The role of insulin and glucose in goose primary hepatocyte triglyceride accumulation

Transcription

1 1553 The Journl of Experimentl Biology 212, Pulished y The Compny of Biologists 2009 doi: /je The role of insulin nd glucose in goose primry heptocyte triglyceride ccumultion Chunchun Hn, Jiwen Wng*, Ling Li, Zhongxin Zhng, Li Wng nd Zhixiong Pn Key L of Animl Genetic Resources, College of Animl Science nd Technology, Sichun Agriculturl University, Y n, Sichun , P.R.C. *Author for correspondence (e-mil: wjw @163.com) Accepted 10 Mrch 2009 SUMMARY In order to otin some informtion on how ftty liver rises in geese, we investigted the role of insulin nd glucose in triglyceride (TG) ccumultion in goose primry heptocytes. Goose primry heptocytes were isolted nd treted with insulin nd glucose. Compred with the control group, 100 nd 150 nmol l 1 insulin incresed TG ccumultion, cetyl-coa croxylseα (ACCα) nd ftty cid synthse (FAS) ctivity, nd the mrna levels of sterol regultory element-inding protein-1 (), FAS nd ACCα genes. Insulin t 200 nmol l 1 hd n inhiiting effect on TG ccumultion nd the ctivity of ACC nd FAS, ut incresed the gene expression of, FAS nd ACCα. We lso found tht high glucose (30 mmol l 1 ) incresed the TG level, ACC nd FAS ctivity, nd the mrna levels of nd FAS. However, there ws no effect of high glucose on ACCα mrna level. In ddition, the interction etween insulin nd glucose ws oserved to induce TG ccumultion, ACC nd FAS ctivity, nd gene expression of, FAS nd ACCα, nd increse nucler protein level nd inding of nucler nd the SRE response element of the ACC gene. The result lso indicted tht the glucose-induced TG ccumultion decresed fter 96 h when the heptocytes were cultured with 30 mmol l 1 glucose. In conclusion, insulin nd glucose my ffect heptic lipogenesis y regulting lipogenic gene expression nd lipogenic enzyme ctivity in goose heptocytes, nd might ply n importnt role in the synergetic ctivtion of lipogenic genes. We propose tht the utiliztion of ccumulted TG in heptocytes is the reson for the reversile phenomenon in goose heptocellulr stetosis. Key words: glucose, goose primry heptocytes, insulin, triglyceride ccumultion. INTRODUCTION Under nturl conditions, irds, especilly some wild wterfowl, re more likely to show non-pthologicl heptic stetosis s result of energy storge efore migrtion (Pilo nd George, 1983). In the cse of pthologicl stetosis, the liver cells hve degenertive lesions tht re generlly irreversile. During non-pthologicl heptic stetosis, the functionl integrity of the liver cells remins intct, nd cellulr hypertrophy is totlly reversile (Bilé et l., 1996; Bilé et l., 1998; Bénrd nd Lie, 1998; Bénrd et l., 1998). In order to find the mechnism of occurrence of ftty liver, some reserchers hve studied the heptic stetosis of wterfowl, focusing on the synthesis nd secretory pthwy of heptic lipoprotein, ut there hs een no report out the pthwy of de novo synthesis of ftty cids. De novo ftty cid synthesis in liver is regulted y insulin nd glucose (Koo et l., 2001; Stoeckmn nd Towle, 2002). The lipogenic genes [including cetyl-coa croxylse-α (ACCα) nd ftty cid synthse (FAS)] re ctivted y comined effect of glucose nd insulin in ctivting sterol regultory element-inding protein-1 () (Koo et l., 2001; Dentin et l., 2004). Two isoforms of SREBP hve een identified in mmmls: nd c. In chicken, however, only one form of ws oserved, which ws similr to the in mmmls (Zhng nd Hillgrtner, 2004). Previous studies hve shown tht c expression itself cn only prtly explin the glucose/insulin induction of lipogenic genes in primry cultured heptocytes (Koo et l., 2001; Dentin et l., 2004; Stoeckmn nd Towle, 2002; Dentin et l., 2005). The trnscriptionl induction of ACCα nd FAS genes requires oth glucose nd insulin (Dentin et l., 2005; Foufelle nd Ferre, 2000). Thus, in order to understnd the mechnism of heptic stetosis, it is importnt to elucidte the role of insulin nd glucose in triglyceride (TG) ccumultion in wterfowl. Sichun white goose (Anser cygnoides) hs moderte cpility to produce ftty liver, nd it is suitle s model system to understnd the regultion of lipogenesis y insulin nd glucose. We therefore isolted primry heptocytes in Sichun white geese s the experimentl mteril. The present study ws designed to investigte the regultion of lipogenesis y insulin nd glucose in heptocytes, which could e reflected y the effect of insulin nd glucose on the ccumulted lipids, ACC nd FAS ctivity, the mrna expression of, FAS nd ACCα, nd the inding of nucler nd the SRE response element of the ACC gene. MATERIALS AND METHODS Primry heptocyte isoltion nd culture Heptocytes were isolted from three 10dy old Sichun white geese (Anser cygnoides Linneus 1758) from the Experimentl Frm for Wterfowl Breeding t Sichun Agriculturl University y modifiction of previous method (Seglen, 1976). Freshly isolted heptocytes were diluted to cellsml 1. The culture medium ws composed of DMEM (contining 4.5gl 1 glucose; Gico, Githersurg, MD, USA) with 100IUl 1 insulin (Sigm, St Louis, MO, USA), 100IUml 1 penicillin (Sigm), 100mgml 1 streptomycin (Sigm), 2mmoll 1 glutmine (Sigm) nd 100mll 1 fetl ovine

2 1554 C. Hn nd others serum (Clrk, Tsmni, Austrli). The heptocytes were then plted in 60mm culture dishes t cells per dish for the preprtion of totl RNA nd nucler extrcts, nd plted in 24- well pltes t cells per well for mesurement of TG level nd ACC nd FAS ctivity. Cultures were incuted t 40 C in humidified tmosphere contining 5% CO 2, with medium renewed fter 3 h, followed y serum-free medium, renewed fter 24 h. After nother 24 h, heptocytes were seprtely treted with culture medium supplemented with 50nmoll 1 insulin, 100nmoll 1 insulin, 150 nmol l 1 insulin, 200 nmol l 1 insulin, 5 mmol l 1 glucose, 30mmoll 1 glucose, 50nmoll 1 insulin + 5mmoll 1 glucose, nd 50nmoll 1 insulin + 30mmoll 1 glucose for 48h, while the control smple cells were cultured with serum-free medium for 48 h (serumfree medium ws renewed every 24h). In ech cse the experiments were repeted three times. Isoltion of totl RNA nd rel-time RT-PCR Totl RNA ws isolted from cultured cells using Trizol (Invitrogen, Crlsd, CA, USA), nd reverse trnscried using the PrimerScript TM RT system kit for rel-time PCR (TKR, Otsu, Jpn) ccording to the mnufcturer s instructions. The quntittive rel-time PCR rection mix contined the newly generted cdna templte, SYBR Premix Ex Tq TM, sterile wter, nd primers of the trget genes. Rel-time PCR ws otined on the Cycler system (one cycle of 95 C for 10s, 40 cycles of 95 C for 5s, nd 60 C for 40s). An 80 cycle melt curve ws performed, strting t 55 C nd incresing y 0.5 C every 10 s, to determine primer specificity. Specific primers re listed in Tle 1, designed ccording to the goose gene sequences: the FAS gene sequence ws from GenBnk (GenBnk ccession no. M60622); the nd ACCα genes were sequenced in our l (GenBnk ccession nos EU nd EF990142). Amplicons corresponding to ech trget were exmined y grose gel electrophoresis to confirm the presence of unique nd of the expected size. Negtive controls corresponding to PCR mplifiction with non-reverse trnscried RNA did not generte ny signl. All smples were mplified in duplicte, with the sme PCR mixture nd in the sme 96-well plte. The cycle threshold vrition oserved etween duplictes ws on verge 0.12±0.1, demonstrting high intr-ssy reproduciility. Ech smple ws lso replicted in nother 96-well plte. The vrition of Ct etween two independent pltes ws 0.28±0.22, showing fir interssy reproduciility s well. PCR products were then diluted 16-fold nd were used to generte the clirtion curve nd the mplifiction rte (R) for ech gene (, ACCα, FAS or 18S). For ech experimentl smple, normlized trget gene level (Exp) corresponding to the trget gene expression level reltive to the 18S (house keeping gene) expression level ws determined y the 2 ΔΔCt method s descried previously (Livk nd Sehmittgen, 2001): Exp trget gene = (1 + R trget gene ) Ct(trget gene) / (1 + R 18S ) Ct(18S). (1) For the trget gene expression nlyses, the normlized trget gene expression level for ech smple ws compred with the positive control smple. Therefore, finl results re expressed s N-fold differences in normlized trget gene expression level etween ech treted nd control smple. Preprtion of heptocyte nucler extrcts Nucler extrcts were prepred y modified version of procedure descried previously (Azzout-Mrniche et l., 2000). Briefly, cultured heptocytes in 60 mm pltes were scrped into PBS, comined, nd centrifuged t 1000g for 3min. The cell pellet ws resuspended in 2ml of lysis uffer (10mmoll 1 Tris-HCl, 0.3moll 1 sucrose, 10mmoll 1 NCl, 3mmoll 1 MgCl 2, 0.5% Nonidet P40, 50gml 1 clpin inhiitor I, 1mmoll 1 PMSF, 2gml 1 protinin nd 10gml 1 leupeptin). After 15min on ice, nuclei were pelleted y 10min centrifugtion (500g) t 4 C nd wshed once in the sme uffer. The nucler pellet ws resuspended in 1 ml of hypertonic uffer (10mmoll 1 Hepes, ph7.4, 0.42moll 1 NCl, 1.5mmoll 1 MgCl 2, 2.5% glycerol, 1 mmol l 1 EDTA, 1 mmol l 1 EGTA, 1mmoll 1 dithiothreitol, nd the sme protese inhiitors listed for the lysis uffer). After 30min on ice, the nucler extrct ws otined y centrifugtion t 100,000g for 30min t 4 C. Protein content ws determined y spectrophotometry using Bio-Rd protein ssy regent with ovine serum lumin s stndrd. protein nlysis y western lotting Aliquots of nucler proteins (40 μg for cell extrcts) were seprted y 10% SDS-PAGE nd trnsferred to PVDF memrne. Memrnes were then incuted with mouse nti- monoclonl ntiody (L Vision Corportion, Fremont, CA, USA). The primry ntiody ws used t concentrtion of 4gml 1. Signls were detected using n ECL western lot detection kit (Snt Cruz Biotechnology, Snt Cruz, CA, USA) nd got nti-mouse horserdish peroxidseconjugted IgG (Snt Cruz Biotechnology) s the secondry ntiody. After nlysis, the memrnes were stripped with Re-Blot Plus solution (Chemicon Interntionl, Temecul, CA, USA) nd lotted with α-tuulin ntiody (TU-02, Snt Cruz Biotechnology) to normlize for protein level. The lot imges were digitized with luminescent imge nlyser (LAS-1000, Fuji Photo Film). Electrophoretic moility shift ssy EMSA ws performed s descried previously (Bord et l., 2005). The doule-strnded DNA frgment (5 -TCGCATCAC- ACCACCGCGG-3 ) contining the SRE response element of the ACC gene ws 5 -end lelled with γ-p 32 ATP using T4 polynucleotide kinse. A typicl rection contined 100,000 c.p.m. (10 20 fmol) of 32 P-lelled oligonucleotide nd 4 μg nucler protein; 2mg of poly(dizdc) nd 1.9mg of poly(dazdt) were used s non-specific competitors for the EMSAs. Following incution t room temperture for 30 min, smples were sujected to electrophoresis on 4.5% non-denturing polycrylmide gel nd imged y PhosphorImger nlysis. ntiody ws dded to nucler protein for 20min t 4 C prior to the ddition of the proe. For competitive inding, 10-, 25- or 50-fold molr excess of unlelled oligonucleotide ws dded together with rdiolelled proe prior to the incution. Tle 1. PCR primers Gene Upstrem primer (5 3 ) Downstrem primer (5 3 ) Product size (p) CGAGTACATCCGCTTCCTGC TGAGGGACTTGCTCTTCTGC 92 FAS TGGGAGTAACACTGATGGC TCCAGGCTTGATACCACA 109 ACCα TGCCTCCGAGAACCCTAA AAGACCACTGCCACTCCA 163, sterol regultory element-inding protein-1; ACCα, cetyl CoA croxylse-α; nd FAS, ftty cid synthse.

3 Effects of insulin nd glucose 1555 Tle 2. TG ccumultion, nd ACC nd FAS ctivity in goose primry heptocytes fter tretment with insulin or glucose Insulin (nmol l 1 ) Glucose (mmol l 1 ) TG ccumultion (mmol l 1 ) FAS ctivity* ACC ctivity ±0.064 c 169.0±7.211 d ±9.98 c ±0.014 c 181.3± d ±10.49 c ± ± c ± ± ± ± ±0.113 d 121.3±5.508 e 86.61±8.23 d ±0.050 c 189.7± d ±10.25 c ± ± ±10.31 c ± ± ± ± ± ±11.18 TG, triglyceride. *Activity given s nmoles of sustrte (NADPH) trnsformed to NADP per min per mg of cytosolic protein; nmoles of sustrte (H[ 14 C]O 3 ) fixed to mlonyl CoA per min per g of cytosolic protein. Different lowercse letters in the sme rry indicte significnt difference etween tretments (P<0.05). After 24 h in serum-free medium, heptocytes were incuted for 48 h either with no ddition s control or with 50 nmol l 1 insulin, 100 nmol l 1 insulin, 150 nmol l 1 insulin, 200 nmol l 1 insulin, 5 mmol l 1 glucose, 30 mmol l 1 glucose, 50 nmol l 1 insulin + 5 mmol l 1 glucose or 50 nmol l 1 insulin + 30 mmol l 1 glucose dded. The stndrd culture medium contined 25 mmol l 1 glucose efore dditions. Mesurement of TG ccumultion, nd ACC nd FAS ctivity Smples of cultured cells for ech tretment were shken for 1h using n ultrsonic processor, then wshed three times with icecold phosphte-uffered sline nd dded to n isovolumic mixture of chloroform nd methnol (2:1, v/v). The TG level ws quntified y colorimetric enzymtic method (Fossti nd Prencipe, 1982) using Triglyceride GPO-POD ssy kit (Biosino, Beijing, Chin). The ssy for FAS ctivity ws performed ccording to Ingle et l. (Ingle et l., 1973), with some modifictions. The FAS ctivity ws clculted from the rte of trnsformtion of NADPH to NADP in incutions contining sustrte, cofctors nd cell smples, y spectrophotometry t 340nm. The concentrtion of the regents ws: 40 mmol l 1 potssium phosphte uffer plus EDTA (ph 6.8), 0.1mmoll 1 mlonyl CoA, 0.1mmoll 1 cetyl-coa, 0.3mmoll 1 NADPH nd 0.4mmoll 1 dithiothreitol. ACC ctivity ws mesured s descried previously (Mjerus et l., 1968) with sustntil modifictions. The concentrtion of regents ws: 60mmoll 1 Tris- HCl, ph7.50, 2.1mmoll 1 ATP, 5mmoll 1 MgCl 2, 0.15mmoll 1 cetyl-coa, 1.2mmoll 1 β-mercptoethnol, 1mgml 1 ftty cidfree ovine serum lumin, 18 mmol l 1 NH[ 14 C]O 3 (specific ctivity 0.5 mcimmoll 1 ) nd 10mmoll 1 sodium citrte. The ssy ws terminted y the ddition of 1/6 volumes of 10% perchloric cid. An liquot of the protein-free superntnt ws dried in counting vil under hir dryer, then the residue ws dissolved in smll volume of wter nd scintilltion fluid ws dded. ACC ctivity is expressed s nmoles of sustrte (H[ 14 C]O 3 ) fixed to mlonyl CoA per min per g of cytosolic protein t 37 C. Protein concentrtion in the homogente ws determined y the Biuret method using ovine serum lumin s stndrd, nd ctivities re expressed s nmolesmin 1 mg 1 of cytosolic protein. Anlyses were performed in duplicte. Sttisticl nlysis The dt were sujected to ANOVA nd the mens were compred for significnce y Tukey s test. Anlysis of vrince nd t-test were performed using the SAS 6.12 pckge (SAS Institute, Cry, NC, USA). Results re presented s mens ± s.d. RESULTS Effect of glucose nd insulin on TG ccumultion, nd on ACC nd FAS ctivity As shown in Tle2, 100 nd 150nmoll 1 insulin could induce TG ccumultion, ut 200mmoll 1 insulin hd mrked inhiitory effect. High glucose (30mmoll 1 ) hd significnt effect on TG ccumultion (P<0.05). However, low glucose (5mmoll 1 ) hd no effect. When cultured with 50nmoll 1 insulin nd low glucose (5mmoll 1 ) for 48h, the TG ccumultion in heptocytes incresed significntly (P<0.05), nd when cultured with 50nmoll 1 insulin nd high glucose (30mmoll 1 ) the effect ws even stronger (P<0.05). Compred with the control group, Tle 2 shows tht t nmoll 1 insulin incresed FAS ctivity, with 150nmoll 1 insulin hving the gretest effect (P<0.05). Low (5mmoll 1 ) glucose hd no effect on FAS ctivity, ut high (30mmoll 1 ) glucose hd significnt effect (P<0.05). Low glucose nd 50nmoll 1 insulin cultured together hd n evident effect (P<0.05) on FAS ctivity, nd high glucose nd 50nmoll 1 insulin together incresed FAS ctivity too (P<0.05). Tle2 shows tht 100nmoll 1 nd 150nmoll 1 insulin oth incresed (P<0.05) ACC ctivity, nd 200nmoll 1 insulin hd n inhiitory effect (P<0.05). Low nd high glucose oth hd no effect on ACC ctivity, ut ACC ctivity could e up-regulted (P<0.05) y oth low nd high glucose together with 50nmoll 1 insulin. TG concentrtion (mmol l 1 ) c c c c Control group 30 mmol l 1 glucose group Time fter dding 30 mmol 1 glucose (h) Fig. 1. Triglyceride (TG) ccumultion in geese heptocytes fter 0 96 h in the presence of 30 mmol l 1 glucose or no glucose s control. Different lowercse letters indicte significnt difference etween tretments (P<0.05). After 24 h in serum-free medium, heptocytes were incuted in the presence of 30 mmol l 1 glucose or no glucose (control) for 24, 48, 72 nd 96 h. d e,c

4 1556 C. Hn nd others Reltive mrna level c c e e e e e e d d d d d Concentrtion of insulin (nmol l 1 ) Fig. 2. Reltive mrna levels of, ACCα nd FAS in goose primry heptocytes treted with different concentrtions of insulin. Different lowercse letters indicte significnt difference etween tretments (P<0.05). After 24 h in serum-free medium, heptocytes were incuted for 72 h either with no ddition s control or in the presence of 50, 100, 150 or 200 nmol l 1 insulin. Fig. 1 shows tht TG ccumultion incresed 24 h fter 30mmoll 1 glucose ddition, reching the highest level fter 48h. After 72h, TG ccumultion decresed, returning to the control level fter 96h. The chnge of TG ccumultion in the control group ws different from tht of the tretment group, nd the TG concentrtion decresed fter 48h in the control group. Regultion of gene expression y insulin in goose primry heptocytes Fig.2 shows tht the regultion of, FAS nd ACCα gene expression ws similr. Insulin t 0 50nmoll 1 hd no evident effect on the mrna level of the three genes. The gene expression ws up-regulted y 100nmoll 1 insulin nd reched mximum t 150nmoll 1, followed y decrese t 200nmoll 1. Glucose nd insulin regulte the mrna expression of nd lipogenic genes Tle 3 presents the synergetic effect of insulin nd glucose on the mrna expression of, FAS nd ACCα y quntittive rel-time PCR nlysis. Low glucose did not hve significnt effect on the mrna expression level of nd FAS, ut high glucose hd significnt effects on the mount of nd FAS mrna. However, neither low nor high glucose hd n evident effect on ACCα mrna level. Insulin t 50nmoll 1 nd low glucose together hd significnt stimultory effect on expression of the three genes, nd 50nmoll 1 insulin nd high glucose together hd the gretest effect. ACC FAS Synergetic effects of glucose nd insulin on trnsltion To determine whether glucose nd insulin ffect trnsltion, goose heptocytes were exposed to glucose nd insulin for 48h. Fig.3 shows the effects of glucose nd insulin on SREBP- 1 protein expression. After incution with 50nmoll 1 insulin or 5mmoll 1 glucose there ws no evident effect, ut significnt increse in protein level induced y 50nmoll 1 insulin plus 5mmoll 1 glucose ws oserved. To confirm the role of in mediting lipogenic gene expression induced y glucose nd insulin in heptocytes, n EMSA ws performed to detect whether the DNA inding ffinity of incresed fter cells were cultured with glucose nd insulin for 48h. As shown in Fig.4, inding of the nucler SREBP- 1 to the ACCα SRE sequence ws induced y 50nmoll 1 insulin plus 5mmoll 1 glucose. DISCUSSION In mmmls, severl studies hve shown tht insulin my ctivte the trnscription of, FAS nd ACCα (Azzout-Mrniche et l., 2000; Fleischmnn nd Iynedjin, 2000; Becrd et l., 2001; Foretz et l., 1999; Mtsumoto et l., 2002), ut n inconsistent report in chicken showed no effect of insulin on ACCα mrna level (Zhng et l., 2003). In the present study, we found tht insulin ffected the mrna expression level of, ACCα nd FAS in goose primry heptocytes. In prticulr, ws upregulted 1000 times y 150nmoll 1 insulin compred with controls, which ws rrely found in other species. The gret induction of mrna expression indictes tht my e the min pthwy of lipogenesis induced y insulin in geese. In ddition, TG ccumultion, nd ACC nd FAS ctivity were stimulted y insulin. In mmmls, insulin is the min hormone regulting the expression of, nd it ws found to not only induce the trnscription of ut lso stimulte the development of the mture form of, nd so modulte heptic lipogensis (Foretz et l., 1999; Shimomur et l., 1999). Our results indicte tht, consistent with the cse in mmmls, insulin my induce lipogenesis in goose liver y regulting the expression of nd lipogenic enzyme genes. Compred with 150nmoll 1 insulin, 200nmoll 1 insulin hd n inhiitory effect on TG ccumultion, ACC nd FAS ctivity, nd mrna expression of, ACCα nd FAS, which my e the result of the high concentrtion of insulin exceeding the tolernce of goose heptocytes, leding to decrese in insulin sensitivity, nd n increse in resistnce to insulin. With respect to the influence of glucose on the expression of nd lipogenic enzymes, previous studies hve shown inconsistent findings. Some investigtors hve reported tht glucose ctivted expression in mouse heptocyte cell line (Hsty et l., 2000), wheres others found tht in primry rt heptocytes Tle 3. Reltive mrna levels in goose primry heptocytes treted with insulin nd glucose Insulin (nmol l 1 ) Glucose (mmol l 1 ) ACCα FAS 0 0 1±0.004 c 1±0.009 c 1±0.008 d ±0.106 c 1.74±0.014 c 1.16±0.027 d ± ±0.004 c 59.10± ± ± ±0.071 c ± ± ±7.771 Different lowercse letters in the sme row indicte significnt difference etween tretments (P<0.05). After 24 h in serum-free medium, heptocytes were incuted for 48 h with either no ddition s control or 5 mmol l 1 glucose, 30 mmol l 1 glucose, 50 nmol l 1 insulin + 5 mmol l 1 glucose, 50 nmol l 1 insulin + 30 mmol l 1 glucose. The stndrd culture medium contined 25 mmol l 1 glucose efore dditions.

5 Effects of insulin nd glucose 1557 Reltive protein level A B C D A B C D nd rt livers glucose potentited the effect of insulin on SREBP- 1c expression ut hd no effect in the sence of insulin (Shimomur et l., 1999; Foretz et l., 1999). Recently, Mtsuzk nd collegues demonstrted tht t lest prt of the controversy proly results from species differences, nd glucose cn ctivte expression of c in mouse liver independent of insulin, wheres the ctivtion of c expression y glucose in rt liver is very limited in the sence of insulin (Mtsuzk et l., 2004). The current study shows tht glucose is the min inducer of heptic lipogenesis. The increse in TG ccumultion nd FAS ctivity induced y glucose ws more evident thn tht y insulin. We compred TG ccumultion, FAS ctivity, nd mrna expression of, ACCα nd FAS of goose primry heptocytes cultured in either low or high glucose-contining medium. It is likely tht culture in medium contining low glucose might e comprle with norml feeding conditions. In contrst, when cells were cultured in the presence of high glucose, TG ccumultion, nd c nd FAS levels incresed significntly, which might e equivlent to n overfeeding sitution α-tuulin Fig. 3. Immunolot nlysis of nucler in goose heptocyte nucler extrcts treted with insulin nd glucose. (A) control, (B) 50 nmol l 1 insulin, (C) 5 mmol l 1 glucose, (D) 50 nmol l 1 insulin + 5 mmol l 1 glucose. After 24 h in serum-free medium, heptocytes were incuted for 48 h with insulin nd glucose. The stndrd culture medium contined 25 mmol l 1 glucose efore dditions. Ech lot is representtive of two independent experiments. Different lowercse letters indicte differences etween tretments (P<0.05). A B C D Non-specific nd Free proe Fig. 4. EMSA performed with goose heptocyte nucler extrcts treted with insulin nd glucose. (A) control, (B) 50 nmol l 1 insulin, (C) 5 mmol l 1 glucose, (D) 50 nmol l 1 insulin + 5 mmol l 1 glucose. After 24 h in serumfree medium, heptocytes were incuted for 48 h with insulin nd glucose. The stndrd culture medium contined 25 mmol l 1 glucose efore dditions. Ech lot is representtive of two independent experiments. (Kim nd Freke, 1996; Zhng nd Hillgrtner, 2004). The TG ccumultion returned to the control level 96h fter 30mmoll 1 glucose ddition. This is very similr to the reversile phenomenon. When the energy level is insufficient, TG is hydrolysed to supply the energy required y the liver. So the utiliztion of ccumulted TG in heptocytes is the reson for the reversile phenomenon in goose heptocellulr stetosis. In greement with this, the current study indicted tht glucose in excess is responsile for inducing ftty liver in geese. Glucose nd insulin disply mrked synergism in lipogenesis in mmmls (Koo et l., 2001; Vulont et l., 2000), nd our results in goose primry heptocytes re consistent with these previous findings; insulin could increse glucose uptke nd utiliztion. In the presence of insulin, low glucose incresed TG ccumultion, ACC nd FAS ctivity, expression of, ACCα nd FAS genes, nd the protein level of nucler. In the presence of insulin, the effect of high glucose reched mximum. The EMSA results indicted tht might ply role in the synergetic ctivtion of lipogenic genes induced y glucose nd insulin. One potentil explntion for the mximum effect requiring oth insulin nd high glucose could e linked to the fct tht the glucose cron toms re orientted towrds lipid synthesis only if glucose is prticulrly undnt. This is consistent with our previous study tht the plsm concentrtions of glucose nd insulin were oth higher in Lndes geese, which hve more ftty liver thn norml geese (Hn et l., 2008). It is indicted tht the metolism of insulin nd glucose re closely relted to lipogenesis, nd upsetting their metolic lnce my ffect the regultion of, ACCα nd FAS gene expression, nd result in the ccumultion of lipids in heptocytes nd so cuse heptocellulr stetosis. In conclusion, we found tht oth insulin nd glucose could induce the mrna expression of nd severl lipogenic genes, nd stimulte ACC nd FAS ctivity, which my relte to the elevted ccumultion of TG in heptocytes. In ddition, glucose my ffect heptocellulr lipogenesis through the interction with insulin. Our results indicte tht the ctivtion of ACCα nd other downstrem trgets y insulin nd glucose in goose primry heptocytes is likely to e secondry to the stimultion y. ACCα FAS TG LIST OF ABBREVIATIONS cetyl-coa croxylse-α. ftty cid synthse sterol regultory element-inding protein-1 triglyceride We re grteful to Ji-Rong Long from Vnderilt University (USA) for her help in revising the mnuscript. The work ws supported y Ntionl Science nd Technology support progrmmes of Chin (2008BADB2B08). REFERENCES Azzout-Mrniche, D., Becrd, D., Guichrd, C., Foretz, M., Ferre, P. nd Foufelle, F. (2000). Insulin effects on sterol regultory-element-inding protein-1c (c) trnscriptionl ctivity in rt heptocytes. J. Biol. Chem. 350, Bilé, R., Auvergne, A., Andrde, V., Hérut, F., Bénrd, G., Bouillier-Oudot, M. nd Mnse, H. (1996). Réversiilité de l stétose héptique chez le cnrd mulrd. In 2èmes Journées de l recherche sur les Plmipèdes à Foie grs, pp Bordeux: ITAVI. Bilé, R., Auvergne, A., Duois, J. P., Bénrd, G. nd Mnse, H. (1998). Réversiilité de l stétose héptique chez l oie. In 3èmes Journées de l recherche sur les Plmipèdes à Foie grs, pp Bordeux: ITAVI. Becrd, D., Hinult, I., Azzout-Mrniche, D., Bertry-Coussot, L., Ferre, P. nd Foufelle, F. (2001). Adenovirus-medited overexpression of sterol regultory element-inding protein-1c mimics insulin effects on heptic gene expression nd glucose homeostsis in dietic mice. Dietes 50, Bénrd, G. nd Lie, C. (1998). Evolution histologique du foie des plmipèdes u cours du gvge. In 3èmes Journées de l recherche sur les Plmipèdes à Foie grs, pp Bordeux: ITAVI.

6 1558 C. Hn nd others Bénrd, G., Bénrd, P., Prehn, D., Bengone, T., Jouglr, J. Y. nd Durnd, S. (1998). Démonstrtion de le réversiilité de l stétose héptique otenue pr gvge de cnrds mulrds. In 3èmes Journées de l recherche sur les Plmipèdes à Foie grs, pp Bordeux: ITAVI. Bord, A., Hinult, I., Ferré, P., Foufelle, F. nd Bossrd, P. (2005). Differentil regultion of sterol regultory element-inding protein 1c trnscriptionl ctivity y insulin nd liver X receptor during liver development. J. Biol. Chem. 280, Dentin, R., Pegorier, J. P., Benhmed, F., Foufelle, F., Ferre, P., Fuveu, V., Mgnuson, M. A., Girrd, J. nd Postic, C. (2004). Heptic glucokinse is required for the synergistic ction of ChREBP nd c on glycolytic nd lipogenic gene expression. J. Biol. Chem. 279, Dentin, R., Girrd, J. nd Postic, C. (2005). Crohydrte respon-sive element inding protein (ChREBP) nd sterol regultory element inding protein-1c (SREBP- 1c): two key regultors of glucose metolism nd lipid synthesis in liver. Biochimie 87, Fleischmnn, M. nd Iynedjin, P. B. (2000). Regultion of sterol regultory-element inding protein 1 gene expression in liver: role of insulin nd protein kinse B/cAkt. J. Biol. Chem. 349, Foretz, M., Guichrd, C., Ferre, P. nd Foufelle, F. (1999). Sterol regultory element inding protein-1c is mjor meditor of insulin ction on the heptic expression of glucokinse nd lipogenesis-relted genes. Proc. Ntl. Acd. Sci. USA 96, Foretz, M., Pcot, C., Dugil, I., Lemrchnd, P., Guichrd, C., Le L. X., Berthelier- Lurno, C., Spiegelmn, B., Kim, J. B., Ferre, P. et l. (1999). ADD1/SREBP- 1c is required in the ctivtion of heptic lipogenic gene expression y glucose. Mol. Cell. Biol. 19, Fossti, P. nd Prencipe, L. (1982). Serum triglycerides determined colorimetriclly with n enzyme tht produces hydrogen peroxide. J. Clin. Chem. 28, Foufelle, F. nd Ferre, P. (2000). New perspectives in the regultion of heptic glycolytic nd lipogenic genes y insulin nd glucose: role for the trnscription fctor sterol regultory element inding protein-1c. J. Biol. Chem. 366, Hn, C. C., Wng, J. W., Xu, H. Y., Li, L., Ye, J. Q., Jing, L. nd Zhuo, W. H. (2008). Effect of overfeeding on plsm prmeters nd mrna expression of genes ssocited with heptic lipogenesis in goose. Asin-ustrls J. Anim. Sci. 21, Hsty, A. H., Shimno, H., Yhgi, N., Kudo, M. A., Perrey, S. nd Yoshikw, T. (2000). Sterol regultory element-inding protein-1 is regulted y glucose t the trnscriptionl level. J. Biol. Chem. 275, Ingle, D. L., Bumn, D. E., Mellenerger, R. W. nd Johnson, D. E. (1973). Lipogenesis in the ruminnt: effect of fsting nd refeeding on ftty cid synthesis nd enzymtic ctivity of sheep dipose tissue, J. Nutr. 103, Kim, T. S. nd Freke, H. C. (1996). High crohydrte diet nd strvtion regulte lipogenic mrna in rts in tissue-specific mnner. J. Nutr. 126, Koo, S. H., Dutcher, A. K. nd Towle, H. C. (2001). Glucose nd insulin function through two distinct trnscription fctors to stimulte expression of lipogenic enzyme genes in liver. J. Biol. Chem. 276, Livk, K. J. nd Sehmittgen, T. D. (2001). Anlysis of reltive gene expression dt using re1-time quntittive PCR nd the 2 -ΔΔCt method. Methods 25, Mjerus, P. W., Jcos, R., Smith, M. B. nd Morris, H. P. (1968). The regultion of ftty cid iosynthesis in rt heptoms. J. Biol. Chem. 243, Mtsumoto, M., Ogw, W., Teshigwr, K., Inoue, H., Miyke, K., Skue, H. nd Ksug, M. (2002). Role of the insulin receptor sustrte 1 nd phosphtidylinositol 3-kinse signling pthwy in insulin-induced expression of sterol regultory element-inding protein 1c nd glucokinse genes in rt heptocytes. Dietes 51, Mtsuzk, T., Shimno, H., Yhgi, N., Amemiy-Kudo, M., Okzki, H., Tmur, Y., Iizuk, Y., Ohshi, K., Tomit, S., Sekiy, M. et l. (2004). Insulin-independent induction of sterol regultory element-inding protein-1c expression in the livers of streptozotocin-treted mice. Dietes 53, Pilo, B. nd George, J. C. (1983). Diurnl nd sesonl vritions in liver glycogen nd ft in reltion to metolic sttus of liver nd m. pectorlis in the migrtory strling. Sturnus roseus, wintering in Indi. Comp. Biochem. Physiol. A 74, Seglen, P. (1976). Preprtion of isolted rt liver cells. Methods Cell. Biol. 13, Shimomur, I., Bshmkov, Y., Ikemoto, S., Horton, J. D., Brown, M. S. nd Goldstein, J. L. (1999). Insulin selectively increses c mrna in the livers of rts with streptozotocin-induced dietes. Proc. Ntl. Acd. Sci. USA 96, Stoeckmn, A. K. nd Towle, H. C. (2002). The role of c in nutritionl regultion of lipogenic enzyme gene expression. J. Biol. Chem. 277, Vulont, S., Khn, A. nd Khn, A. (2000). Glucose regultion of gene trnscription. J. Biol. Chem. 275, Zhng, Y. nd Hillgrtner, F. B. (2004). Strvtion nd feeding high-crohydrte, low-ft diet regulte the expression of sterol regultory element-inding protein-1 in chickens. J. Nutr. 134, Zhng, Y., Yin, L. nd Hillgrtner, F. B. (2003). integrtes the ctions of thyroid hormone, insulin, camp, nd medium-chin ftty cids on ACC{lph} trnscription in heptocytes. J. Lipid. Res. 44,