there were significnt reductions of rective oxygen species (ROS), lipid peroxidtion, nd the TAG nd totl cholesterol concentrtions in oth the serum nd liver. Additionlly, oligonol ttenuted oxidtive stress through the inhiition of dvnced glyction endproduct formtion nd its receptor expression. Furthermore, ugmented expressions of NF-kBp65 nd inducile NO synthse were down-regulted to the levels of mice in the group treted with oligonol t mg/kg. Regrding lipid metolism, lower heptic lipid resulted from the down-regultion of sterol regultory element-inding protein- nd its trget gene of lipogenic enzymes in the liver of d/d mice. The present results suggest tht oligonol hs protective effects ginst ROS-relted inflmmtion nd excess lipid deposition in the type dietic liver. Key words: Oligonol: Type dietes: Oxidtive stress: Dyslipidemi: Stetosis Type dietes is ssocited with oxidtive stress nd norml lipid metolism due to hyperglycemi nd hyperlipidemi. Incresed rective oxygen species (ROS) genertion nd lipid peroxidtion ctivte stress-sensitive intrcellulr signlling pthwys such s the trnscription of NF-kB, which plys centrl role in inflmmtion-relted disese (). In ddition, hyperglycemi ccelertes the formtion of dvnced glyction endproducts (AGE), which re proteins produced from non-enzymic glyction rections (). AGE nd their inding with receptors, such s the receptor for AGE (RAGE), glectin- nd CD6, induce free rdicl formtion. They ccumulte during the norml geing process nd t ccelerted rtes during the course of dietes, nd re ssocited with the pthogenesis of chronic diseses such s rthritis, therosclerosis, liver cirrhosis nd dietic nephropthy (). Therefore, the ttenution of oxidtive stress during the initition nd propgtion of type dietes is importnt to prevent vicious cycle of inflmmtory responses nd tissue dmge. Moreover, insulin resistnce in type dietes leds to mrked disruption of lipid dynmics, often reflected y elevted levels of circulting NEFA nd TAG, together with excess ft deposition in vrious tissues (). Lipid homeostsis is regulted y trnscription fctor, sterol regultory elementinding protein (SREBP), which is highly expressed in the presence of metolic disorders such s oesity nd dietes. In prticulr, up-regulted SREBP- hs een suggested to ply centrl role in the development of heptic stetosis in n insulin-resistnt niml model (5). Accordingly, to prevent dietic heptic dmge induced y inflmmtion nd/or excess lipid ccumultion, it is importnt to reduce oxidtive stress nd inhiit lipid synthesis in the liver. Currently, functionl food nd/or dietry ingredients with helth enefits re eing given much ttention due to the sence of dverse effects, undnt production nd ppliction to vrious commercil goods (6). Oligonol is phenolic product derived from lychee fruit extrct contining ctechin-type monomers nd oligomers of pronthocynidins, produced y mnufcturing process which converts Arevitions: ACC, cetyl-coa croxylse; AGE, dvnced glyction endproduct; CEL, N -(croxyethyl)lysine; CML, N -(croxymethyl)lysine; COX-, cyclo-oxygense-; FAS, ftty cid synthse; GSH, reduced glutthione; GSSG, oxidised glutthione; HMGR, -hydroxy--methylglutryl-coa reductse; inos, inducile NO synthse; RAGE, receptor for dvnced glyction endproduct; ROS, rective oxygen species; SREBP, sterol regultory elementinding protein; TBARS, thiorituric cid-rective sustnce. * Corresponding uthor: Dr Tkko Yokozw, fx þ , emil yokozw@inm.u-toym.c.jp Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
2 J. S. Noh et l. British Journl of Nutrition polyphenol polymers into oligomers (7,8). Oligonol is produced y the oligomeristion of polyphenol polymers, typiclly pronthocynidins; thus, oligonol delivers higher levels of oligomeric pronthocynidins compred with fruit nd plnt sources tht generlly contin high-moleculr-weight pronthocynidins. There is ccumulting evidence tht oligonol cn exert some iologicl effects in vitro nd in vivo: nticncer (9), s well s ntioxidnt nd nti-inflmmtory effects (), eneficil ctivity for NO iovilility () nd regultory effect on lipid metolism (,). Indeed, dietry feeding with pronthocynidins, which comprise oligonol, hs een reported to induce significnt ttenution of tissue ft levels, without chnging the totl ody mss of the nimls compred with non-pronthocynidin-fed nimls (). However, there is no evidence to support whether or not oligonol hs ny effect on oxidtive stress-induced inflmmtion nd norml lipid ccumultion in the liver of oesity-induced type dietes. Therefore, we investigted the effects of oligonol on heptic dmge induced y hyperglycemi, norml lipid synthesis nd NF-kB-relted inflmmtion, using typicl type dietic niml, the C57BLKS/J d/d mouse. Mterils nd methods Oligonol Oligonol ws generted y oligomerising polyphenol polymers derived from lychee fruit. The sfety of oligonol s food or dietry supplement nd s phrmceuticl dditive hs lredy een confirmed, s descried previously (8). Oligonol comprises polyphenol mixture of 6 % monomers (ctechin, epictechin, epictechin gllte nd epiglloctechin gllte) nd 9 % dimers (procynidin A, A, B nd B), while lychee fruit polyphenols comprise mixture of 6 % monomers nd 9 8 % dimers. Oligonol is commercilly ville (Amino Up Chemicl Co., Ltd, Spporo, Jpn). Mterils Protese inhiitor mixture solution,,6-dihydroxy-- mercptopyrimidine (-thiorituric cid), EDTA, reduced glutthione (GSH) nd oxidised glutthione (GSSG) were purchsed from Wko Pure Chemicl Industries, Ltd (Osk, Jpn).,7 -Dichlorofluorescein dicette ws purchsed from Moleculr Proes (Eugene, OR, USA). The Bio-Rd protein ssy kit nd pure nitrocellulose memrne were purchsed from Bio-Rd Lortories (Tokyo, Jpn). -Actin, o-phthlldehyde, phenylmethylsulfonyl fluoride nd N-ethylmleimide were purchsed from Sigm Chemicl Co. (St Louis, MO, USA). Rit polyclonl ntiodies ginst PPAR, SREBP-, SREBP-, NF-kBp65 nd RAGE, nd mouse monoclonl ntiody ginst cyclo-oxygense- (COX-) nd inducile NO synthse (inos) were purchsed from Snt Cruz Biotechnology, Inc. (Snt Cruz, CA, USA). Monoclonl nti-n -(croxyethyl)lysine (CEL) ntiody nd polyclonl nti-n -(croxymethyl)lysine (CML) ntiody were kindly provided y Dr R. Ngi (Kummoto University, Kummoto, Jpn). Got nti-rit nd got nti-mouse IgG horserdish peroxidse-conjugted secondry ntiodies were purchsed from Snt Cruz Biotechnology, Inc. ECL TM Western Blotting Detection Regents were purchsed from Amershm Bioscience (Pisctwy, NJ, USA). Experimentl protocol The Guidelines for Animl Experimenttion pproved y the University of Toym were followed in the present study (registrtion no. S-6 INM-). Mle C57BLKS/J d/d nd ge-mtched mice, ged 5 weeks, were purchsed from Jpn SLC Inc. (Hmmtsu, Jpn). C57BLKS/J mice were used s norml control in the experiment. Mice were mintined under h light drk cycle, fed stndrd lortory pellet chow (comprising % protein, 5 % lipids nd 6 5 % crohydrte; CLEA Jpn Inc., Tokyo, Jpn) nd wter d liitum, nd housed in room with controlled temperture ( ^ 8C) nd humidity (out 6 %). Oligonol ( or mg/kg ody weight per d) ws orlly dministered to d/d mice (Oligo- or Oligo-, n, respectively), while vehicle-treted d/d (n ) nd non-dietic control (n 6) mice received wter every dy for 8 weeks. The ody weight, food intke nd wter intke were mesured every dy during the tretment period. After 8 weeks of oligonol tretment, lood smples were collected from nesthetised mice y crdic puncture. The serum ws immeditely seprted from lood smples y centrifugtion. Susequently, to remove the remining lood in the liver, ech mouse ws perfused with ice-cold physiologicl sline y syringe fter crdic puncture, nd the liver ws hrvested, plunged into liquid N nd stored t 88C until nlysis. Mesurement of serum prmeters Serum glucose, TAG, totl cholesterol nd NEFA levels were mesured using commercil kit (Glucose CII-Test, Triglyceride E-Test, Cholesterol E-Test nd NEFA C-Test from Wko Pure Chemicl Industries, Ltd, Osk, Jpn). The serum ROS level ws determined using the method of Ali et l. (5) nd the thiorituric cid-rective sustnce (TBARS) concentrtion ws exmined employing the method of Nito & Ymnk (6). Heptic functionl prmeters (lnine minotrnsferse nd sprtte minotrnsferse) were mesured using Wko kit (Trnsminse CII-Test). Mesurement of heptic TAG nd totl cholesterol contents Heptic tissues were homogenised in ice-cold 9 % NCl uffer. Then the homogente ws extrcted with mixture of chloroform nd methnol (:, v/v) ccording to the method of Folch et l. (7), nd the mixture ws centrifuged t 67 g for 5 min. The orgnic lyer ws collected nd dried, nd the residue ws dissolved in isopropnol. Determintions for TAG nd totl cholesterol contents were performed using the Wko kit. Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
3 Attenution y oligonol of heptic dmge 5 British Journl of Nutrition Assessment of heptic rective oxygen species genertion nd thiorituric cid-rective sustnce levels ROS genertion ws mesured using the method of Ali et l. (5). Heptic tissues were homogenised on ice with mm-edta 5 mm-sodium phosphte uffer (ph 7 ), nd then 5 mm-,7 -dichlorofluorescein dicette ws dded to homogentes. After incution for min, the chnges in fluorescence vlues were determined t n excittion wvelength of 86 nm nd emission wvelength of 5 nm. The heptic TBARS content, n oxidtive stress iomrker, ws determined employing the method of Mihr & Uchiym (8). Determintion of heptic reduced glutthione nd oxidised glutthione levels GSH nd GSSG ssys were crried out pplying the method of Hissin & Hilf (9). Heptic tissues were homogenised on ice with mm-edta 5 mm-sodium phosphte uffer (ph 7 ). Then, 5 % metphosphoric cid ws dded for protein precipittion. The homogente ws centrifuged t 8C t g for min to otin the superntnt frction for the ssys of GSH nd GSSG. To ssy GSH, mm-edta 5 mm-sodium phosphte uffer (ph 7 ) ws dded to the superntnt frction, followed y the ddition of o-phthlldehyde. After min t room temperture, fluorescence ws estimted t n excittion wvelength of 6 nm nd emission wvelength of 6 nm. GSSG ws ssyed fter pre-incution with N-ethylmleimide for min, nd M-NOH ws sustituted for the phosphte uffer. After incution for min t room temperture, the fluorescence vlue ws estimted t n excittion wvelength of 6 nm nd emission wvelength of 6 nm. Protein ssys were crried out ccording to the method of Itzhki & Gill () using ovine serum lumin s stndrd. Preprtion of nucler nd post-nucler frctions To prepre nucler frctions, heptic tissues were homogenised with ice-cold lysis uffer contining 5 mm--mino- -hydroxymethyl-propne-,-diol (Tris)-HCl (ph 7 5), mm-mgcl,5mm-ccl nd M-sucrose, nd then M- dithiothreitol (DTT) nd protese inhiitor cocktil were dded. After centrifugtion ( 5 g for min t 8C), the pellet ws suspended with extrction uffer contining mm--[-(-hydroxyethyl)--piperzyl] ethnesulfonic cid (ph 7 9), mm-mgcl, M-NCl, mm-edta nd 5 % (v/v) glycerol, nd then M-DTT nd protese inhiitor cocktil were dded. The mixture ws plced on ice for min. The nucler frction ws prepred y centrifugtion t 5 g for 5 min t 8C. The post-nucler frction ws extrcted from the liver of ech mouse, s descried elow. In rief, heptic tissue ws homogenised with ice-cold lysis uffer (ph 7 ) contining 7 mm-ncl, mm-tris-hcl, % Tween, % glycerol, mm-phenylmethylsulfonyl fluoride nd protese inhiitor mixture solution. The homogente ws then centrifuged t g for min t 8C. The protein concentrtion of ech frction ws determined using commercil kit (Bio-Rd Lortories, Hercules, CA, USA). Western lot nlyses For the determintion of NF-kB, PPAR, SREBP- nd SREBP-, mg protein of ech nucler frction ws electrophoresed through 8 % SDS-PAGE. Seprted proteins were trnsferred to nitrocellulose memrne, locked with 5 % (w/v) skimmed milk solution for h, nd then incuted with primry ntiodies to NF-kBp65, PPAR, SREBP-, SREBP- nd -ctin, respectively, overnight t 8C. After the lots were wshed, they were incuted with nti-rit or ntimouse IgG horserdish peroxidse-conjugted secondry ntiody for h t room temperture. Also, mg of protein of ech post-nucler frction for COX-, inos, RAGE, CEL nd CML were electrophoresed through 8 % SDS-PAGE. Ech ntigen ntiody complex ws visulised using ECL Western Blotting Detection Regents nd detected y chemiluminescence with LAS- (Fujifilm, Tokyo, Jpn). Bnd densities were determined using ATTO Densitogrph Softwre (ATTO Corportion, Tokyo, Jpn) nd quntified s the rtio to -ctin. These protein levels of groups re expressed reltive to those of mice (represented s ). Quntittive rel-time PCR Totl RNA ws isolted from heptic tissue using Trizol regent (Invitrogen Life Technologies, Crlsd, CA, USA) nd quntified with NnoDrop (Thermo Scientific, Wilmington, DE, USA). The cdna were synthesised from 5 mg of RNA using RT (QIAGEN, Tokyo, Jpn). For the rel-time PCR, triplicte smples of serilly diluted cdna smples were used in rection mixture tht contined mm of ech primer in rection volume of 5 ml using the SYBR Green Rel-time PCR kit (QIAGEN, Tokyo, Jpn) nd fluorometric therml cycler (MxP TM ; Strtgene, L Joll, CA, USA). Rection mixtures were incuted for n initil denturtion t 958C for 5 min, followed y forty-five cycles t 98C for 5 s, 68C for s nd 78C for s. Primers used were s follows: cetyl- CoA croxylse (ACC; sense: CCCAGCAGAATAAAGCTACT- TTGG, ntisense: TCCTTTTGTGCAACTAGGAACGT), ftty cid synthse (FAS; sense: CCTGGATAGCATTCCGAACCT, ntisense: AGCACATCTCGAAGGCTACACA) nd -hydroxy-- methylglutryl-coa reductse (HMGR; sense: AGCCGAAGCA- GCACATGAT, ntisense: CTTGTGGAATGCCTTGTGATTG). Glycerldehyde -phosphte dehydrogense (GAPDH) ws employed s n endogenous control. The DC T method ws used for reltive quntifiction. The DC T vlue for ech smple ws determined y clculting the difference etween the C T vlue of the trget gene nd tht of the GAPDH reference gene. The normlised trget gene expression level in the smple ws clculted using the formul DDCT s the fold chnge over the control. Histology The excised prts of livers were immeditely fixed with % neutrl-uffered formlin nd, fter emedding in prffin, they were cut into 5 mm-thick sections. After oil red O stining, these sections were exmined with light microscope. Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
4 6 J. S. Noh et l. Sttisticl nlysis Dt re expressed s men vlues with their stndrd errors. Sttisticl comprisons were performed y one-wy ANOVA followed y Duncn s multiple-rnge test. Sttisticl nlysis ws conducted using SAS (relese 9.; SAS Institute, Inc., Cry, NC, USA) nd P, 5 ws considered significnt. those of mice, wheres these enhnced levels were significntly reduced y oligonol tretment in dosedependent mnner. Concerning the heptic GSH, GSSG nd GSH:GSSG rtio, there were significnt ltertions etween vehicle d/d nd groups. Oligonol dministrtion significntly ugmented the GSH:GSSG rtio due to mrked decrese in the GSSG level in the liver of d/d mice. British Journl of Nutrition Results Generl chrcteristics Type dietic chrcteristics such s excessive ody-weight gin, food intke nd wter intke were exhiited in d/d mice t ge 7 weeks compred with norml mice (Tle ). The liver weight ws higher in d/d thn mice; however, oligonol dministrtions led to no significnt differences in d/d groups. In serum nlyses, glucose nd lipid concentrtions were incresed in d/d compred with mice; however, except for serum glucose, oligonol dministrtion significntly reduced serum concentrtions of TAG, totl cholesterol nd NEFA t mg/kg doses (Tle ). In ddition, oxidtive stress-relted prmeters, ROS nd TBARS, were enhnced in vehicle d/d compred with mice. However, oligonol tretment t mg/kg significntly reduced the ROS level nd inhiited lipid peroxidtion in the serum of d/d mice (Tle ). Regrding heptic functionl prmeters, serum lnine minotrnsferse nd sprtte minotrnsferse levels in vehicle d/d mice were elevted compred with mice, while, in oligonoldministered d/d mice, only the lnine minotrnsferse level ws significntly decresed (Tle ). Heptic iomrkers ssocited with oxidtive stress As shown in Fig., the heptic levels of ROS nd TBARS in vehicle-treted d/d mice were pprently higher thn Heptic NF-kBp65, cyclo-oxygense- nd inducile NO synthse expressions At the end of the experiment, heptic NF-kBp65- nd NF-kBmedited trget protein expression levels in the vehicletreted d/d group were significntly up-regulted compred with those in the group (Fig. ). The dministrtion of oligonol suppressed the trnscription of NF-kB in the liver. Also, up-regulted heptic inos expression levels were reduced on oligonol tretment t mg/kg. Concerning heptic COX- protein expression, oligonol tretment showed reducing tendency, ut this ws not significnt. Heptic receptor for dvnced glyction endproducts, N -(croxyethyl)lysine nd N -(croxymethyl)lysine expressions In Fig., protein expressions of AGE-relted proteins were enhnced in the d/d mouse liver t 7 weeks. The d/d mice showed up-regulted protein expressions of RAGE nd CML, ut the orl dministrtion of oligonol ttenuted these protein levels. Heptic CEL protein expression remined unchnged in ll experimentl groups. Heptic TAG nd totl cholesterol contents The heptic contents of TAG nd totl cholesterol in vehicletreted d/d mice were significntly elevted compred Tle. Generl chrcteristics nd serum nlyses fter 8 weeks tretment with oligonol (Men vlues with their stndrd errors) d/d Veh Oligo- Oligo- Item Men SE Men SE Men SE Men SE Body-weight gin (g/8 weeks) Food intke (g/d) Wter intke (ml/d) Liver weight (g/ g ody weight) Glucose (mg/l) TAG (mg/l) Totl cholesterol (mg/l) NEFA (meq/l) ROS (fluorescence/min per ml) TBARS (nmol MDA/ml) 5 7 c ALT (IU/l) 66 6 c AST (IU/l) c d/d, Dietic;, Misty; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; ROS, rective oxygen species; TBARS, thiorituric cid-rective sustnces; MDA, mlondildehyde; ALT, lnine minotrnsferse; AST, sprtte minotrnsferse.,,c Men vlues within row with unlike superscript letters were significntly different (P, 5; Duncn s test). Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
5 Attenution y oligonol of heptic dmge 7 (A) ROS (fluorescence/min per mg protein) c (B) TBARS (nmol MDA/mg protein) c,c 5 Veh Oligo- Oligo- Veh Oligo- Oligo- d/d d/d British Journl of Nutrition (C) (D) (E) 5 c GSH (µmol/mg protein) Veh Oligo- Oligo- d/d with mice (Fig. ). In the oligonol-treted group, heptic TAG nd totl cholesterol contents were mrkedly decresed on oligonol dministrtion. Heptic lipogenic enzyme mrna expressions To exmine the effects of oligonol dministrtion on the heptic mrna levels of genes involved in ftty cid nd GSSG (µmol/mg protein) GSH:GSSG rtio Veh Oligo- Oligo- Veh Oligo- Oligo- d/d d/d Fig.. Biomrkers ssocited with oxidtive stress in the liver: (A) rective oxygen species (ROS); (B) thiorituric cid-rective sustnces (TBARS); (C) reduced glutthione (GSH); (D) oxidised glutthione (GSSG); (E) GSH:GSSG rtio., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; MDA, mlondildehyde. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs.,,c Men vlues with unlike letters were significntly different (P, 5; Duncn s test). c cholesterol synthesis, quntittive rel-time PCR ws performed (Fig. 5). mrna expressions of lipogenic enzymes for TAG synthesis (ACC nd FAS) nd cholesterol synthesis (HMGR) were over-expressed in the heptic tissue of vehicle d/d mice compred with the group. However, oligonol-treted d/d mice exhiited significntly lower expressions of ACC, FAS nd HMGR thn d/d vehicle mice. (A) (B) (C) NF-κBp65 (65 kd) COX- (7 kd) inos ( kd) NF-κB (fold of ) 5 COX- (fold of ) 5 inos (fold of ) Veh Oligo- Oligo- d/d Veh Oligo- Oligo- d/d Veh Oligo- Oligo- d/d Fig.. NF-kBp65 (A), cyclo-oxygense- (COX-) (B) nd inducile NO synthse (inos) (C) expressions in the liver., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
6 8 J. S. Noh et l. (A) (B) (C) RAGE (6 kd) 5 RAGE (fold of ) 5 CEL (65 kd) CEL (fold of ) 5 CML (5 kd) CML (fold of ), British Journl of Nutrition Heptic PPAR, sterol regultory element-inding protein- nd sterol regultory element-inding protein- expressions As shown in Fig. 6, heptic expressions of trnscriptionl fctors relted to lipid regultion, PPAR, SREBP- nd SREBP-, were exmined y Western lotting. There ws no ltertion in PPAR nd SREBP- expressions in the livers of ll experimentl groups of mice. SREBP- protein expression ws higher in vehicle d/d thn mice, ut, in the group treted with oligonol t mg/kg, heptic SREBP- expression ws significntly decresed (Fig. 6). Histologicl exmintions Veh Oligo- Oligo- d/d Fig. 7 shows the results of histologicl exmintions using oil red O stining, which detects ft deposits. The level of lipid deposition ws higher in the liver of d/d control mice compred with tht of mice. However, oligonol-treted d/d mice clerly showed decresed ft ccumultion. Veh Oligo- Oligo- d/d Discussion Veh Oligo- Oligo- d/d Fig.. Receptor for dvnced glyction endproduct (RAGE) (A), N -(croxyethyl)lysine (CEL) (B) nd N -(croxymethyl)lysine (CML) (C) expressions in the liver., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). Hyperglycemi nd elevted NEFA levels result in the genertion of ROS, nd, consequently increse oxidtive stress (). ROS re elieved to ply direct, key role in the pthogenesis of dietic complictions, ecuse of their ility to directly oxidise nd dmge DNA, protein nd lipids, consequently resulting in cell dysfunction nd poptosis (,). In the present results, the experimentl type dietes model mice exhiited higher oxidtive stress levels cused y incresed ROS nd lipid peroxidtion, long with lower heptic GSH:GSSG rtio, compred with norml mice. Conversely, oligonol tretment significntly reduced ROS nd TBARS levels in oth the serum nd liver of d/d mice. In ddition, the reduced GSH:GSSG rtio of vehicle d/d mice ws incresed y oligonol dministrtion due to reduction of the GSSG concentrtion in the liver. Actully, oligonol comprises ctechin-type monomers nd oligomers, which hve well-recognised ntioxidnt nd rdicl-scvenging effects (A) TAG (mg/g tissue) (B) Totl cholesterol (mg/g tissue) Veh Oligo- Oligo- d/d 8 6 Veh Oligo- Oligo- Fig.. Heptic TAG (A) nd totl cholesterol (B) contents., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6 or n ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). d/d Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
7 Attenution y oligonol of heptic dmge 9 (A) 6 (B) 6 (C) 5 5 5, 5 ACC (fold of ) FAS (fold of ) HMGR (fold of ) Veh Oligo- Oligo- d/d Veh Oligo- Oligo- d/d Veh Oligo- Oligo- Fig. 5. Heptic mrna expressions of cetyl-coa croxylse (ACC) (A), ftty cid synthse (FAS) (B) nd -hydroxy--methylglutryl-coa reductse (HMGR) (C)., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). d/d British Journl of Nutrition in vitro nd in vivo (,5). Consequently, these results demonstrte tht oligonol effectively ttenuted oxidtive stress, t lest in prt, through the direct inhiition of ROS nd lipid peroxidtion rther thn the improvement of hyperglycemi. In type dietes, the redox-sensitive intrcellulr signlling pthwy is ltered. In prticulr, one mjor intrcellulr trget of hyperglycemi nd oxidtive stress is the trnscription fctor NF-kB. NF-kB cn e ctivted y wide rry of exogenous nd endogenous stimuli including hyperglycemi, elevted NEFA, ROS, TNF-, IL-, other proinflmmtory cytokines, AGE-inding RAGE nd p8 mitogen-ctivted protein kinse. The ctivtion of NF-kB induces the inflmmtion-relted proteins COX- nd inos, nd susequent production of PG nd NO, respectively. NO rects very rpidly with superoxide to form peroxynitrite nd other NO-derived oxidnts cple of dmging DNA nd proteins (6). There is vicious cycle involving NF-kB, oxidtive stress nd inflmmtion under the dietic condition. Therefore, the inhiition of NF-kB trnscription plys centrl role in regulting the pthophysiology of dietic complictions. In the present study, elevted protein expressions of NF-kBp65 nd inos in the liver of d/d mice were mrkedly down-regulted y oligonol dministrtion. Oligonol dministrtion could djust inflmmtion through the inhiition of the NF-kB pthwy. Hyperglycemi in dietes ccelertes the synthesis nd tissue deposition of AGE, n normlity contriuting to the pthogenesis of morid complictions. The progression of AGE genertion ws lso stimulted y enhnced oxidtive stress ecuse ROS induce the uto-oxidtion of Amdori products, nd decrese in GSH levels impirs the ctivity of glyoxlse, the mjor AGE-detoxifying enzyme (7). Two distinctive AGE, CEL nd CML, re formed on proteins y glycoxidtion nd/or lipid peroxidtion pthwys. AGEmodified molecules interct with specific cell-surfce receptors (RAGE), ctivting severl intrcellulr signl trnsduction pthwys such s the induction of NF-kB trnscription nd mitogen-ctivted protein kinse followed y the further stimultion of oxidtive stress nd inflmmtory responses (8). (A) (B) (C) PPARα (55 kd) SREBP- (68 kd) SREBP- (7 kd) PPARα (fold of ) 5 Veh Oligo- Oligo- Veh Oligo- Oligo- d/d SREBP- (fold of ) 5 d/d SREBP- (fold of ) 5 5 Veh Oligo- Oligo- Fig. 6. PPAR (A), sterol regultory element-inding protein (SREBP)- (B) nd SREBP- (C) expressions in the liver., Misty; d/d, dietic; Veh, d/d vehicle-treted mice; Oligo-, d/d mice treted with oligonol t mg/kg ody weight; Oligo-, d/d mice treted with oligonol t mg/kg ody weight. Vlues re mens (n 6orn ), with stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P, 5; Duncn s test). d/d Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
8 J. S. Noh et l. (A) (C) (E) (G) (B) (D) (F) (H) Fig. 7. Oil red O stining of the liver. Upper pnel (A, C, E, G), ; lower pnel (B, D, F, H),. (A nd B) Misty () mice; (C nd D) dietic (d/d) vehicle-treted mice; (E nd F) d/d mice treted with oligonol t mg/kg ody weight; (G nd H) d/d mice treted with oligonol t mg/kg ody weight. British Journl of Nutrition Moreover, up-regulted RAGE expression is relted to heptic firogenesis through prllel increse in trnsforming growth fctor- nd procollgen, which ply centrl roles in firosis progression (9). The present study showed tht oligonol ws effective t ttenuting oxidtive stress nd inhiiting NF-kB trnscription. Therefore, oligonol ws ssumed to down-regulte AGE-relted protein expression in the liver. In Western lot nlysis, heptic RAGE, CEL nd CML expressions in d/d mice were elevted, compred with those in mice. However, oligonol dministrtion significntly ttenuted RAGE nd CML expressions in the liver of d/d mice. Oligonol tretment more effectively ttenuted heptic CML compred with CEL, t lest in prt, ecuse CML formtion is linked with lipid peroxidtion nd peroxynitrite production induced y inos ctivity (). Dietes is chrcterised y hyperglycemi together with iochemicl ltertions of glucose nd lipid metolism, which is due to impired crohydrte utilistion resulting from deficient insulin secretion nd/or insulin resistnce. In prticulr, insulin resistnce elevtes the heptic output of TAG-rich prticles nd dipose relese of NEFA. When the NEFA supply exceeds utilistion, non-dipose tissues strt ccumulting TAG, which is ggrvted y the simultneous presence of hyperglycemi. In the present study, d/d mice represented oesity-induced dietes, long with hyperglycemi nd hyperlipidemi. The dministrtion of oligonol for 8 weeks to d/d mouse groups led to significnt decrese in the serum lipid profile, such s TAG, totl cholesterol nd NEFA levels, without chnges in serum glucose (Tle ). These results indicte tht oligonol cn meliorte dietic pthologicl conditions relted to norml lipid metolism in type dietes. Hyperglycemi nd normlities in serum lipids cn contriute to diverse lipid metolic chnges occurring in the liver, which re strongly ssocited with the progression of dietic liver disese. Oesity-induced insulin resistnce, which is typicl chrcteristic of type dietes, leds to reduced heptic ftty cid oxidtion nd incresed de novo lipogenesis, nd, consequently, excess ft ccumultion in the liver (). Consistent with the results for serum lipids, the oligonol-dministered group showed significnt reduction in heptic TAG nd totl cholesterol contents compred with the vehicle group (Fig. ). Next, we nlysed the effect of oligonol on heptic mrna levels of lipid-synthesising enzymes such s ACC, FAS nd HMGR. ACC is n importnt rte-controlling enzyme involved in the synthesis of mlonyl- CoA, which is oth criticl precursor for the iosynthesis of ftty cids nd potent inhiitor of mitochondril ftty cid oxidtion. The phosphoryltion nd inhiition of ACC y AMP-ctivted protein kinse led to fll in the mlonyl-coa content nd susequent decrese in TAG synthesis, concomitnt with n increse in -oxidtion (). In the present study, oligonol mrkedly lowered the mrna expression of heptic ACC nd FAS, key enzyme tht ctlyses the synthesis of sturted long-chin ftty cids, compred with control d/d mice. Also, mrna expression of HMGR, key enzyme in cholesterol synthesis, ws significntly down-regulted y oligonol tretment. It ws confirmed tht oligonol inhiited heptic lipid synthesis nd ccumultion vi the suppression of lipogenic enzyme ctivity. Lipid metolism is regulted y severl nucler trnscription fctors such s SREBP. In the present study, heptic SREBP- in d/d mice ws significntly down-regulted y the dministrtion of oligonol. However, oligonol dministrtion led to no significnt ltertion of PPAR nd SREBP-. These findings were relted to the inhiition of heptic TAG nd cholesterol ccumultion. HMGR is the min trget gene regulted y SREBP- nd lso y SREBP-, nd, therefore, up-regulted SREBP- is relted to cholesterol synthesis (,). This my explin why the reduced heptic cholesterol content cused y oligonol tretment ws medited y the down-regultion of SREBP- without ny chnge in SREBP- expression. In summry, the present results show tht oligonol meliorted oxidtive stress nd dyslipidemi in type dietic d/d mouse model. Oligonol dministrtion inhiited oxidtive stress nd inflmmtion through the reduction of ROS genertion, lipid peroxidtion, nd, in turn, the downregultion of NF-kB nd inos protein. Furthermore, the 8-week dministrtion of oligonol prevented dyslipidemi Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
9 Attenution y oligonol of heptic dmge British Journl of Nutrition compred with the vehicle group, which, in turn, reduced the expression of SREBP- protein nd its trget genes ACC, FAS nd HMGR, leding to the low-level heptic lipid deposition of TAG nd cholesterol. Consistent with nother report (5), the ody weight, food intke nd wter intke of d/d mice in our present study were mrkedly higher thn those of mice due to ugmented food consumption in the former. However, the dministrtion of oligonol for 8 weeks led to no difference in these items. There ws no hypoglycemic effect of oligonol dministrtion in d/d mice. Accordingly, the present study suggests tht the nti-dietic effects of oligonol re ssocited with meliortions of oxidtive stress nd norml lipid metolism in type dietes. Acknowledgements The present study ws supported in prt y grnt-in-id (C) from the Ministry of Eduction, Culture, Sports, Science, nd Technology, Jpn (no to T. Y.). T. Y. designed the experiment nd wrote the mnuscript. All the uthors red, commented on nd pproved the sumitted version. The uthors declre tht there re no conflicts of interest. References. Hotmisligil GS (6) Inflmmtion nd metolic disorders. Nture, Ahmed N (5) Advnced glyction endproducts role in pthology of dietic complictions. Dietes Res Clin Prctice 67,.. Goh SY & Cooper ME (8) The role of dvnced glyction end products in progression nd complictions of dietes. J Clin Endocrinol Met 9, 5.. Delrue J & Mgnn C (7) Free ftty cids nd insulin resistnce. Curr Opin Clin Nutr Met Cre, Browning JD & Horton JD () Moleculr meditors of heptic stetosis nd liver injury. J Clin Invest, Jones PJ & Vrdy KA (8) Are functionl foods redefining nutritionl requirements? Appl Physiol Nutr Met, Tnk T, Yoshitke N, Zho P, et l. (7) Production of oligomeric pronthocynidins y frgmenttion of polymers. Jpn J Food Chem, Fujii H, Nishiok H, Wkme K, et l. (8) Acute, suchronic nd genotoxicity studies conducted with oligonol, n oligomerized polyphenol formulted from lychee nd green te extrcts. Food Chem Toxicol 6, Jo EH, Lee SJ, Ahn NS, et l. (7) Induction of poptosis in MCF-7 nd MDA-MB- rest cncer cells y oligonol is medited y Bcl- fmily regultion nd MEK/ERK signling. Eur J Cncer Prev 6, 7.. Kundu JK, Chng EJ, Fujii H, et l. (8) Oligonol inhiits UVB-induced COX- expression in HR- hirless mouse skin AP- nd C/EBP s potentil upstrem trgets. Photochem Photoiol 8, Zhng XH, Yokoo H, Nishiok H, et l. () Beneficil effect of the oligomerized polyphenol oligonol on high glucose-induced chnges in enos phosphoryltion nd dephosphoryltion in endothelil cells. Br J Phrmcol 59, Skuri T, Nishiok H, Fujii H, et l. (8) Antioxidtive effects of new lychee fruit-derived polyphenol mixture, oligonol, converted into low-moleculr form in dipocytes. Biosci Biotechnol Biochem 7, Ogswr J, Kitdte K, Nishiok H, et l. (9) Oligonol, new lychee fruit-derived low-moleculr form of polyphenol, enhnces lipolysis in primry rt dipocytes through ctivtion of the ERK/ pthwy. Phytother Res, Mittl A, Elmets CA & Ktiyr SK () Dietry feeding of pronthocynidins from grpe seeds prevents photocrcinogenesis in SKH- hirless mice: reltionship to decresed ft nd lipid peroxidtion. Crcinogenesis, Ali SF, LeBel CP & Bondy SC (99) Rective oxygen species formtion s iomrker of methylmercury nd trimethyltin neurotoxicity. Neurotoxicology, Nito C & Ymnk T (978) Lipid peroxides in therosclerotic diseses. Nippon Ronen Igkki Zsshi 5, Folch J, Lees M & Slone Stnley GH (957) A simple method for the isoltion nd purifiction of totl lipides from niml tissues. J Biol Chem 6, Mihr M & Uchiym M (978) Determintion of mlonldehyde precursor in tissues y thiorituric cid test. Anl Biochem 86, Hissin PJ & Hilf R (976) A fluorometric method for determintion of oxidized nd reduced glutthione in tissues. Anl Biochem 7, 6.. Itzhki RF & Gill DM (96) A micro-iuret method for estimting proteins. Anl Biochem 9,.. Brownlee M () Biochemistry nd moleculr cell iology of dietic complictions. Nture, Rösen P, Nwroth PP, King G, et l. () The role of oxidtive stress in the onset nd progression of dietes nd its complictions: summry of Congress Series sponsored y UNESCO-MCBN, the Americn Dietes Assocition nd the Germn Dietes Society. Dietes Met Res Rev 7, 89.. Newsholme P, Her EP, Hirr SM, et l. (7) Dietes ssocited cell stress nd dysfunction: role of mitochondril nd non-mitochondril ROS production nd ctivity. J Physiol 58, 9.. Higdon JV & Frei B () Te ctechins nd polyphenols: helth effects, metolism, nd ntioxidnt functions. Crit Rev Food Sci Nutr, Perron NR & Brumghim JL (9) A review of the ntioxidnt mechnisms of polyphenol compounds relted to iron inding. Cell Biochem Biophys 5, Surh YJ, Chun KS, Ch HH, et l. () Moleculr mechnisms underlying chemopreventive ctivities of ntiinflmmtory phytochemicls: down-regultion of COX- nd inos through suppression of NF-kB ctivtion. Mutt Res 8 8, Vnder Jgt DL, Hsserook RK, Hunsker LA, et l. () Metolism of the -oxoldehyde methylglyoxl y ldose reductse nd y glyoxlse-i: roles for glutthione in oth enzymes nd implictions for dietic complictions. Chem Biol Interct, Yeh CH, Sturgis L, Hidcher J, et l. () Requirement for p8 nd p/p mitogen-ctivted protein kinses in RAGE-medited nucler fctor-kb trnscriptionl ctivtion nd cytokine secretion. Dietes 5, Lohwsser C, Neureiter D, Popov Y, et l. (9) Role of the receptor for dvnced glyction end products in heptic firosis. World J Gstroenterol 5, Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
10 J. S. Noh et l.. Ngi R, Unno Y, Hyshi MC, et l. () Peroxynitrite induces formtion of N -(croxymethyl)lysine y the clevge of Amdori product nd genertion of glucosone nd glyoxl from glucose: novel pthwys for protein modifiction y peroxynitrite. Dietes 5, Khn SE, Hull RL & Utzschneider KM (6) Mechnisms linking oesity to insulin resistnce nd type dietes. Nture, Velsco G, Geelen MJ & Guzmán M (997) Control of heptic ftty cid oxidtion y 5 -AMP-ctivted protein kinse involves mlonyl-coa-dependent nd mlonyl-coaindependent mechnism. Arch Biochem Biophys 7, Bennett MK, Seo YK, Dtt S, et l. (8) Selective inding of sterol regultory element-inding protein isoforms nd co-regultory proteins to promoters for lipid metolic genes in liver. J Biol Chem 8, Kpln M, Kerry R, Avirm M, et l. (8) High glucose concentrtion increses mcrophge cholesterol iosynthesis in dietes through ctivtion of the sterol regultory element inding protein (SREBP): inhiitory effect of insulin. J Crdiovsc Phrmcol 5,. 5. Lee YA, Cho EJ & Yokozw T (8) Effects of pronthocynidin preprtions on hyperlipidemi nd other iomrkers in mouse model of type dietes. J Agric Food Chem 56, British Journl of Nutrition Downloded from IP ddress: , on 6 Aug 8 t 7::, suject to the Cmridge Core terms of use, ville t
* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationBritish Journal of Nutrition
British Journl of Nutrition (215), 113, 1862 1875 q The Authors 215 doi:1.117/s7114515121x Anormlities in myo-inositol metolism ssocited with type 2 dietes in mice fed high-ft diet: enefits of dietry myo-inositol
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationBritish Journal of Nutrition
British Journl of Nutrition (2012), 108, 2166 2175 q The Authors 2012 doi:10.1017/s0007114512000347 Differentil effects of low-dose resvertrol on diposity nd heptic stetosis in diet-induced oese mice Su-Jung
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationBritish Journal of Nutrition
(11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen
More informationCurcumin attenuates Nrf2 signaling defect, oxidative stress in muscle and glucose intolerance in high fat diet-fed mice
Online Sumissions: http://www.wjgnet.com/1948-938of fice wjd@wjgnet.com doi:239/wjd.v3.i.94 World J Dietes 212 My 1; 3(): 94-14 ISSN 1948-938 (online) 212 Bishideng. All rights reserved. ORIGINAL ARTICLE
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationDIETARY FOOD FORTIFIED WITH OROTIC ACID AND LIVER FUNCTION
MAKARA, SAINS, VOL. 15, NO. 2, NOVEMBER 211: 11-15 DIETARY FOOD FORTIFIED WITH OROTIC ACID AND LIVER FUNCTION Yohnes Bung Deprtment of Chemistry, Fculty of Science nd Engineering, Nus Cendn University,
More informationPhysical training prevents oxidative stress in L-NAME-induced hypertension rats
cell iochemistry nd function Cell Biochem Funct 2013; 31: 136 151. Pulished online 7 Septemer 2012 in Wiley Online Lirry (wileyonlinelirry.com) DOI:.02/cf.2868 Physicl trining prevents oxidtive stress
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationThe effects of Momordica charantia on obesity and lipid profiles of mice fed a high-fat diet
Nutrition Reserch nd Prctice 2015;9(5):489-495 c2015 The Koren Nutrition Society nd the Koren Society of Community Nutrition http://e-nrp.org The effects of Momordic chrnti on obesity nd lipid profiles
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationKeywords ATP. GK rat. Na + /K + -ATPase. Pancreatic islet. ROS. Src
Dietologi (28) 51:1226 1235 DOI 1.17/s125-8-18-x ARTICLE ctivtion genertes rective oxygen species nd impirs metolism secretion coupling in dietic Goto Kkizki nd ouin-treted rt pncretic islets R. Kominto
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationEnhanced glutathione peroxidases (GPx) activity in young barley seedlings enriched with selenium
Africn Journl of Biotechnology Vol. 10(55), pp. 11483-11487, 21 Septemer, 2011 Aville online t http://www.cdemicjournls.org/ajb DOI: 10.5897/AJB11.1480 ISSN 1684 5315 2011 Acdemic Journls Full Length Reserch
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationCHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS
CHAPTER- 3 CHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS 3.1. INTRODUCTION The liver, hs vriety of trnsminse to synthesize nd
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationResearch Article Protective Effect of Short-Term Genistein Supplementation on the Early Stage in Diabetes-Induced Renal Damage
Meditors of Inflmmtion Volume 2013, rticle ID 510212, 14 pges http://dx.doi.org/10.1155/2013/510212 Reserch rticle Protective Effect of Short-Term Genistein Supplementtion on the Erly Stge in Dibetes-Induced
More informationEffect of Different Dietary Energy Sources on Induction of Fatty Liver-Hemorrhagic Syndrome in Laying Hens
Interntionl Journl of Poultry Science 7 (12): 1232-1236, 2008 ISSN 1682-8356 sin Network for Scientific Informtion, 2008 Effect of Different Dietry Energy Sources on Induction of Ftty Liver-Hemorrhgic
More informationAnti-Glycation Effects of Pomegranate (Punica granatum L.) Fruit Extract and Its
Anti-Glyction Effects of Pomegrnte (Punic grntum L.) Fruit Extrct nd Its Components In Vivo nd In Vitro Yuy Kumgi, 1 Schie Nktni, 1 Hideki Onoder, 1 Akifumi Ngtomo, 2 Norihis Nishid, 2 Yoichi Mtsuur, 2
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationEffects of Curcumin Attenuated Hepatitis in Mice with Paracetamol Overdose ABSTRACT
Originl Article 43 Effects of Curcumin Attenuted Heptitis in Mice with Prcetmol Overdose Somnwt K 1 Thong-Ngm D 1 Klikew N 2 ABSTRACT Bckground: N-cetyl-p-minophenol () or prcetmol overdose cuses incresing
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationEnhanced Chemopreventive Effect by Combining Quercetin and Green tea in Prostate Cancer
Enhnced Chemopreventive Effect y Comining Quercetin nd Green te in Prostte Cncer Piwen Wng, MD, PhD Assistnt Professor, Division of Cncer Reserch nd Trining Chrles R. Drew University of Medicine nd Science
More informationAntifibrotic Mechanism of Pinocembrin: Impact on Oxidative Stress, Inflammation and TGF-β /Smad Inhibition in Rats
Antifirotic Mechnism of Pinocemrin., 2018; 17 (2): 307-317 ORIGINAL ARTICLE Mrch-April, Vol. 17 No. 2, 2018: 307-317 307 The Officil Journl of the Mexicn Assocition of Heptology, the Ltin-Americn Assocition
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationKumar et al. Kumar et al. BMC Complementary and Alternative Medicine 2013, 13:273
Umelliferone β-d-glctopyrnoside from Aegle mrmelos (L.) corr. n ethnomedicinl plnt with ntidietic, ntihyperlipidemic nd ntioxidtive ctivity Kumr et l. Kumr et l. BMC Complementry nd Alterntive Medicine
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationRole of hydroxytyrosol in ameliorating effects of high fat
Role of hydroxytyrosol in meliorting effects of high ft diet on mle rts CNS Hyder A. N. Al-Zmely, Zen Shkir Mhmoud Al -Tmemi Dept. of physiology nd biochemistry, College of veterinry Medicine, AL-Qssim
More informationSESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?
SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte
More informationThe role of insulin and glucose in goose primary hepatocyte triglyceride accumulation
1553 The Journl of Experimentl Biology 212, 1553-1558 Pulished y The Compny of Biologists 2009 doi:10.1242/je.022210 The role of insulin nd glucose in goose primry heptocyte triglyceride ccumultion Chunchun
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationAccepted 10 January 2006
The Journl of Experimentl Biology 9, - Pulished y The Compny of Biologists doi:./je. Glycerol production in rinow smelt (Osmerus mordx) my e triggered y low temperture lone nd is ssocited with the ctivtion
More informationBeneficial effects of hesperidin following cis diamminedichloroplatinum induced damage in heart of rats
Originl Article Beneficil effects of hesperidin following cis dimminedichloropltinum induced dmge in hert of rts H Oguzturk, O Ciftci 1, A Cetin 2, K Ky 3, OM Disli 4, MG Turty, S Gürüz, N Bsk 5 Deprtments
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationInterleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes
ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationHEPATOPROTECTIVE EFFECTS OF GINKGO BILOBA AGAINST CARBON TETRACHLORIDE INDUCED HEPATIC INJURY IN RATS
Indin Journl of Phrmcology 21; 33: 26-266 RESEARCH PAPER K. ASHOK SHENOY et l. HEPATOPROTECTIVE EFFECTS OF GINKGO BILOBA AGAINST CARBON TETRACHLORIDE INDUCED HEPATIC INJURY IN RATS K. ASHOK SHENOY*, S.
More informationMolecular Nutrition and Food Research. Cocoa flavonoid epicatechin protects pancreatic beta cell viability and function against oxidative stress
Moleculr Nutrition nd Food Reserch Coco flvonoid epictechin protects pncretic et cell viility nd function ginst oxidtive stress Journl: Moleculr Nutrition nd Food Reserch Mnuscript ID: mnfr.0.r Wiley -
More informationEffect of Conjugated Linoleic Acid (CLA) in Rats Subjected to Damage Liver Induced by Carbon Tetrachloride
32 Journl of Modern Medicinl Chemistry, 2014, 2, 32-42 Effect of Conjugted Linoleic Acid () in Rts Sujected to Dmge Liver Induced y Cron Tetrchloride Eline Bonifácio Teixeir de Crvlho 1,*, Illn Louise
More informationAlterations in drug metabolizing activities in acute hepatosteatosis induced by intake of a high-carbohydrate/fat-free diet after food deprivation
Functionl Foods in Helth nd Disese 2016; 6(1):59-69 Pge 59 of 69 Altertions in drug metolizing ctivities in cute heptostetosis induced y intke of high-crohydrte/ft-free diet fter food deprivtion Chul Won
More informationFollow this and additional works at: Part of the Life Sciences Commons
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2013 Insulin Secretgogue Activity of Ellgic Acid-Rich Muscdine (Vitis Rotundifoli) nd Indin Gooseerry (Emlic Officinlis) Extrcts
More informationAnti-Obesity Potential of Gallic Acid from Labisia pumila, through Augmentation of Adipokines in High Fat Diet Induced Obesity in C57BL/6 Mice
Advnces in Reserch 2(10): 556-570, 2014, Article no. AIR.2014.10.004 SCIENCEDOMAIN interntionl www.sciencedomin.org Anti-Oesity Potentil of Gllic Acid from Lisi pumil, through Augmenttion of Adipokines
More informationDe novo lipogenesis in human fat and liver is linked to ChREBP-b and metabolic health
Received 2 Aug 2 Accepted 23 Jn 213 Pulished 26 Fe 213 DOI: 1.13/ncomms253 De novo lipogenesis in humn ft nd liver is linked to ChREBP- nd metolic helth Leh Eissing 1, *, Thoms Scherer 2, *,w, Klus Tödter
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationAvailable online at International Journal of Current Research Vol. 9, Issue, 10, pp , October, 2017
z Aville online t http://www.journlcr.com Interntionl Journl of Current Reserch Vol. 9, Issue, 1, pp.58684-587, Octoer, 217 INTERNATIONAL JOURNAL OF CURRENT RESEARCH ISSN: 975-833X RESEARCH ARTICLE COMPARATIVE
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationChromium Alleviates Glucose Intolerance, Insulin Resistance, and Hepatic ER Stress in Obese Mice
nture pulishing group rticles intervention AND prevention Chromium Allevites Glucose Intolernce, Insulin Resistnce, nd Heptic ER Stress in Oese Mice Nir Sreejyn, Feng Dong, Mchender R. Knddi,2, Xioping
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationEffects of Sini San used alone and in combination with fluoxetine on central and peripheral 5-HT levels in a rat model of depression
Online Sumissions:http://www.journltcm.com J Trdit Chin Med 2013 Octoer 15; 33(5): 674-681 info@journltcm.com ISSN 0255-2922 2013 JTCM. All rights reserved. EXPERIMENTAL STUDY TOPIC Effects of Sini Sn
More informationHigh dietary salt decreases antioxidant defenses in the liver of fructose-fed insulin-resistant rats
Aville online t www.sciencedirect.com ScienceDirect Journl of Nutritionl Biochemistry 24 (213) 216 222 RESEARCH ARTICLES High dietry slt decreses ntioxidnt defenses in the liver of fructose-fed insulin-resistnt
More informationNutrition Research and Practice 2015;9(3): ; doi: /nrp ; pissn eissn
Nutrition Reserch nd Prctice 215;9(3):227-234 c215 The Koren Nutrition Society nd the Koren Society of Community Nutrition http://e-nrp.org Dul effects of mixture of grpe pomce (Cmpell Erly) nd Omij fruit
More informationCompound K attenuates glucose intolerance and hepatic steatosis through AMPK-dependent pathways in type 2 diabetic OLETF rats
ORIGINAL ARTICLE Koren J Intern Med 218;33:347-355 Compound K ttenutes glucose intolernce nd heptic stetosis through AMPK-dependent pthwys in type 2 dibetic OLETF rts Yoo-Cheol Hwng 1, D-Hee Oh 1, Moon
More informationAnti-proliferative and pro-apoptotic effects of tectorigenin on hepatic stellate cells
Online Sumissions: http://www.wjgnet.com/17-9327office wjg@wjgnet.com doi:1.3748/wjg.v16.i31.3911 World J Gstroenterol 21 August 21; 16(31): 3911-3918 ISSN 17-9327 (print) 21 Bishideng. All rights reserved.
More informationAnti-Tumor Effect of Azadirachta indica (Neem) on Murine Solid Ehrlich Carcinoma
Acdemic Journl of Cncer Reserch 7 (1): 38-45, 2014 ISSN 1995-8943 IDOSI Pulictions, 2014 DOI: 10.5829/idosi.jcr.2014.7.1.1111 Anti-Tumor Effect of Azdircht indic (Neem) on Murine Solid Ehrlich Crcinom
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationJournal of Chemical and Pharmaceutical Research
Avilble on line www.jocpr.com Journl of Chemicl nd Phrmceuticl Reserch ISSN No: 0975-7384 CODEN(USA): JCPRC5 J. Chem. Phrm. Res., 2011, 3(3):52-63 Effect of Lovsttin on Lipoprotein Lipid Peroxidtion nd
More informationAMELIORATIVE EFFECT OF POMENGRATE PEEL WATER EXTRACT AGAINST FOLIC ACID-INDUCED NEPHROTOXICITY IN RATS
Vol. 3. No. 4. July, 2011, II Prt AMELIORATIVE EFFECT OF POMENGRATE PEEL WATER EXTRACT AGAINST FOLIC ACID-INDUCED NEPHROTOXICITY IN RATS Ftm H. Ad El-Rzek, Ens A. Kmel Biochemistry nd Nutrition Deprtment,Women's
More informationEffect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationQuercetin modulates Nrf2 and glutathione-related defenses in HepG2. cells. Involvement of p38
Quercetin modultes Nrf2 nd glutthione-relted defenses in HepG2 cells. Involvement of p38 An Belén Grndo-Serrno, Mrí Angeles Mrtín, Lur Brvo, Luis Goy nd Soni Rmos* Deprtment of Metolism nd Nutrition Institute
More informationEFFECT OF METHANOL EXTRACT OF ALOE VERA ON ACETIC ACID-INDUCED COLON ULCER
EFFECT OF METHANOL EXTRACT OF ALOE VERA ON ACETIC ACID-INDUCED COLON ULCER 4. EFFECT OF METHANOL EXTRACT OF ALOE VERA ON ACETIC ACID -INDUCED COLON ULCER 4.1 INTRODUCTION Aloe rdensis Miller (Aloe ver)
More informationGlucose metabolism inhibits apoptosis in neurons and cancer cells by redox inactivation of cytochrome c
letters Glucose metolism inhiits poptosis in neurons nd cncer cells y redox inctivtion of cytochrome c Allyson E. Vughn 1 nd Mohnish Deshmukh 1,2,3 Neurons nd cncer cells use glucose extensively, yet the
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationFlaxseed Lignan Increased Glucose Uptake by Human Red Blood Cells
The Open Nutrceuticls Journl, 29, 2, 81-85 81 Open Access Flxseed Lignn Incresed Glucose Uptke y Humn Red Blood Cells Yeong Rhee * nd Ardith Brunt 351 EML, NDSU Dept. # 262, PO Box 65, North Dkot Stte
More informationDOI /mnfr
3 Mol. Nutr. Food Res. 15, 59, 3 35 DOI 1.1/mnfr.1399 RESEARCH ARTICLE Ursolic cid improves lipid nd glucose metolism in high-ft-fed C57BL/6J mice y ctivting peroxisome prolifertor-ctivted receptor lph
More informationEFFECT OF DIETARY TOCOTRIENOLS ON INFECTION AND INFLAMMATION INDUCED LIPOPROTEIN OXIDATION IN HAMSTERS
Interntionl Journl of Phrmcy nd Phrmceuticl Sciences ISSN- 975-1491 Vol 3, Issue 3, 211 Reserch Article EFFECT OF DIETARY TOCOTRIENOLS ON INFECTION AND INFLAMMATION INDUCED LIPOPROTEIN OXIDATION IN HAMSTERS
More information