Role of hydroxytyrosol in ameliorating effects of high fat

Transcription

1 Role of hydroxytyrosol in meliorting effects of high ft diet on mle rts CNS Hyder A. N. Al-Zmely, Zen Shkir Mhmoud Al -Tmemi Dept. of physiology nd biochemistry, College of veterinry Medicine, AL-Qssim Green University Abstrct Hydroxytyrosol (HT), virgin olive oil phenolic compound with mny helth benefits hs been used s strong ntioxidnt with scvenging ctivity to eliminte the free rdicls which hve been formed in the body exposed to oxidtive stress, the present study imed to investigte the role of hydroxytyrosol in meliorting the hrmful effect of high ft diet consumption in mle rts CNS.Forty eight mles Wistr rts bout 3 months old with verge weight 160 ± 15 g were divided rndomly in to four equl groups nd treted for 3 months s the follow : First group (C ) control group were drenched with distilled wter nd were fed with norml pelleted diet, second group () were treted with 100 mg/kg/bw of hydroxytyrosol, third group (T2) were given high sturted ft diet( 60% ft) for the lst 6 weeks of the current study the fourth group () were treted by 100 mg/kg/bw of hydroxytyrosol for the first 6 weeks of the study then diet ws chnged to high ft diet for the other 6 weeks of this study. Results of the current study reveled significnt difference (P 0.05) represented by increse in serum TNF-α concentrtion in T2 group compred with other groups C,,T, lso there ws significnt decrese in TNF-α concentrtion in group s compred with T2 group. On the other hnd there ws significnt difference (p 0.05) represented by increse in serum MCP-1 concentrtion in T2 group s compred with other groups while there ws significnt decrese in MCP-1 concentrtion in group s compred with the previous group. The results of lipid profile(cholesterol, triglyceride, high density lipoprotein HDL-c, low density lipoprotein LDL-c nd very low density lipoprotein VLDL-c) of nd were showed n improvement in lipid profile vlues when compred with T2 group which were showed highly significnt increse (P 0.05) in TG, LDL-c, VLDL-c nd significnt decrese in HDLc. regrding results of gene expression of (NF-KB) gene were showed significnt increse (P 0.05) in T2 group nd significnt decrese in nd groups. Keywords: hydroxytyrosol, high ft diet, NF-KB, CNS. INTRODUCTION One of the gretest fctors contributing to the prevlence of obesity is choice of diet. A term to describe the unhelthy diet eten by mny people s well s other westernized popultions is " the western diet "(1). Excessive ft intke contributes to the progression of metbolic diseses by cellulr injury nd inflmmtion, process termed lipotoxicity ws investigted by the role of lysosoml dysfunction nd impired utophgic flux in the pthogenesis of lipotoxicity.(2) obesity my cuse oxidtive stress, neuroinflmmtion, dipocyte derived dipokine chnges, such s incresed leptin nd resistin, nd reduced diponectin tht re ssocited with dverse effects on therosclerosis (3). Antioxidnts ct by inhibiting or delying the cellulr dmge through their free rdicl scvenging property nd cn sfely interct with them nd destroy the chin rection before the cellulr dmge (4). Olive oil constitutes the min Mediterrnen diet, the importnce of its poly phenols such s Hydroxytyrosol hs been come from its scvenging the free rdicls nd drw ttention due to their beneficil effect in most phrmcologicl fields it ct s n ntioxidnt, nticncer, nti-inflmmtory nd neuroprotective substnce (5). lso it is ble to reduce oxidtive stress, inflmmtory processes, improve the mitochondril function in brin tissues nd counterct lipid profile nd insulin sensitivity (6). NF-KB, known s hllmrk of oxidtive stress in brin is n inducible nd ubiquitously expressed trnscription fctor responsible for regulting the expression of genes involved in cell survivl, cell dhesion, inflmmtion, differentition, nd growth(7). The trnscription fctor NF-KB promotes immunity by controlling the expression of genes involved in neuroinflmmtion. Cytokines nd pthogen-ssocited moleculr ptterns (PAMPs) stimulte cell surfce receptors including toll-like receptors (TLRs) to initite signling cscde resulting in the ctivtion of NF-KB. NF-KB drives expression of trget genes tht medite cell prolifertion nd relese of ntimicrobil molecules nd cytokines to ctivte the immune response. Although NF-KB ws first chrcterized in cells of the hemtopoietic system, subsequent reserch hs reveled tht NF- KB ctivtion cn occur in most cell types. Indeed, number of recent high-profile reports hve demonstrted key role for the NF-KB signling pthwy in the liver, dipose tissue, nd centrl nervous system in the development of inflmmtion-ssocited metbolic diseses (8). HFD incresed diposity (body weight, ft mss, ft percent nd dipocyte size), metbolic dysfunction (impired glucose metbolism nd insulin resistnce) mcrophge number, nd gene expression of, T-cell mrkers, inflmmtory meditors, nd mrna expression of MCP-1, tumor necrosis fctor α (TNF-α) nd interleukin-6. However, contrry to the hypothesis, MCP-1 deficiency excerbted mny of these responses resulting in further increse in diposity (body weight, ft mss, ft percent nd dipocyte size), metbolic dysregultion, mcrophge mrkers, inflmmtory cell infiltrtion.(9). Rts fed high-ft diet exhibited significnt elevtion of plsm triglyceride nd totl nd low-density lipoprotein (LDL) cholesterol concentrtions. These chnges represented disorders of biosynthesis nd metbolism of the primry bile cids, steroids, nd ftty cids nd mitochondril ftty cid elongtion pthwys in diet-induced hyperlipidemi.(10). tretment with HT significntly suppressed NF-KB expression in THP-1 cells. These results support the impliction of the NF-KB pthwy in the neuroprotective effect of HT in the erly brin injury.in ddition to reduction in neurl poptosis, cspse-3 ctivity ws lso meliorted following HT dministrtion. dministrtion of Hydroxytyrosol restrined NF-KB protein expression following brin injury (11). HT is the most powerful nturl ntioxidnt protect cells from oxidtive stress ssocited with metbolic fluxes. studies hve demonstrted tht HT inhibits the production of Tumor Necrosis Fctor lph (TNF-), key inflmmtory cytokine nd inhibit MCP-1 production lso (12). Olive Mill Wter extrct significntly lowered the serum levels of TC nd LDL-C while incresing the serum levels of high-density lipoprotein cholesterol (HDL-C), These results suggested tht the hypocholesterolemic effect of hydroxytyrosol, might be due to its bility to lower serum TC nd LDL-C levels s well s slowing the lipid peroxidtion process nd enhncing ntioxidnt ctivity (13). The present study ws crried out to investigte the role of Hydroxytyrosol extrcted from olive oil As potent ntioxidnt in meliorting effect of high ft consumption in mle Wistr rts through evlution of the protective effect of hydroxytyrosol on brin tissues by ssessing the expression level of mrna of NFkpp B gene, Serologicl ssessment of the inflmmtory mrkers TNF-lph nd MCP-1 by Elis technique, Estimting 2448

2 the role of hyroxytyrosol in combting high ft diet by the following biochemicl tests ; totl cholesterol,triglycerides TG, Low density lipoprotein LDL-c, High density lipoproteinhdl-c,very low density lipoprotein VLDL-c. MATERIALS AND METHODS Experimentl nimls In the current study, 48 mle Wistr rts were used, ges rnged between dys old, nd their weights rnged between g, nd cptured in plstic cges with dimensions 40-60cm nd kept under controlled conditions bout 12 hours light nd12 hours drk with 25 C. divided rndomly in to four groups, ech group included 12 nimls nd fed on bsl diet nd provided by drinking wter, the nimls were divided ccording to the following groups: Control Group: Fed on bsl diet for 3 months.treted Group : Fed on bsl diet nd were orlly dministered with Hydroxytyrosol 100 mg / Kg/BW once dily during the first6 weeks of the study (14). Treted Group T2 : Fed on bsl diet during the first 6 weeks of the study then the diet ws chnged to A high ft diet (HFD) 60 % ft (15).for the lst 6 weeks of this study. Treted Group : Fed on bsl diet nd were dministered with 100 mg / Kg/ BW once dily of hydroxytyrosol during the first 6 weeks of the study then the diet ws chnged to high ft diet (HFD) 60 % ft for the lst 6 weeks of the study. Preprtion of hydroxytyrosol nd HFD: Hydroxytyrosol ws obtined from( Trnshumn Technologies/ UK) 100 Mg/ KG/BW dissolved in distl wter t room temperture in drk bottle the solution ws prepred every dy for drenching. Diets were prepred weekly nd were kept in seled bgs nd drined of ir, kept wy from light, mintined t-20 C until dministered, nd were provided in pelleted form, HFD formultion nd composition s showed in the tble (1) (60% ft, 20% crbohydrte, 20% protein. Tble (1) High ft diet formul ( sturted HFD 60% ft ). HFD Formul Nutrient substnce weight energy (g) kcl Tllow (Sturted ft) Mltodextrin Csein Sucrose Cellulose 95 0 Sun Flower Oil Tble Slt 26 0 Vitmin Mix Minerl Mix 4 0 Amino cid Mix (premix) Methionine, Lysine 5 0 Serum lipid profile estimtion: All specimens were left t room temperture, the concentrtions of serum Totl Cholesterol, Triglycerides, HDL-c,VLDL-c, LDL-c( mg / dl) in mle rts were estimted using the clinicl Chemistry utomted nlyzer Cobs c 311, n open regent system for consolidting routine nd specil chemistry worklods, on bord cpcity of 45 tests nd throughput of up to 480 test per hour. Pro inflmmtory Cytokines Estimtion in Mle rts serum by using ELISA techniques Serum smples were tken nd ELISA ssy to proinflmmtory cytokines tumor necrosis fctor TNF-α nd monocyte chemottrctnt protein (MCP-1) were chieved ccording to the method described by the mnufctures compny ssy protocol (Elbscience.USA). Estimtion of Reltive gene Expression for Nucler Fctor Kpp B (NF-KВ ) Totl RNA extrction :Totl RNA were extrcted from brin smples by using (Accuzol regent kit. Bioneer. Kore) nd done ccording to compny instructions s follow; 300μl of blood smplews plced in 1.5ml eppendorf tube nd 1 ml of Accuzol regent ws dded nd the tubes shken vigorously for 1minute. Then, 200μl chloroform dded to ech tube nd shken vigorously for 15 seconds. Then the mixture ws incubted on ice for 5 minutes, nd then centrifuged t rpm, 4 C, for 15 minutes. The superntnt trnsferred into new eppendorf tube, nd 500μl isopropnol ws dded. Then, mixture mixed by inverting the tube 4-5 times nd incubted t 4 C for 10 minutes. Then, centrifuged t rpm, 4 C for 10 minutes. The superntnt ws discrded, nd 1ml 80% Ethnol ws dded nd mixed by vortex gin. Then, centrifuge t rpm, 4C for 5 minutes. The superntnt ws discrded nd the RNA pellet ws left to ir to dry. Finlly, 50μl DEPC wter ws dded to ech smple to dissolve the RNA pellet, nd then the extrcted RNA smple ws kept t -20. The extrcted totl RNA ws ssessed nd mesurement by Nnodrop spectrophotometer (THERMO. USA) DNse I Tretment: The extrcted RNA were treted with DNse I enzyme to remove the trce mounts of genomic DNA from the eluted totl RNA by using smples (DNse I enzyme kit) nd done ccording to method described by Promeg compny, USA instructions s following tble (2): Tble 2: DNse I Tretment mster mix preprtion Mix Volume Totl RNA 100ng/ul 10ul DNse I enzyme 1ul 10X buffer 4ul DEPC wter 5ul Totl 20ul After tht, The mixture ws incubted t 37 C for 30 minutes. Then, 1μl stop rection ws dded nd incubted t 65C for 10 minutes for inctivtion of DNse enzyme ction cdna synthesis : DNse-I tretment totl RNA smples were used in cdna synthesis step by using AccuPower RocktScript RT PreMix kit tht provided from Bioneer compny, Kore nd done ccording to compny instructions s following tble: Tble 3: RT mster mix for cdna synthesis RT mster mix Volume Totl RNA 100ng/ul 10ul Rndom Hexmer primer (10pmol) 1ul DEPC wter 9ul Totl 20ul This RT PreMix ws plced in AccuPower RocketScript RT PreMix tubes tht contins lyophilized Reverse trnscription enzyme t form. Then dissolved completely by vortex nd briefly spinning downthe RNA converted into cdna in thermocycler under the following thermocycler conditions Tble 4: Thermocycler conditions for cdna synthesis Step Temperture Time cdna synthesis (RT step) 42 C 1 hour Het inctivtion 95 C 5 minutes Quntittive Rel-Time PCR (qpcr) :qpcr ws performed for quntifiction of nucler fctor kpp B subunit 1 (Nfkb1) gene, reltive gene expression nlysis ws crried out by using (2 - CT Livk method) (17). The qpcr rection ws done on Rel- Time PCR system (BioRd. USA) by using SYBER Green dye qpcr mster mix tht used in detection nd mplifiction of( Nfkb1) trget gene nd GAPDH housekeeping gene for normliztion of gene expression(16) Primers were designed using the primer3 plus (Primers sequences re listed in Tble 5) 2449

3 Primer Nfkb1 GAPDH Tble 5: RT-qPCR primers with their sequence F R F R Sequence (5'-3') TGGTGGTTGGCTTTGCAAAC ATCCGTGCTTCCAGTGTTTC AGTTCAACGGCACAGTCAAG TGGAAGATGGTGATGGGTTTCC Product Size 76bp 70 bp qpcr mster mix ws prepred for Nfkb1 trget gene nd GAPDH housekeeping gene ccording to (AccuPower TM 2XGreen Str qpcr mster mix kit. Bioneer.Kore) instructions s following tble (6) Tble 6: qpcr mster mi preprtion qpcr mster mix cdna templte (100ng) Forwrd primer(10pmol) Reverse primer (10pmol) qpcr Mster Mix DEPC wter Totl volume 2.5µL 1 µl 1 µl 10 µl 5.5 µl 20 µl After tht, qpcr mster mix rection component tht mentioned bove plced in qpcr white tube strips nd mixed by (Exispin vortex centrifuge, Bioneer. Kore) for 3 minutes, thn the strips plced in Miniopticon Rel-Time PCR system BioRd USA s following thermocycler conditions tble (7) Tble 7: qpcr thermocycler conditions qpcr step Temperture Time Repet cycle Initil Denturtion 95 C 5min 1 Denturtion 95 C 20 sec Anneling\Extention C 30 sec Detection(scn) Tble (8) effect of hydroxytyrosol nd HFD on serum TNF-α concentrtion in mle rt (pg/ml) TNF-α Concentrtion (pg/ ml) C ± A ± A T ± B ± C LSD Tble 9: effect of hydroxytyrosol on serum MCP-1 concentrtion in mle rts prmeters MCP-1 Concentrtion (ng/ ml) C 2.33 ± ± 0.45 T ± 0.55c 5.18 ± 0.43 b LSD Prmeters C T2 LSD 0.05 Cholesterol 64.75± ±2.14 b 68.65±2.68 c 65.96± Tble 10: effect of hydroxytyrosol nd HFD on serum lipids in mle rts TG 77.53± ± ±28.63 c 85.90± LDL 14.98± ±0.66 b 18.05±1.14 c 9.51±0.7 db 2.50 HDL 41.54± ± ±1.37 b 39.18±0.97 b 5.26 VLDL 18.24± ± ±6.75 b 17.45± Numbers = men ± S.E,Different litters = significnt differences (p 0.05),C group = control group, group = Fed on bsl diet nd were orlly dministered with Hydroxytyrosol 100 mg / Kg/BW once dily during the first 45 dys of the study. T2 group = : Fed on bsl diet during the first 6 weeks of the study then the diet ws chnged to A high ft diet (HFD ) 60 % ft for the lst 6 weeks of the study. group = Fed on bsl diet nd were dministered with 100 mg / Kg/ BW once dily of hydroxytyrosol during the first 6 weeks of the study then the diet ws chnged to high ft diet (HFD) 60 % ft for the lst 6 weeks of the study. Tble 11: effect of hydroxytyrosol nd HFD on NF-KB gene expression Fold chnge mrna trnscript level 0.29± T ± 0.87 b 2.56± 0.43 c C 1.35± 0.19 c LSD Sttisticl nlysis of the results by using computer progrm (SPSS),Version 23one-wy nlysis of vrince (ANOVA) were used, the difference ws considered significnt t P < 0.05 Descriptive sttistics :men± stnder error, sttsticl nlysis of dt ws performed on the bsis of ANOVA (one wy nlysis of vrince) with lest significnt difference LSD ws detected to compre between groups. Figure 1: Digrm showing TNF-α concentrtion in rts serum (pg/ml) 2450

4 Figure 2 : Rel time PCR mplifiction plot for nucler fctor kpp B gene( NF-KB ) in brin tissue of mle rts tht show difference in threshold cycle numbers (Ct vlue) between tretment nd control groups. Red plot : HT group Fed on bsl diet nd were orlly dministered with Hydroxytyrosol 100 mg / Kg/BW once dily during the first 45 dys of study. Blue plot: HFD group Fed on bsl diet during the first 6 weeks of the study then the diet ws chnged to A high ft diet (HFD ) 60 % ft for lst 6weeks of study. Green plot: HT+HFD groupfed on bsl diet nd were dministered with 100 mg / Kg/ BW once dily of hydroxytyrosol during the first 6 weeks of the study then the diet ws chnged to high ft diet (HFD) 60 % ft for the lst 6 weeks of study.yellow plot: Control group Figure 4: reltive nucler fctor kpp B expression RESULTS AND DISCUSSION Effect of Hydroxytyrosol nd HFD on serum Tumor Necrosis Fctor-lph (TNF-α ) concentrtion in mle rts.(pg/ml). In current study, results in tble (8), figure(1), showed tht there ws significnt difference (p 0.05) represented by increse in serum TNF-α concentrtion in T2 group ( ± ) s compred with C, nd groups. there ws slight decrese TNF-α concentrtion in group ( ± ) compred with C group( ± ) while there ws significnt decrese in TNF-α concentrtion in group( ± 79.78) which were received both HT nd HFD s compred with T2 group which were received HFD only.severl studies confirm this fct tht the cytokine tumor necrosis fctor (TNF), mster regultor of the immune system, plys n importnt role in the propgtion of inflmmtion due to the ctivtion nd recruitment of immune cells vi its receptor TNF receptor 1 (TNFR1). Moreover, TNFR1 cn directly induce oxidtive stress by the ctivtion of ROS nd RNS producing enzymes.nutrient stress is generlly considered from the stndpoint of how cells detect nd respond to n insufficient supply of nutrients to meet their bioenergetic needs. However, cells lso experience stress s result of nutrient excess, during which rective oxygen species (ROS) production exceeds tht required for norml physiologicl responses. This my occur s result of oncogene ctivtion or chronic exposure to growth fctors combined with high levels of nutrient.(31). Both TNF-induced oxidtive stress nd inflmmtion interct nd cooperte to promote neurodegenertion. However, TNF plys dul role in neurodegenertive disese, since stimultion vi its second receptor, TNFR2, is neuroprotective nd promotes tissue regenertion (18), (9). Our results were very similr to study reported by (19). who mesured the concentrtion of two proinflmmtory cytokines (IL-1β nd TNFα) in the plsm of mice t week 16 of high ft mice feeding nd found significnt increse of TNFα for mice fed HFD compred with control mice. our results were in greement with (20). documented tht the olive oil rich with ntioxidnt compounds ( hydroxytyrosol nd tyrosol ) in dose of 0.75ml/kg/dy in the cortex nd stritum of rts ttenuted TNF- α receptor -1expression significntly compred with the control (intct) group(p= 0.01 nd P= 0.00, respectively). The significnt difference in lower doses of olive oil ws not seen. Effect of hydroxytyrosol nd high ft on serum monocyte chemo ttrctnt protein (MCP-1) concentrtion in mle rts(ng/ml). Results in tble (9) figure (2)showed tht there ws significnt difference (p 0.05) represented by increse in serum MCP-1 concentrtion in T2 group which were fed on 60% ft (8.90 ± 0.55) s compred with other groups while there ws significnt decrese in MCP-1 concentrtion in group which were received both HT nd HFD 60% (5.18 ± 0.43) s compred with the previous group, on the other hnd we found tht there ws no significnt difference chrcterized by slight decrese between group (2.24 ± 0.45) which were received only HT nd control group(2.33 ± 0.53). gene expression nd the protein secretion of MCP-1, ws mrkedly enhnced in dipocyte nd dipose tissue of obese nimls, presumbly contributing to the inflmmtory milieu in obesity, monocyte chemottrctnt protein-1 decreses insulin-stimulted glucose uptke in dipocytes, indicting the involvement of MCP-1 in insulin resistnce (21). phenolic compounds of hydroxytyrosol lso modulted TNF-α nd MCP-1 plsm levels in high cholesterol fed mle rts for 8 weeks compred to norml fed rts nd they found tht HT-Acette nd HT-Ether improved dipose tissue distribution nd dipokine production, decresing MCP-1 levels. results confirm the metbolic effects of HT, which re mintined nd even improved by hydrophobic derivtives, prticulrly HT-Acette (22). Effect of hydroxytyrosol nd high ft diet on serum lipids in mle rts (mg/dl). Tble (10) showed significnt increse (P<0.05) in cholesterol level in T2 group( HFD fed rts), ( 68.65±2.68) s compred with group (which were received HT ) 60.91±2.14, while there ws slight increse in cholesterol vlue in T2 group s compred with other groups, C ( 64.75±2.33) nd ( 65.96±3.47) which were received HT nd HFD ). In the sme tble with regrding triglycerides prmeter we noticed significnt increse with TG level in T2 group( ±28.63), s compred with other 3 groups Control group, nd (77.53± 5.31), (60.09±4.44), (85.90±4.43) respectively, nd showed significnt decrese of TG level in group compred with T2 group. As for low density lipoprotein prmeter (LDL), our results showed significnt increse in T2 (18.05±1.14 ) compred with control nd groups ( 14.98±0.82), (8.96±0.66) respectively, on the other hnd there ws significnt decrese between T2 nd group (9.51±0.7). Regrding high density lipoprotein prmeter (HDL) our results showed significnt decrese in T2 group (35.42±1.37) compred with C nd groups, there ws no significnt difference between control group (41.54±1.88) nd 2451

5 group (45.16±2.51), nd no significnt difference between T2 nd group chrcterized by slight increse in (39.18±0.97). While VLDL prmeter results were showed significnt increse in T2 group (46.33±6.75) compred with other groups C,,groups(18.24±1.89),(11.89±0.97), (17.45±1.66) respectively, no significnt differences between previous groups hve been observed. Beef ft rises serum cholesterol concentrtions. Becuse beef ft is 19% steric cid, the cholesterol-rising potentil of beef is not s gret s predicted by its totl sturted ftty cid content. However, beef tllow is hypercholesterolemic compred with fts contining less cholesterol-rising sturted ftty cid (23). mle rts fed diet contining 1% cholesterol or 15% lrd, incresed plsm cholesterol nd triglycerides compred to controls (24). Moderte nd High SFA presented reduction in insulin, leptin/diponectin rtio, nd increse in diponectin nd diponectin/leptin rtio. Adiponectin/leptin rtio ws predictor of totl cholesterol nd LDL-cholesterol reduced only in High SFA tertile, nd ws ssocited with SFA independent of viscerl ft (26). Mny trils hve investigted the helthy benefits of hydroxytyrosol supplementtion. These studies hve demonstrted decrese in the rtio of T-CHOL nd increse in HDL-C, with reduction of mrkers of oxidtive stress such s IL-6 nd CRP levels, nd monocyte number with high hydroxytyrosol levels it is considered indictive of one of the mjor nti-therogenic polyphenol compounds in olive-oil (25). Another recent study were similr to our study showed tht the tretment with supplementtion of new nutrceuticl NC which include hydroxytyrosol demonstrted significnt reduction of serum totl cholesterol, LDL-cholesterol, triglycerides nd significntly increse of HDL-cholesterol levels in hypercholesterolemic ptients (27). Reltive expression of Nucler Fctor Kpp B (NF-KB) gene Our results in tble (11), figures (3, 4) showed tht there ws significnt difference (P 0.05) represented by increse fold chnge of gene expression level in T2 group (10.77± 0.87) s compred with other groups, there ws significnt decrese in fold chnge of gene expression level in group (P 0.05) (0.29 ± 0.048) s compred with T2 nd (2.56± 0.43), on the other hnd there ws no significnt difference between nd control group ( 1.35± 0.19) lso there ws no significnt difference between nd C group. Our results were showed mrked up regultion in NF-kpp B gene expression in T2 group which were exposed to high ft diet for 6 weeks of the current study which indicte the close reltionship between induced obesity nd inflmmtory signling pthwy regulted by NF-KB gene. t the sme time our results were showed mrked decline in the sme gene expression in group which were given hydroxytyrosol nd HFD, these findings prove the protective effect of HT ginst the oxidtive stress induced by HFD, lso we found n obvious down regultion of NF-KB gene expression in group, the one tht ws received only HT nd these results confirm the fct tht HT is potent ntioxidnt which reduce the expression of NF-kb gene even within norml feeding cses. The mediobsl hypothlmus regultes energy blnce nd prevents obesity by djusting ppetite nd food intke in response to signls of metbolic sttus including insulin nd leptin. To investigte how inflmmtory gene expression contributes to centrl control of nutrient metbolism, the Ci group sought to define IKKβ ction in the hypothlmus. IKKβ is constitutively expressed in the hypothlmus nd directs NF-KB ctivtion in the CNS of mice exposed to high-ft diet. Forced expression of IKKβ in the CNS interrupted leptin nd insulin signling, resulting in incresed intke of high-ft food nd weight gin, trgeted disruption of IKKβ in the hypothlmus lowered food intke nd protected mice from obesity (28). IKKβ ctivity in the CNS ws ssocited with ugmented IL-6 production, nd cytokine signling, suggesting tht NF-KB trget genes medite the metbolic chnges observed in the CNS of IKKβ. Severl reports hve linked over nutrition with stressed protein ssembly pthwys in the ER leding to inflmmtion nd even the development of heptic insulin resistnce(29). The inhibitory effect of olive oil polyphenol compounds on NF-kB nd TNFR1 protein level, this result highlights the inhibitory effect of olive oil on the destructive inflmmtory process,(20). Regrding the effect of hydroxytyrosol in NF-KB ttenution reserch ws reched conclusion tht phenolic compounds of olive oil prevent the blood-brin brrier integrity by suppressing free rdicls, NF- KB ctivity nd mtrix metlloproteinse-9 expression (30). REFERENCES 1. FUNG, T. T., RIMM, E. B., SPIEGELMAN, D., RIFAI, N., TOFLER, G. H., WILLETT, W. C. & HU, F. B. Assocition between dietry ptterns nd plsm biomrkers of obesity nd crdiovsculr disese risk. The Americn journl of clinicl nutrition, 2001, 73, YAMAMOTO, T., TAKABATAKE, Y., TAKAHASHI, A., KIMURA, T., NAMBA, T., MATSUDA, J., MINAMI, S., KAIMORI, J.-Y., MATSUI, I. & MATSUSAKA, T. High-ft dietinduced lysosoml dysfunction nd impired utophgic flux contribute to lipotoxicity in the kidney. Journl of the Americn Society of Nephrology, ASN DESPRÉS, J. P. Is viscerl obesity the cuse of the metbolic syndrome? Annls of medicine, 2006, 38, LOBO, V., PATIL, A., PHATAK, A. & CHANDRA, N. Free rdicls, ntioxidnts nd functionl foods: Impct on humn helth. Phrmcognosy reviews, 2010, 4, KOUKA, P., PRIFTIS, A., STAGOS, D., ANGELIS, A., STATHOPOULOS, P., XINOS, N., SKALTSOUNIS, A. L., MAMOULAKIS, C., TSATSAKIS, A. M. & SPANDIDOS, D. A. Assessment of the ntioxidnt ctivity of n olive oil totl polyphenolic frction nd hydroxytyrosol from Greek Ole europe vriety in endothelil cells nd myoblsts. Interntionl journl of moleculr medicine, 2017, 40, PEYROL, J., RIVA, C. & AMIOT, M. J. Hydroxytyrosol in the prevention of the metbolic syndrome nd relted disorders. Nutrients, 2017, 9, TANAKA, S., TAKEHASHI, M., MATOH, N., IIDA, S., SUZUKI, T., FUTAKI, S., HAMADA, H., MASLIAH, E., SUGIURA, Y. & UEDA, K. Genertion of rective oxygen species nd ctivtion of NF κb by non Aβ component of Alzheimer's disese myloid. Journl of neurochemistry, 2002, 82, HAYDEN, M. S. & GHOSH, S. Shred principles in NF-κB signling. Cell, 2008, 132, CRANFORD, T. L., ENOS, R. T., VELÁZQUEZ, K. T., MCCLELLAN, J. L., DAVIS, J. M., SINGH, U. P., NAGARKATTI, M., NAGARKATTI, P. S., ROBINSON, C. M. & MURPHY, E. A. Role of MCP-1 on inflmmtory processes nd metbolic dysfunction following high-ft feedings in the FVB/N strin. Interntionl Journl of Obesity, 2016, 40, MIAO, H., ZHAO, Y.-H., VAZIRI, N. D., TANG, D.-D., CHEN, H., CHEN, H., KHAZAELI, M., TARBIAT-BOLDAJI, M., HATAMI, L. & ZHAO, Y.-Y. Lipidomics biomrkers of dietinduced hyperlipidemi nd its tretment with Pori cocos. Journl of griculturl nd food chemistry, 2016, 64, ZHANG, X., CAO, J., JIANG, L. & ZHONG, L. Suppressive effects of hydroxytyrosol on oxidtive stress nd nucler fctor-κb ctivtion in THP-1 cells. Biologicl nd Phrmceuticl Bulletin, 2009b 32, KNOTT, C., STERN, G. & WILKIN, G. Inflmmtory regultors in Prkinson's disese: inos, lipocortin-1, nd cyclooxygenses-1 nd- 2. Moleculr nd Cellulr Neuroscience, 2000, 16, FKI, I., SAHNOUN, Z. & SAYADI, S. Hypocholesterolemic effects of phenolic extrcts nd purified hydroxytyrosol recovered from olive mill wstewter in rts fed cholesterol-rich diet. Journl of griculturl nd food chemistry, 2007, 55, SCHAFFER, S., PODSTAWA, M., VISIOLI, F., BOGANI, P., MÜLLER, W. E. & ECKERT, G. P. Hydroxytyrosol-rich olive mill 2452

6 wstewter extrct protects brin cells in vitro nd ex vivo. Journl of griculturl nd food chemistry, 2007, 55, PISTELL, P. J., MORRISON, C. D., GUPTA, S., KNIGHT, A. G., KELLER, J. N., INGRAM, D. K. & BRUCE-KELLER, A. J. Cognitive impirment following high ft diet consumption is ssocited with brin inflmmtion. Journl of neuroimmunology, 2010, 219, BAKER, R. G., HAYDEN, M. S. & GHOSH, S. NF-κB, inflmmtion, nd metbolic disese. Cell metbolism, 2011, 13, LIVAK, K. J. & SCHMITTGEN, T. D. Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the 2 ΔΔCT method. methods, 2001, 25, FISCHER, R. & MAIER, O. Interreltion of oxidtive stress nd inflmmtion in neurodegenertive disese: role of TNF. Oxidtive medicine nd cellulr longevity, GUILLEMOT-LEGRIS, O., MASQUELIER, J., EVERARD, A., CANI, P. D., ALHOUAYEK, M. & MUCCIOLI, G. G. High-ft diet feeding differentilly ffects the development of inflmmtion in the centrl nervous system. Journl of neuroinflmmtion, 2016, 13, MARDOOKHI, J., BIGDELI, M. R. & KHAKSAR, S. The effect of pre-tretment with olive oil on TNFR1/NF-кB inflmmtory pthwy in rt ischemic stroke model. Physiology nd Phrmcology, 2016, 20, SARTIPY, P. & LOSKUTOFF, D. J. Monocyte chemottrctnt protein 1 in obesity nd insulin resistnce. Proceedings of the Ntionl Acdemy of Sciences, 2003, 100, TABERNERO, M., SARRIÁ,B., LARGO, C., MARTÍNEZ- LÓPEZ, S., MADRONA, A., ESPARTERO, J. L., BRAVO, L. & MATEOS, R. Comprtive evlution of the metbolic effects of hydroxytyrosol nd its lipophilic derivtives (hydroxytyrosyl cette nd ethyl hydroxytyrosyl ether) in hypercholesterolemic rts. Food & function, 2014, 5, DENKE, M. A. Role of beef nd beef tllow, n enriched source of steric cid, in cholesterol-lowering diet. The Americn journl of clinicl nutrition, 1994, 60, 1044S-1049S. 24. FOTSCHKI, B., JURGONSKI, A., JUSKIEWICZ, J. & ZDUNCZYK, Z. Metbolic effects of dietry pple seed oil in rts. Żywność Nuk Technologi Jkość, 2015, FITó, M., CLADELLAS, M., DE LA TORRE, R., MARTI, J., ALCáNTARA, M., PUJADAS-BASTARDES, M., MARRUGAT, J., BRUGUERA, J., LóPEZ-SABATER, M. & VILA, J. Antioxidnt effect of virgin olive oil in ptients with stble coronry hert disese: rndomized, crossover, controlled, clinicl tril. Atherosclerosis, 2005, 181, MASQUIO, D., DE PIANO, A., CAMPOS, R., SANCHES, P., CARNIER, J., CORGOSINHO, F., NETTO, B., CARVALHO FERREIRA, J., OYAMA, L. & OLLER DO NASCIMENTO, C. Reduction in sturted ft intke improves crdiovsculr risks in obese dolescents during interdisciplinry therpy. Interntionl journl of clinicl prctice, 2015, 69, RICCIONI, G., GAMMONE, M. A., CURRENTI, W. & D ORAZIO, N. Effectiveness nd Sfety of Dietetic Supplementtion of New Nutrceuticl on Lipid Profile nd Serum Inflmmtion Biomrkers in Hypercholesterolemic Ptients. Molecules, 2018, 23, ZHANG, X., ZHANG, G., ZHANG, H., KARIN, M., BAI, H. & CAI, D. Hypothlmic IKKβ/NF-κB nd ER stress link overnutrition to energy imblnce nd obesity. Cell, 2008, 135, OZCAN, L., ERGIN, A. S., LU, A., CHUNG, J., SARKAR, S., NIE, D., MYERS, M. G. & OZCAN, U. Endoplsmic reticulum stress plys centrl role in development of leptin resistnce. Cell metbolism, 2009, 9, SHARMA, H. S., DRIEU, K., ALM, P. & WESTMAN, J. Role of nitric oxide in blood-brin brrier permebility, brin edem nd cell dmge following hyperthermic brin injury. An experimentl study using EGB-761 nd Gingkolide B pretretment in the rt. Brin Edem XI. Springer WELLEN, K. E. & THOMPSON, C. B. Cellulr metbolic stress: considering how cells respond to nutrient excess. Moleculr cell, 2010, 40,