Dietary fat source alters hepatic gene expression profile and determines the type of liver pathology in rats overfed via total enteral nutrition

Transcription

1 Physiol Genomics 44: , 212. First published September 18, 212; doi:1.1152/physiolgenomics Dietry ft source lters heptic gene expression profile nd determines the type of liver pthology in rts overfed vi totl enterl nutrition M. J. J. Ronis, 1,2,3 J. N. Bumgrdner, 1,2 J. C. Mrecki, 1,3 L. Hennings, 4 X. Wu, 1,3 K. Shnkr, 1,3 M. A. Cleves, 1,3 H. Gomez-Acevedo, 1,3 nd T. M. Bdger 1,3,5 1 Arknss Children s Nutrition Center, University of Arknss for Medicl Sciences, Little Rock, Arknss; 2 Deprtment of Phrmcology & Toxicology, University of Arknss for Medicl Sciences, Little Rock, Arknss; 3 Deprtment of Peditrics, University of Arknss for Medicl Sciences, Little Rock, Arknss; 4 Deprtment of Pthology, University of Arknss for Medicl Sciences, Little Rock, Arknss; nd 5 Deprtment of Physiology & Biophysics, University of Arknss for Medicl Sciences, Little Rock, Arknss Submitted 23 My 212; ccepted in finl form 14 September 212 Ronis MJJ, Bumgrdner JN, Mrecki JC, Hennings L, Wu X, Shnkr K, Cleves MA, Gomez-Acevedo H, Bdger TM. Dietry ft source lters heptic gene expression profile nd determines the type of liver pthology in rts overfed vi totl enterl nutrition. Physiol Genomics 44: , 212. First published September 18, 212; doi:1.1152/physiolgenomics To determine if dietry ft composition ffects the progression of nonlcoholic ftty liver disese (NAFLD), we overfed mle Sprgue-Dwley rts low () or high (7%) ft diets with different ft sources: olive oil (OO), corn oil (CO), or echium oil (EO), with totl enterl nutrition (TEN) for 21 dys. Overfeeding of the CO or EO diets resulted in less stetosis thn OO (P.5). Affymetrix rry nlysis reveled significnt differences in heptic gene expression signtures ssocited with greter ftty cid synthesis, ChREBP, nd SREBP-1c signling nd incresed ftty cid trnsport (P.5) in the OO compred with CO group. The OO groups hd mcrostetosis, but no evidence of oxidtive stress or necrosis. The 7% CO nd 7% EO groups hd mixture of micro- nd mcrostetosis or only microstetosis, respectively; incresed oxidtive stress; nd incresed necrotic injury reltive to their respective groups (P.5). Oxidtive stress nd necrosis correlted with incresing peroxidizbility of the ccumulted triglycerides. Affymetrix rry nlysis compring the 7% OO nd 7% CO groups reveled incresed ntioxidnt pthwys nd lower expression of genes linked to inflmmtion nd fibrosis in the 7% OO group. A second study in which 7% OO diet ws overfed for 5 dys produced no evidence of progression of injury beyond simple stetosis. These dt suggest tht dietry ft type strongly influences the progression of NAFLD nd tht Mediterrnen diet high in olive oil my reduce the risk of NAFLD progressing to nonlcoholic stetoheptitis. nonlcoholic stetoheptitis; ftty cid; lipid peroxidtion; SREBP-1c; ChREBP NONALCOHOLIC FATTY LIVER DISEASE (NAFLD) is incresingly recognized s component of metbolic syndrome, cluster of pthologies ssocited with obesity (16). Chrcterized by initil ft ccumultion (stetosis) in up to 7% of obese ptients (68), NAFLD pthology cn progress to include inflmmtion, poptosis, necrosis, nd fibrosis (nonlcoholic stetoheptitis, NASH) nd ultimtely cirrhosis nd liver cncer (14). While nutrition nd physicl ctivity re clerly mjor fctors in NAFLD development nd progression, the exct role of diet composition in this process remins uncler (14, 4). Address for reprint requests nd other correspondence: M. J. Ronis, Arknss Children s Nutrition Center, 15 Children s Wy, Little Rock, AR, 7222 (e-mil: RonisMrtinJ@ums.edu). Reserch in this re hs been hmpered by lck of n niml model tht mimics the nturl course nd etiologicl bckground of NAFLD observed cliniclly (7, 4). In generl, nutritionlly relevnt models in which obesity hs been chieved s result of d libitum feeding of diets high in sugrs, such s sucrose nd fructose or in sturted fts, hve resulted in simple stetosis with limited evidence of progressive injury (37, 52, 69). Moreover, uncontrolled differences in cloric intke nd species nd strin differences in response to these diets hve resulted in considerble vribility in the reported dt nd difficulties in mechnistic interprettion. These limittions certinly pply to the smll number of studies tht hve exmined the role of ft/crbohydrte rtio or the influence of specific ft components on NAFLD/NASH development (5, 11, 13, 15, 33, 35, 56, 72). To control diet composition nd food intke nd to mke nimls obese by overfeeding, severl groups studying NAFLD/ NASH hve recently turned to intrgstric feeding of liquid diets (7, 8, 18). We hve utilized vrint of this pproch: totl enterl nutrition (TEN) to develop new model for NASH in rts overfed high polyunsturted ft diet with corn oil s the dietry ft source (7). In this model, development of heptic injury ws dietry ft-dose nd time-dependent, nd by 65 dys of overfeeding NASH pthology developed similr to tht observed cliniclly, chrcterized by high levels of oxidtive stress, inflmmtion, nd fibrosis (7, 8). We previously utilized similr TEN model to exmine the effects of diet composition on progression of lcoholic liver injury, which exhibits very similr overll pthology to NASH (29). In those studies (29, 58), we observed tht diets high in crbohydrte-to-ft rtio nd diets high in sturted fts protected ginst the development of lcoholic heptotoxicity, in prt s result of reduced production of rective oxygen species (ROS) by the enzyme CYP2E1 nd in prt s result of reduced susceptibility of heptic lipids to peroxidtion. These dt were similr to those previously published by Nnjii nd coworkers (43, 44, 49), suggesting strong correltion between the degree of unsturtion of dietry ftty cids (FA) nd severity of lcoholic liver injury. The current study ws undertken to determine if similr reltionships exist between dietry ft/crbohydrte rtio nd the type of ft in the development of NAFLD/NASH. We utilized the TEN model to overfeed mle Sprgue-Dwley rts isocloric diets contining three ft sources tht differed in their degree of sturtion. This ws chieved using olive oil (OO, monounsturted, minly 18:1); corn oil (CO, polyunst /12 Copyright 212 the Americn Physiologicl Society 173

2 174 EFFECT OF FATTY ACIDS ON NAFLD urted, minly 18:2), or echium oil (EO, highly polyunsturted, minly 18:3) plnt bsed omeg-3 FA source derived from Echium plntgineum (Viper s bugloss) (1, 76) for 3 wk. The nlysis included body composition, chnges in plsm lipids nd metbolic hormones, liver pthology, heptic gene expression profiles, nd lipid composition. MATERIALS AND METHODS Experimentl nimls nd diets. Mle Sprgue-Dwley rts (175 g) were purchsed from Hrln Sprgue-Dwley (Indinpolis, IN). Animls were housed in n Assocition for Assessment nd Accredittion of Lbortory Animl Cre-pproved niml fcility. Animl mintennce nd experimentl tretments were conducted in ccordnce with the ethicl guidelines for niml reserch estblished nd were pproved by the Institutionl Animl Cre nd Use Committee t the University of Arknss for Medicl Sciences. Rts hd n intrgstric cnnul surgiclly inserted nd were llowed 7 dys to recover before infusion of TEN diets s described previously (7). Animls hd d libitum ccess to wter throughout the experiments. In experiment 1, rts were rndomly ssigned to groups of n 5 6 nd were fed 22 kcl/kg 3/4 /dy diets contining 5 or 7% OO, CO, or EO for 21 dys. Ft ws isocloriclly substituted for crbohydrte clories s described previously such tht ft diets contined 76% crbohydrte nd 7% ft diets contined 11% crbohydrte in the form of 1:3 mltodextrin-dextrose (7, 8). There were six diets, nd ech hd cloric density of 89 kcl/l (isocloric). Protein content (19% in the form of whey) nd vitmin nd minerl content were the sme in ll diets (7). Diets were formulted to meet the cloric nd nutritionl recommendtions estblished by the Ntionl Reserch Council but were fed t level tht exceeded the recommended cloric intke by 17% to increse weight gin nd diposity nd produce stetoheptitis. Body weight gins were mesured twice week nd t the beginning nd end of the study. Totl body ft composition ws ssessed by nucler mgnetic resonnce (Echo, Houston, TX). Rts were killed between 8 nd 1. Serum nd livers were collected nd stored t 2 C nd 7 C, respectively. In experiment 2, n 1 mle rts were fed pelleted AIN-93G control diet d libitum nd compred with n 6 mle rts, which were overfed the sme 7% OO diet used in experiment 1 vi TEN for 5 dys. Pthologicl evlution. Liver pthology ws ssessed by hemtoxylin-eosin nd oil red O stining of liver sections. Oil red O ws quntified by imge nlysis s described previously (7). Necrosis ws ssessed biochemiclly by mesurement of serum lnine mino trnsferse (ALT) ctivity t deth with the Infinity ALT liquid stble regent (Thermo Electron, Wlthm, MA) ccording to mnufcturer s protocols. Apoptosis ws ssessed by in situ end lbeling of free 3=-hydroxyl ends generted during poptosis (TUNEL) nd heptocyte prolifertion ws mesured by immunohistochemicl stining for proliferting cell nucler ntigen (PCNA) s described previously (59). In experiment 2, liver pthology ws scored in blinded smples by bord certified pthologist (L. Hennings). The pthology clcultion ws s described previously (7). Biochemicl nlysis. Nonesterified free ftty cids (NEFA) were mesured with the NEFA C kit from Wco Chemicls (Richmond, VA). Serum triglycerides were mesured using Triglyceride Regent (IR141; Synermed, Westfield, IN). Triglyceride ws extrcted from whole liver homogentes with chloroform-methnol (2:1, vol:vol) nd nlyzed with Triglyceride Regent (IR141; Synermed, Westfield, IN). Serum glucose levels were mesured with Glucose Regent (IR71 72; Synermed, Westfield, IN). Serum insulin nd leptin levels were mesured with ELISA kits from Linco Reserch (St. Chrles, MO) ccording to mnufcturer s protocols. Serum diponectin levels were mesured with n ELISA kit from B-Bridge Interntionl (Sunnyvle, CA) ccording to mnufcturer s protocols. Liver lipid peroxidtion (thiobrbituric cid rective substnces, TBARS) ws ssessed s mesure of oxidtive stress s described by Ohkw et l. (45). Lipid FA profile nlysis of liver homogentes ws conducted by GC-MS s previously described in our lbortory (74). Peroxidizbility index of liver free FA, triglycerides, nd phospholipid frctions ws clculted bsed on FA profiles s described by Lmbert et l. (3). Anlysis of liver hydroxecoistetrenoic cid (HETE) nd hydroxyoctdecdienoic cid (HODE) FA metbolites nd brekdown products ws crried out by HPLC-MS/MS s described previously (75). Western blot nlysis of protein expression. Western immunoblots were performed ginst sterol regultory element binding protein (SREBP)-1c, ftty cid synthse (FASN), cyl CoA crboxylse 1 (ACC), phospho-acc, nd CD36 s previously described nd normlized to GAPDH (42, 6 64). Western immunoblots ginst phosphorylted nd totl mitogen-ctivted protein (MAP) kinses ERK, p38, nd JNK were lso performed s described previously (63, 64). Western immunoblot nlysis of poprotein expression for CYP2E1 nd CYP4A1 ws conducted s previously described nd normlized ginst totl protein loded bsed on Coomssie blue stining of whole lnes (6). CYP2E1 ws gift from the lbortory of Dr. Mgnus Ingelmn-Sundberg (Krolinsk Institute, Stockholm, Sweden) (25). CYP4Al ws detected using polyclonl sheep ntibody to rt CYP4A1 (7), which ws gift from Dr. Gordon Gibson (University of Surrey, Guilford, UK). Nucler extrcts were prepred nd nucler SREBP-1c expression immunoquntified s previously described (63). Expression of the trnscription fctor, crbohydrteresponsive element binding protein (ChREBP) in nucler extrcts ws detected in Western immunoblots with got polyclonl ntibody rised ginst the COOH terminus of humn ChREBP, which cross rects with the rt form (Snt Cruz Biotechnology Sc-21189). Expression of the erly growth response protein-1 (Egr-1) ws detected in Western blots of whole liver homogentes using rbbit polyclonl ntibody Sc-11 from Snt Cruz Biotechnology. Expression of SREBP-1c, ChREBP, nd Egr-1 proteins ws normlized ginst totl protein loded bsed on Amido blck stining of whole lnes. Heptic gene expression nlysis. Heptic gene expression profiles were ssessed using Affymetrix RGU34A GeneChip microrrys Tble 1. Biochemicl nd endocrine effects ssocited with different dietry ft composition 7% ANOVA Effect P Vlues FA Type Concentrtion Interction Glucose, mg/dl 16 (26) 158 (37) 178 (34) 26 (14) 231 (17) 266 (14) Insulin, ng/ml 4.1 (.3) 2.9 (.4) 4.6 (1.1) 4.7 (.7) 4. (.3) 3.1 (.2) Triglycerides, mg/dl 126 (22) 121 (19) 153 (21) 336 (56) 16 (22) 25 (8) NEFA, mm.18 (.4).25 (.4).3 (.6).44 (.7).35 (.3).53 (.9) Leptin, ng/ml 3.4 (.8) 3.4 (1.4) 3.1 (.7) 3.5 (.6) 2.8 (.5) 4.6 (1.) Adiponectin, g/ml 6.6 (.7) 8.5 (.6) 8. (1.2) 5. (1.2) 3.2 (.3) 3.6 (.3) Dt re mens (SE). Endocrine nd biochemicl dt from experiment 1 in which rts were overfed 5 or 7% ft diets of different ft composition vi totl enterl nutrition for 21 dys. FA, ftty cid. Mens with were significntly different with different % dietry ft, vs. 7%, P.5.

3 EFFECT OF FATTY ACIDS ON NAFLD 175 Fig. 1. Oil red O stining of representtive rt liver sections illustrting the development of stetosis fter overfeeding of diets contining 5 or 7% ft vi totl enterl nutrition for 21 dys. A: olive oil (OO); B: corn oil (CO); C: echium oil (EO); D: 7% OO; E: 7% CO; F: 7% EO. (Affymetrix, Snt Clr, CA) contining 8,8 genes, with 7, full-length trnscripts nd 1,8 expressed sequence tg sequences. Livers were nlyzed from rts fed 5 or 7% OO or CO diets, respectively. Totl RNA ws extrcted nd three pools prepred from ech tretment group, ech pool from n 1 2 livers. The intensity vlues of different probe sets (genes) generted by Affymetrix Gene- Chip Softwre were imported into GeneSpring version softwre (Silicon Genetics, Redwood City, CA) for dt nlysis. The dt files (CEL files) contining the probe level intensities were processed by the robust multirry verge lgorithm for bckground correction, normliztion, nd log trnsformtion of perfect mtch probe level vlues (64). Subsequently, the dt were subjected to per-chip nd per-gene normliztion using GeneSpring normliztion lgorithms. For comprison nlysis, genes were filtered bsed on minimum 1.5-fold rtio chnge nd P vlue.5 by Student s t-test. Fetures were clssified with connectivity-bsed clustering with correltion s distnce. Visuliztion of dt ws ccomplished with GeneSpring GX v Known biologicl functions of genes were queried nd cquired from Affymetrix online dt nlysis resource NetAffx nd gene ontology (GO) nlyses performed using Affymetrix GO Browser (64). Anlysis of genes mpped to biologicl pthwys ws conducted using Affymetrix NetAffx nd GO nlysis for biologicl/moleculr function performed with GeneSpring using flse discovery rte corrected P.1 (defult for GeneSpring) (64). Furthermore, the list of genes ffected in the liver by OO vs. CO feeding t 5 or 7% clories ws nlyzed with DAVID to perform Functionl Annottion clustering nd using Gene Set Enrichment Anlysis. This nlysis included identifying top intercting networks bsed on gene dt bses from the known literture s described previously for other mrna dt sets (64). Confirmtion of microrry gene expression dt ws done by rel-time RT-PCR. Rel-time reverse trnscription-polymerse chin rection. Totl RNA ws extrcted from livers nd dipose tissue with TRI Regent nd clened with RNesy mini columns (Qigen, Vlenci, CA). RNA qulity ws scertined spectrophotometriclly (rtio of A26/A28) nd lso by checking rtio of 28S to 18S ribosoml RNA with the RNA Nno Chip on 21 Bionlyzer (Agilent Technologies, Plo Alto, CA). Totl RNA (1 g) ws reverse trnscribed with the iscript Reverse Trnscription kit (Bio-Rd Lbortories, Hercules, CA) ccording to mnufcturer s instructions. The reverse trnscribed cdna (1 ng) ws utilized for rel-time PCR using the 2 SYBR green mster mix nd monitored on ABI Prism 7 sequence detection system (Applied Biosystems, Foster City, CA). Gene-specific probes described previously (7, 8, 42, 6 64) were designed with Primer Express Softwre (Applied Biosystems), nd the reltive mounts of gene expression were quntitted by stndrd curve ccording to mnufcturer s instructions. Electrophoretic mobility shift nd TrnsAM SREBP-1c trnscription fctor binding ELISA. For electromobility shift ssys (EMSAs), complementry oligonucleotide probes specific for the plus nd minus strnd SRE consensus sequence (GATCCTGATCACCCCACTGAG- GAG nd CTCCTCAGTGGGGTGATCAGGATC) site contined t Tble 2. Effects of dietry ft type nd concentrtion on liver pthology 7% ANOVA Effect P Vlues Interction FA Type Concentrtion Interction Stetosis 1.2 (.8).11 (.4).11 (.1).36 (.5).27 (.4).24 (.5) Liver triglycerides, g/mg 112 (39) b 58 (8),b 44 (11), 131 (15),b 13 (7) 191 (11),b Serum ALT, U/I 41 (4) 39 (2) 36 (4) 37 (3) 64 (1),b 87 (5),c Cells in S-phse (5) 1.17 (.18) 1.28 (.3) 1.1 (.11).89 (.1) 1.24 (.74).82 (.13) Dt re mens (SE). Liver pthology dt from experiment 1 in which rts were overfed 5 or 7% ft diets of different ft composition vi totl enterl nutrition for 21 dys. 1 Intensity of oil red O stining bsed on imge nlysis. Mens with were significntly different with different % dietry ft, vs. 7%, P.5. Mens with differing letters re significntly different bsed on FA type within the sme dietry %, P.5; b c.

4 176 EFFECT OF FATTY ACIDS ON NAFLD position ( 15) of the ftty cid synthse (FASN) promoter were synthesized by Integrted DNA Technologies, (Corlville, IA). Nucler proteins (3 g) were incubted in rection buffer contining 1 mm Tris Cl, ph 7.5, 5 mm NCl, 1 mm MgCl 2,.5 mm EDTA,.5 mm DTT, 4% glycerol, nd.5 mg/ml of poly (di-dc) with or without 5-fold excess of unlbeled probes nd 1.75 pmol of lbeled probe for 2 min t room temperture. The complexes resolved with ntive 4% polycrylmide gel in Tris-borte-EDTA buffer for 2 h t room temperture. The gels were dried nd exposed to X-ry film for 24 h t 7 C. SREBP-1 binding ctivity in 3 g of liver nucler extrcts ws determined with the SREBP-1 TrnsAM kit (Active Motif, Crlsbd, CA) ccording to the mnufcturer s instructions. Sttisticl nlysis. Dt for continuous outcomes re presented s mens SE. Two-fctor nlysis of vrince (ANOVA) ws used to compre men effects of ft source (oil type), percent ft in diet (5 nd 7%), nd their interction on ech outcome. Post hoc comprisons of ft source nd of percent ft within oil were performed by n ll-pirs Tukey-Krmer comprison test nd considered significnt if P.5. Sttisticl nlyses were performed with the Stt sttisticl pckge version 12. (Stt, College Sttion, TX). RESULTS Effects of dietry ft-crbohydrte rtio nd ft type on body weight nd diposity. Comprison mong rts overfed diets with three different ft sources (CO, OO, EO) nd two levels of ft (5 or 7% of totl clories) in experiment 1 reveled no significnt group differences in finl body weight ( g) or weight gin (3 4 g/dy). Moreover, no significnt differences were observed in diposity between the diet groups with % body ft mss rnging from 16 to 18%. In ddition, there were no significnt effects of ltering ft-crbohydrte rtio or ft type on expression of the inflmmtory mrkers tumor necrosis fctor- or IL-6 mrnas in dipose tissue fter this short period of overfeeding (dt not shown). Collectively these dt suggest tht, t lest over short periods of overfeeding, body composition is not sensitive to chnges in dietry mcronutrient composition nd tht in these young rpidly growing nimls significnt expnsion of dipose tissue mss fter overfeeding occurs without ccompnying inflmmtion. Tble 3. Effects of dietry ft type on heptic lipid FA composition 7% ANOVA Effect P Vlues FA Type Concentrtion Interction Free Ftty Acids C14: 15 (68) b 8 (15),b () () () () C16: 469 (223) 241 (59) 1741 (1217) 1167 (332) 1727 (74) 25 (36) C16:1 889 (537) 52 (17) 444 (361) 1 (6) () 3 (3) C18: 37 (1) 314 (54) 257 (14) 257 (72) 373 (127) 151 (24) C18: (85) 774 (28) 459 (34) 1264 (414) 627 (226) 63 (15) C18:2 193 (126) 352 (17) 15 (72) 279 (74) 2419 (1),b 247 (51) C18:3 () () 45 (22),b () () 11 (23),b C2:3 () () 9 (9) () 4 (22) 5 (5) C2:4 122 (48) 174 (34) 9 (36) 15 (36) 48 (145),b 68 (23) C22:6 45 (32) 42 (12) 42 (31) 5 (5) 31 (2) 6 (6) Totl 762 (3755) 4529 (132) 3517 (2192) 3354 (866) 5882 (223) 116 (185) Triglycerides C14: 626 (222),b 158 (34) 368 (95) b 135 (15) 7 (13) 97 (15) C16: 1629 (5146) b 4624 (74) 1952 (325),b (113) 1526 (226) 746 (741) C16: (147) 712 (13) 34 (82) 379 (79) 43 (2) 19 (25) C18: 118 (297) b 351 (8) 514 (76),,b 847 (131) 538 (86) 112 (6) C18: (45) 1585 (225) 448 (1417) 1929 (1967),b 598 (17) 5598 (1847) C18:2 583 (31) 38 (8) 172 (526) 4347 (1262) 2442 (4341),b (783),b C18:3 8 (8) () 249 (13),b 112 (21) 158 (34) 7462 (1274),b C2:3 () () 25 (17) 47 (28) 335 (13),b 1262 (135),b C2:4 56 (26) () 122 (96) 287 (65) 1416 (474),b 1122 (61),b C22:6 () () 13 (78) 46 (21) 154 (41),b 473 (44),b Totl (113) 8142 (951) 2155 (547) (3384) (7548) (136) Phospholipids (Phosphtidylcholine) C14: 44 (3) 42 (4) 54 (1) () () 3 (3) C16: 4678 (391) 459 (254) 5395 (66) 334 (29) 3569 (276) 325 (98) C16:1 796 (71) 513 (4) 962 (335) 25 (2) 42 (19) 6 (4) C18: 5498 (642) 5164 (895) 5594 (897) 75 (48) 6752 (395) 7739 (476) C18: (45) b 721 (1), 76 (15), 1315 (141) b 442 (44), 317 (16), C18:2 19 (186), 291 (443),b 157 (151),,b 1992 (217), 3152 (424),b 2775 (259),,b C18:3 () () 37 (6),b () () 138 (36),b C2:3 299 (37) 479 (75), 815 (137) b 353 (38) 163 (29), 76 (89) b C2: (573) 3934 (861) 372 (752) 4816 (75) 5282 (58) 5493 (276) C22:6 118 (215) 1532 (687) 1944 (329) 1117 (134) 787 (76) 94 (85) Totl (1556) (2251) (2879) 263 (1361) 2487 (1387) (115) Dt re mens (SE) g/g liver. Liver ftty cid composition dt from experiment 1 in which rts were overfed 5 or 7% ft diets of different ft composition vi totl enterl nutrition for 21 dys. Mens with were significntly different with different % dietry ft, vs. 7%, P.5. Mens with differing letters re significntly different bsed on FA type within the sme dietry %, P.5; b.

5 EFFECT OF FATTY ACIDS ON NAFLD 177 Effects of dietry ft-crbohydrte rtio nd ft type on serum prmeters. Incresing dietry ft content from 5 to 7% of clories elevted fsting glucose concentrtions irrespective of FA type (P.2) (Tble 1). In contrst, no effects of either crbohydrte-ft rtio or ft type were observed on serum insulin concentrtions in these overfed nimls. Incresing dietry ft content significntly incresed both serum triglyceride nd serum NEFA concentrtions (P.5) in the 7% OO nd EO groups but filed to do so in the 7% CO group. Serum leptin vlues were unchnged between groups (Tble 1). In contrst, overll ANOVA nlysis demonstrted tht incresing dietry ft concentrtion decresed serum diponectin concentrtions (P.1). However, this only reched sttisticl significnce in the rts fed polyunsturted fts (Tble 1). These dt re consistent with the development of systemic insulin resistnce fter overfeeding of high-ft diets irrespective of ft type. However, lipid homeostsis nd dipokine secretion pper to be sensitive to dietry ft composition. Effects of overfeeding diets differing in ft content nd type on development of NAFLD pthology. Reltive liver weight ws incresed s dietry ft content incresed in ll groups (P.5) (dt not shown). We ssessed ppernce of heptic stetosis by oil red O stining of lipid droplets (Fig. 1) nd by mesurement of totl triglyceride concentrtions biochemiclly (Tble 2). In generl, oil red O stining nd triglyceride content incresed with dietry ft concentrtion (P.2). However, drmtic differences were observed in the nture of the stetosis observed microscopiclly depending on dietry ft type (Fig. 1). In groups fed diets contining OO, lrge lipid droplets chrcteristic of mcrostetosis predominted. In contrst, in rts fed high CO diets, stetosis ppered to be mixture of lrge droplets nd smll droplets, but only in the 7% group. In rts fed EO diets, ll lipid droplets ppered A Corn Oil C Olive Oil B Corn Oil Olive Oil Fsn Cyb5r3 Acsl5 Akr1c14 Cps1 Acsl1 Acox1 Cyp41 Hdhb Gm2 Acot2 Decr1 Hmgcs2 Ghr Apo4 Cd36 Hsd17b4 Acly Chk Acc Gpm Ephx2 Dpm2 Enpp1 Adh7 Pemt Psp Adh4 Mecr Strd3 Gpd1 Cyp51 Acox3 Mpk14 Prdx6 Rbp4 Hdh Scrb1 Gpsn2 Hmgcr Pik3c3 Srd51 Cyp7b1 Cyp2d4v1 Nr3c1 Cyp43 Il1b Pten Plcl1 Lip Serinc1 Fig. 2. Microrry results for liver from rts overfed high crbohydrte diets contining OO or CO vi totl enterl nutrition for 21 dys. Dt re bsed on nlysis using RGU34A GeneChip microrrys of 3 mrna pools prepred from ech tretment group with n 1 2 livers/pool. A: hierrchicl clustering for genes exhibiting 1.5-fold difference between groups. B: het mp for genes involved in lipid metbolic process. C: pthwy nlysis of relevnt genes expressed t higher level in the OO group (red) nd expressed t lower level in the OO group (green) reltive to the CO group.

6 178 EFFECT OF FATTY ACIDS ON NAFLD Tble 4. Min KEGG pthwys relted to the selection of differentilly expressed genes for the comprison of olive oil vs. corn oil nd 7% olive oil vs. 7% corn oil KEGG Pthwy Count % P Vlue FDR A: Olive Oil vs. Corn Oil Retinol metbolism E E-5 Ftty cid metbolism E E-4 Drug metbolism E Protesome E PPAR signling pthwy E Metbolism of xenobiotics by cytochrome P E Antigen processing nd presenttion E Grft-versus-host disese Alzheimer s disese Drug metbolism Focl dhesion type I dibetes mellitus Cffeine metbolism Ftty cid elongtion in mitochondri Oxidtive phosphoryltion Ascorbte nd ldrte metbolism Prkinson s disese Neurotrophin signling pthwy Allogrft rejection Ribosome Steroid hormone biosynthesis Virl myocrditis Gliom Autoimmune thyroid disese T cell receptor signling pthwy Vsculr smooth muscle contrction Cell dhesion molecules (CAMs) Long-term potentition Pthwys in cncer Lysosome Pncretic cncer Thyroid cncer Porphyrin nd chlorophyll metbolism Endocytosis Propnote metbolism Linoleic cid metbolism Huntington s disese Prion diseses Long-term depression Endometril cncer Bldder cncer Nonsmll cell lung cncer Renl cell crcinom Melnom Strch nd sucrose metbolism Biosynthesis of unsturted ftty cids B: 7% Olive Oil vs. 7% Corn Oil Ftty cid metbolism E E-6 Retinol metbolism E E-4 PPAR signling pthwy E Metbolism of xenobiotics by cytochrome P E Drug metbolism E B cell receptor signling pthwy E Prion diseses E Long-term depression Vsculr smooth muscle contrction Vline, leucine nd isoleucine degrdtion NOD-like receptor signling pthwy Butnote metbolism Pthwys in cncer Adipocytokine signling pthwy Neurotrophin signling pthwy Biosynthesis of unsturted ftty cids T cell receptor signling pthwy Oocyte meiosis Continued

7 Tble 4. Continued EFFECT OF FATTY ACIDS ON NAFLD 179 KEGG Pthwy Count % P Vlue FDR Terpenoid bckbone biosynthesis Amyotrophic lterl sclerosis (ALS) Long-term potentition Chemokine signling pthwy Propnote metbolism Linoleic cid metbolism Focl dhesion MAPK signling pthwy Pncretic cncer Archidonic cid metbolism Toll-like receptor signling pthwy Melnogenesis VEGF signling pthwy Synthesis nd degrdtion of ketone bodies Pyruvte metbolism Nturl killer cell medited cytotoxicity Tryptophn metbolism Glycolysis/Gluconeogenesis Insulin signling pthwy Antigen processing nd presenttion Fc gmm R-medited phgocytosis Prostte cncer Renl cell crcinom Citrte cycle (TCA cycle) smll (microstetosis). Interestingly, substntil differences were observed in liver triglyceride ccumultion depending on the dietry ft content nd type (P.7 for ft type, P.4 for ft type/content interction). Rts fed OO diets hd greter men triglyceride ccumultion thn rts fed CO or EO. Incresing dietry ft content to from 5 to 7% resulted in lrger increse in heptic lipid content in rts in the polyunsturted ftty cid (PUFA) groups reltive to those fed OO (Tble 2). Assessment of hemtoxylin nd eosin (H&E)-stined sections did not provide evidence of inflmmtory infiltrtes or necrotic foci fter this short period of overfeeding in ny of the diet groups (dt not shown). However, serum ALT vlues were highly dependent on dietry FA dose nd composition (P.1) (Tble 2). The 7% OO group displyed no increse in ALT vlue reltive to the OO group. In contrst, both groups overfed 7% PUFA hd bnormlly elevted ALTs indictive of cellulr necrosis nd ALT vlues followed the order EO CO OO (P.5). In contrst, poptotic cell deth using TUNEL stining ws highly vrible between.1 nd.4% nd ws not different between groups (dt not shown). At this time point, there ws no evidence of incresed heptocyte prolifertion in ny diet group bsed on nlysis of PCNA immunostining (Tble 2). Tken together, these dt demonstrte tht short-term overfeeding of diets high in monounsturted ftty cids (MUFA) produced mcrostetosis, but no evidence of liver injury. In contrst, overfeeding high-pufa diets resulted in microstetosis ccompnied by necrotic injury. Effects of overfeeding diets differing in ft type on FA profiles of heptic lipids. Comprison of heptic FA profiles in free FA, triglycerides, nd the phospholipid frctions from rts in experiment 1 is shown in Tble 3. In the rts fed low ft diets, heptic FA composition ws reltively similr. Free FAs were predominntly C16: nd C18:1. Heptic triglycerides in the low ft groups were composed minly of C16: nd C18:1 FA chins. As with the free FA frction, smll proportion of triglycerides ccumulted in the EO group contined 18:3 FAs nd the EO group lso hd detectble C22:6 FAs. In the phospholipid (phosphdylcholine) frction, the mjor incorported FAs fter ft overfeeding were 16: nd 18: nd rchidonic cid (C2:4). The effects of differing dietry FAs were only observed on minor FA components. There were no significnt effects of incresing dietry ft content from to 7% clories on totl heptic free FA concentrtions (Tble 3). However, incresing dietry CO content to 7% incresed free levels of C18:2 nd rchidonic cid over the CO group (P.5), while 18:3 levels were elevted in the 7% EO group over the EO group (P.5). Within the 7% ft groups, 7% CO feeding lso incresed free 18:2 nd rchidonic cid concentrtion reltive to the other two diets. Incresing dietry FA content elevted overll heptic triglyceride levels (P.4). This increse ws much greter for CO nd EO diets thn the OO diet (P.5). FA composition of triglycerides generlly reflected dietry FA composition in rts fed 7% ft diets. C18:1 content of triglycerides ws incresed from 27 to 49% fter 7% OO feeding (P.5); C18:2 content of heptic triglycerides ws incresed from 4 to 53% fter 7% CO feeding (P.5). In contrst, incresing dietry EO from 5 to 7% incresed 18:2 content of triglycerides from 6 to 43% nd incresed content of 18:3 FAs from 1.4 to 16% (P.5). Incresing dietry CO nd EO to 7% of clories lso incresed rchidonic cid content nd C22:6 content of heptic triglycerides (P.5). Incresing dietry FA content hd no effect on overll heptic phospholipid concentrtion but produced chnges in composition dependent on dietry FA type; C16: concentrtion of phospholipids ws lower in 7% ft-fed compred with ft-fed rt livers, nd the concentrtion of C18: ws greter (P.5). Within the 7% groups, C18:1 content ws higher in the OO group thn in the polyunsturted ft groups, while 18:2 ws greter in rts fed 7% CO or EO compred with rts fed 7% OO (P.5). C18:3 ws only found in phospholipid frctions fter EO feeding. Tken s whole, the composition of

8 18 EFFECT OF FATTY ACIDS ON NAFLD ccumulted heptic lipids fter overfeeding of high-ft diets mirrored the dietry ft type. Effects of dietry ft type in the context of overfeeding high crbohydrte diets on heptic gene expression. In light of the difference in triglyceride ccumultion observed in livers of rts fed OO diets reltive to those fed CO diets in experiment 1 (Fig. 1, Tbles 2 nd 3), we exmined potentil underlying moleculr mechnisms with Affymetrix microrrys to ssess globl chnges in heptic gene expression between these groups. The originl.cel files hve been submitted to the Ntionl Center for Biotechnology Informtion Gene Expression Omnibus (NCBI-GEO) dtbse nd re ccessible s series record GSE The gene list generted using 1.5-fold cut-off is presented in Supplementl Tble S1. 1 A summry of the gene rry dt is presented in Fig. 2. We found 279 genes to be expressed more highly nd 126 genes to be expressed t lower level in the OO group reltive to the CO group (Fig. 2A). Functionl nnottion clustering by DAVID reveled severl clusters of genes involved in lipid homeostsis (Tble 4, Fig. 2B). This included genes linked to biosynthesis of unsturted FAs nd FA metbolism, severl cytochrome P45 enzymes, nd genes involved in the peroxisome prolifertor-ctivted receptor (PPAR) signling pthwy. Other mjor KEGG pthwys differing between these groups included genes involved in retinol metbolism, genes linked to the proteosome, nd genes ssocited with ntigen processing nd presenttion (Tble 4). Genes linked to lipid homeostsis included genes encoding FASN, which is rte limiting in de novo FA synthesis from crbohydrtes (19); CD36 heptic FA trnsporter (39); 1 The online version of this rticle contins supplementl mteril. CYP4A1, involved in FA degrdtion vi -hydroxyltion (66); nd ApoA4, lipoprotein ssocited with VLDL secretion (12). Rel-time RT-PCR ws utilized to nlyze differences in expression of mrnas coding for genes involved in FA homeostsis including those reveled by rry nlysis of OO nd CO groups nd to further compre them with gene expression in the EO group (Tble 5). Expression of mrna for three FA trnsporters, FATP-2, FATP-5, nd CD36, ws higher in OO group thn the CO group (P.5). In ddition mrna for enzymes controlling FA nd triglyceride synthesis, FASN, ACC, nd steroyl CoA desturse (SCD-1), were lso higher in the OO group (P.5). However, greter expression ws lso noted in mrnas for PNPLA3 (diponutrin), implicted in triglyceride hydrolysis, nd mrnas for two proteins involved in VLDL secretion, mitochondril triglyceride trnsport protein (MTP), nd ApoB-1 in the OO group. Pthwys nlysis of the rry dt suggested tht higher CD36 in the OO group might be linked to incresed expression of two MAP kinses MAPK14 (p38- ) nd MAPK1 (ERK-2) (Fig. 2C). However, CD36 expression is lso regulted vi PPARs, nd chnges in PPAR signling genes ws lso indicted in DAVID nlysis of the rry dt (Tble 4). Higher men expression of FASN, ACC, nd CD36 in liver from OO-fed rts compred with the CO group ws confirmed t the protein level by Western immunoblotting (Fig. 3). Since FASN nd ACC re known trgets of the trnscription fctor ChREBP, we mesured ChREBP protein in nucler extrcts. ChREBP expression ws significntly higher in nucler extrcts from OO-fed compred with CO-fed rts (P.5) (Fig. 3). FASN, ACC, nd SCD-1 re lso ll known trgets for the trnscription fctor SREBP-1c. SREBP-1c expression t the mrna level Tble 5. Effects of dietry ft composition on heptic pthwys regulting ftty cid homeostsis 7% ANOVA Effect P Vlues FA Type Concentrtion Interction Ftty Acid Trnsport FATP (.65),,b 1.52 (.27) 9.32 (1.44) b 1.67 (1.88),b 4.25 (.34) 11.6 (2.25) b FATP (.43) b 1.32 (.24) (4.37) b 9.97 (4.19) 1.82 (.32) 8.73 (2.16) CD (5.96) b 3.2 (.63), (4.3) b (1.96) (4.1) 12. (2.7) Ftty Acid Synthesis SREBP-1c 3.54 (1.6) 1.34 (.52) 3.99 (1.34) 1.77 (4.57) b.32 (.8) 6.91 (3.7) b FASN 47.9 (12.93),b (5.18) (8.35) b 6.25 (1.54) 2.54 (.49) 7.58 (1.49) ACC (5.26) 8.23 (2.42) (16.6) 8.82 (2.56) 2.3 (.61) 1.45 (3.88) SCD (6.99),b 9.12 (2.8) (3.66),b 2.25 (.62).15 (.5) 2.38 (1.8) Ftty Acid Degrdtion PPAR lph 4.71 (1.8) 3.39 (.99) 21.2 (5.87) b 1.82 (3.56) 2.46 (.36) (3.2) CPT (1.1) 1.11 (.3) 7.4 (1.93) (2.97),b 4.65 (.83) 11.9 (3.1),b ACO 4.32 (.38),b 1.43 (.22) 1.61 (1.48),b (2.39),b 3.41 (.59) (3.8),b Triglyceride Associted PNPLA (1.32),b 9.1 (2.37) (16.88),,b 3.72 (1.36) 1.33 (.24) 5.12 (2.14) Adipophilin 5.24 (.73) 1.34 (.24) 5.84 (1.47) 1.92 (2.52) b 2.3 (.36) 1.61 (3.92) b VLDL Secretion MTP 9.98 (1.18),b 3.74 (.7) (2.11) b (2.87) b 4.72 (.57) (2.52) b ApoB (2.64) b 2.69 (.62) (2.5) b 1.94 (2.75) 6.46 (.69) 12.6 (2.83) Dt re mens (SE) for mrna expression normlized to 18S. Liver ftty cid homeostsis dt from experiment 1 in which rts were overfed 5 or 7% ft diets of different ft composition vi totl enterl nutrition for 21 dys. Mens with significntly different with different % dietry ft, vs. 7%, P.5. Mens with differing letters significntly different bsed on FA type within the sme dietry %, P.5; b.

9 EFFECT OF FATTY ACIDS ON NAFLD 181 Liver Fsn Protein Liver Acc Protein Liver CD36 Protein Normlized ADUs b, b, b, b, 7% Normlized ADUs 2 b, 1 Liver nsrebp1 Protein b, b b, Liver Chrebp Protein, b Fig. 3. Immunoquntittion of Western immunoblots of heptic protein expression in livers from rts overfed high crbohydrte diets contining OO or CO vi totl enterl nutrition for 21 dys. A C: dt from whole cell extrcts. D, E: dt from nucler extrcts ACC, cyl CoA crboxylse; FASN, ftty cid synthse; SREBP-1, sterol regultory element binding protein 1c; CD36, ftty cid trnsporter; ChREBP, crbohydrte response element binding protein. Dt re mens SE, mens with different letters re significntly different between oil type P.5; b, mens with re sttisticlly different, 5 vs. 7% within oil type. nd expression t the protein level were mesured in heptic nucler extrcts (Tble 5, Fig. 3). Men SREBP-1c mrna vlues were higher nd nucler SREBP-1c protein levels were greter (P.5) in the OO-compred to CO-fed group. Since SREBP-1c signling cn be regulted by posttrnscriptionl modifictions such s cetyltion (51) nd vi interctions with coctivtors (6, 35), we lso exmined DNA binding of SREBP-1c to its response element using TrnsAM ELISA nd by EMSA with the consensus SREBP-1c binding site on the FASN promoter (Fig. 4). Higher SREBP-1c promoter binding ws observed in OO rts compred with CO rts in both ssys. EMSA specificity ws estblished by competitive binding with unlbeled probe nd unrelted sequences. Higher SREBP-1c binding in the OO group in the EMSA ws ccompnied by significntly reduced migrtion of the nucler protein complex, indicting the binding of dditionl coctivtors t this site reltive to nucler extrcts from CO rts. One possible coctivtor of SREBP-1c signling is the peroxisome prolifertor-ctivted receptor coctivtor (PGC-1, Ref. 35). Interestingly, reltive mrna expression of PGC-1 ws higher in the OO-fed compred with CO-fed group:.72.8 vs (P.5). Despite the EO group lso hving significntly less stetosis reltive to the OO group (Tble 2), fewer differences were observed between the OO nd EO groups reltive to the differences seen between OO nd CO groups in expression of mrnas of genes involved in FA synthesis or in expression of FASN or ACC proteins. (Tble 4, Fig. 3). In ddition, lthough nucler ChREBP expression ws comprble between CO nd EO groups, nd both were lower thn expression in the OO group (P.5), SREBP-1c nucler protein levels were more similr in OO nd EO groups (Fig. 3). However, like the CO group, the EO group hd significntly less expression of CD36 protein (P.5) (Fig. 3). Moreover, PPAR mrna nd expression of mrnas downstrem of PPAR signling linked to FA degrdtion (CPT nd ACO) were expressed t higher levels (P.5) in the EO group compred with the OO group (Tble 5). These differences in FA trnsport nd degrdtion my contribute to the reduced level of triglyceride ccumultion fter feeding EO. These dt indicte tht the effects of dietry ft type on FA homeostsis re complex nd differences in heptic ft ccumultion represent the sum of mny different pthwys controlling FA import nd export, synthesis, nd degrdtion. Effects of dietry ftty cids on progression of liver injury beyond simple stetosis. In experiment 1, incresing dietry ft content to 7% clories further incresed heptic triglyceride content in ll three groups over the ft groups (P.5, Tbles 2 nd 3). Gene expression nlysis nd Western blotting

10 182 EFFECT OF FATTY ACIDS ON NAFLD Corn Oil Olive Oil Fig. 4. Anlysis of SREBP-1c binding to the FASN promoter in livers from rts overfed OO or CO vi totl enterl nutrition for 21 dys. A: Trns-AM ssy; dt re mens SE for ssys using 3 nucler extrct pools prepred from ech tretment group with n 1 2 livers/ pool. B: electrophoretic mobility shift ssy with heptic nucler extrcts. Lnes represent 3 nucler extrct pool prepred from ech tretment group with n 1 2 livers/pool. SREBP-1 Binding Corn Oil Olive Oil (Fig. 3, Tble 5) suggest tht this occurred despite significnt reductions in de novo FA synthesis prticulrly in the 7% OO nd 7% EO groups. Suppression of FASN, ACC, nd SCD-1 in the 7% OO vs. OO group coincided with decreses in nucler ChREBP nd SREBP-1c expression (P.5) (Fig. 3). Wheres reduced FA synthesis in the 7% EO group compred with EO group occurred independently of chnges in SREBP-1c expression nd despite incresed expression of ChREBP-1c (Fig. 3). In prt, the incresed stetosis fter overfeeding 7% ft diets cn be explined by increses in FA trnsport. Elevting OO from 5 to 7% incresed expression of FATP-2 mrna (P.5), while incresing CO from to 7% drmticlly incresed expression of CD36 mrna nd protein (P.5). In ddition, incresing ft content reduced expression of PNPLA3 (diponutrin) mrna (P.1). The protein encoded by PNPLA3 hs been suggested to be involved in triglyceride hydrolysis, nd inctivting muttions in PNPLA3 hve been observed cliniclly in NAFLD ptients (63). Coincident with incresed stetosis, incresing dietry ft content incresed expression of mrna encoding dipophilin, ft droplet ssocited PAT protein (P.5). mrna encoding nother PAT protein perilipin ws below detection in ll tretment groups (dt not shown). Since serum ALT vlues indicted significnt differences in heptic necrosis between groups overfed 7% ft of different types for 21 dys, we exmined other spects of progression of liver injury beyond simple stetosis in these rts. Two sources of ROS formed during FA metbolism re the cytochrome P45 enzymes CYP2E1 nd CYP4A1 (2, 7, 36, 61). Similr to our previously published dt with CO diets in the TEN model (7), incresing dietry ft content from 5 to 7% rised expression of CYP2E1 two- to threefold nd CYP4A1 four- to sixfold (P.5) in ll three groups independently of dietry ft type (dt not shown). Another suggested component involved in progression of liver injury is incresed signling through the MAP kinse JNK s result of direct lipotoxicity of circulting NEFA nd consequent development of endoplsmic reticulum stress (23, 72). We nlyzed expression of totl nd phosphorylted JNK, p38, nd ERK in whole liver cell lystes from these livers. No phosphoryltion of either p38 or JNK ws detected in ny of the livers from ny of the groups. In contrst, totl ERK protein expression ppered elevted by 7% ft feeding independent of ft type, nd the overll rtio of phosphorylted to totl ERK ws reduced (P.5) (dt not shown). Clcultion of peroxidizbility index of heptic lipid frctions in the current study demonstrted incresed peroxidizbility of heptic free FAs nd prticulrly triglycerides fter overfeeding of 7% CO nd EO (P.5), but not fter overfeeding with 7% OO (Fig. 5). In contrst, no differences were observed between peroxidizbility of the phospholipid frctions fter 7% ft overfeeding. These differences in susceptibility of cellulr lipids to ttck by ROS were prlleled by similr effects in the heptic concentrtion of TBARS depending on dietry ft concentrtion nd type (Fig. 5). Recent clinicl studies of NAFLD nd NASH ptients hve linked specific oxidized FA products to progression of liver injury nd NASH. We mesured the spectrum of HODE nd HETE metbolites in the rt livers from the current study. The dt re shown in Figs. 5 nd 6. Both 9- nd 13-HODE concentrtions were dependent on dietry ft concentrtion nd type (P.5). Both metbolites were elevted by 7% CO or EO (P.5) but were not incresed in the 7% OO group (Fig. 5). Similrly, 8- nd 12-HETE concentrtions were incresed by overfeeding of 7% CO nd EO (P.5), but not by overfeeding 7% OO. In contrst, 5-HETE concentrtions were not significntly different between groups. 11-HETE concentrtions were only incresed fter 7% EO feeding (P.5). Overll 15-HETE concentrtions were incresed by 7% ft diets, including 7% OO (P.5). However, within the 7% groups, the highest men concentrtion ws with 7% EO (Fig. 6).

11 EFFECT OF FATTY ACIDS ON NAFLD Liver FFA Lipid Peroxidizbility Index 7%,b,b Liver Triglyceride Lipid Peroxidizbility Index %,b,b Liver Phospholipid Peroxidizbility Index 7%,b b TBA protein nmols of rective product/mg of liver % TBARS,b,b 1e+5 8e+4 6e+4 4e+4 2e+4 7% Liver 9-HODE,b,b 1e+5 8e+4 6e+4 4e+4 2e+4 7% Liver 13-HODE,b Fig. 5. Lipid peroxidtion in livers from rts overfed 5 or 7% olive oil, corn oil or echium oil vi totl enterl nutrition for 21 dys. Top: clculted lipid peoxidizbility index (28) for free ftty cids, triglycerides, nd phospholipids extrcted from liver bsed on quntittion of ftty cid composition shown in Tble 6. Bottom: lipid peroxidtion in whole liver homogentes mesured ccording the method of Ohkw et l. (42) nd liver concentrtions of ftty cid HODE metbolites. Dt re mens SE, mens with different letters re significntly different between oil type P.5; b, mens with re sttisticlly different, 5 vs. 7% within oil type.,b To exmine the differences between the 7% CO nd 7% OO groups in experiment 1 t the level of globl ptterns of heptic gene expression, we conducted Affymetrix gene rry nlysis. The originl.cel files hve been submitted to NCBI-GEO dtbse nd re ccessible s series record GSE The gene list generted using 1.5-fold cut-off is presented in Supplementl Tble S2. A summry of the gene rry dt is presented in Fig. 7. We found 212 genes to be expressed more highly nd 134 genes to be expressed t lower levels in the 7% OO group reltive to the 7% CO group (Fig. 7A). Functionl nnottion clustering with DAVID (Tble 4) reveled mny of the sme gene clusters identified in the comprison of OO nd CO groups: top KEGG pthwys included ftty cid metbolism, retinol metbolism, PPAR signling, nd cytochrome P45 expression. However, in ddition, unique gene clusters tht differed only in the 7% ft groups included those involved in rchidonic cid metbolism, the immune response (B nd T cell receptor signling), Toll-like receptor signling, chemokine signling, dipokine signling, nd MAP kinse signling. Hierrchicl clustering nd pthwys nlysis re shown in Fig. 7, B nd C. In greement with the rel-time RT-PCR dt shown in Tble 5, we observed greter expression of genes encoding proteins involved in FA synthesis (FASN), FA degrdtion (ACOX, HADHA, CYP4A1), nd VLDL formtion (ApoB) in the 7% OO group compred with the 7% CO group. Compred with the 7% CO group, CYP3A1/23, CYP2C7, CYP2C37, nd CYP1A2 were expressed to greter degree in the 7% OO group, while CYP2B3 ws lower. Interestingly we observed higher expression of genes involved in ntioxidnt defense in the 7% OO group, e.g., Gsr (glutthione reductse), Nqo1 (quinine oxidoreductse), nd Sod1 (superoxide dismutse) (Fig. 7C) nd hve confirmed some of the differences in reltive mrna expression by rel-time RT-PCR: Gsr vs , Nqo vs (7% OO vs. 7% CO). In contrst, hierrchicl clustering nd pthwys nlysis reveled tht vriety of mrnas for genes linked to heptic inflmmtion nd fibrosis were expressed t higher levels in the 7% CO group thn the 7% OO group (Fig. 7, B nd C). These included: ngiotensinogen (Agt), the precursor of ngiotensin II (27); RhoA (27); the cytokine IL-18 (71); the chemokine Ccl5 (28, 33); nd Egr-1 (53). Reltive expression of mrna encoding the pregnncy zone protein (pzp), suppression of which hs been linked to cirrhosis (34), ws reduced by 7% CO, nd this ws confirmed by rel-time RT-PCR ( vs , 7% CO vs. 7% OO). We confirmed the increse in Egr-1 expression in the 7% CO group t the protein level by Western blot (Fig. 7D). We hve previously demonstrted tht TEN overfeeding of CO diets, dministered for longer periods, resulted in dose- nd time-dependent progression of liver injury from simple stetosis to complete NASH (7, 8). To determine if longer overfeeding of the 7% OO resulted in progression of liver pthology to NASH, in experiment 2 we compred liver pthology fter TEN overfeeding of the 7% OO diet for 5 dys with bseline liver pthology in group of mle rts fed pelleted AIN-93G diet d libitum. The results re shown in Fig. 8. Although the totl liver pthology score ws greter in the 7% OO overfed

12 184 EFFECT OF FATTY ACIDS ON NAFLD Liver 5-Hete Liver 8-Hetes 8 6 7% % b,b Liver 11-Hetes 6 5 7% % Liver 12-Hetes 1 7% Liver 15-Hetes Fig. 6. Liver concentrtions of ftty cid HETE metbolites in livers from rts overfed 5 or 7% OO, CO, or EO vi totl enterl nutrition for 21 dys. Dt re mens SE, mens with different letters re significntly different between oil type P.5; b, mens with re sttisticlly different, 5 vs. 7% within oil type group (P.5) compred with control livers, this ws entirely driven by the lipidosis score (P.5), nd there were no differences in the (inflmmtion necrosis) scores. In ddition, ALT vlues were unchnged (28 2 vs U/l control vs. OO), nd there ws no evidence of incresed oxidtive stress s mesured by TBARS (.24.1 vs..23.2, control vs. OO). Comprison of mrna expressions linked to inflmmtion, stellte cell ctivtion, nd fibrosis re shown in Fig. 8D. Although smll increses were observed in CD68/CD45 mrna rtio nd SMA expression in the OO group compred with controls (P.5), there ws no consistent moleculr evidence for incresed inflmmtion, stellte cell ctivtion, or fibrosis even fter this much longer period of 7% OO overfeeding. These dt indicte tht despite high levels of stetosis in ll nimls overfed high-ft diets, progression of liver injury ws only evident fter overfeeding PUFA nd tht this ws linked to lipid peroxidtion. DISCUSSION Although extensive reserch hs been conducted on the development of NAFLD nd the progression to NASH in niml models, the relevnce to obesity-relted NASH is not cler. For exmple, genetic modifiction nd dietry deficiency models, such s the methionine-choline deficient model, result in heptic lipid ccumultion nd robust pthology in the bsence of obesity (1, 21, 24, 31, 32, 33, 57, 65, 68). Studies tht hve used d libitum consumption of diets high in sturted fts or simple crbohydrtes, show development of NAFLD but suffer from lck of much progression of injury beyond simple stetosis despite long feeding periods nd re complicted by differences in cloric intke (52, 56, 69). The current study employed previously reported model in which isocloric liquid diets of differing composition re used to overfeed mle rts vi totl enterl nutrition (7). Using this model, we previously demonstrted tht overfeeding diet high in CO, source of predominntly 18:2, -6 PUFA, could produce NASH pthology in 9 wk (7, 8). Most dietry NASH studies hve utilized long-chin sturted fts s prt of solid high-ft diets (1, 13, 56, 72). The role of mcronutrient composition in NAFLD development remins n re of considerble disgreement between investigtors (1,

13 A C EFFECT OF FATTY ACIDS ON NAFLD Corn Oil Olive Oil Corn Oil Olive Oil B D 185 Apob Acdsb Cyp323/31 Cyp41 Fsn Acox1 Decr2 Cyp2c7 Mp2k1 Acox3 Cdo1 Cyp12 Agtr1 Aldh61 Etfdh Gsr Aldh32 Cyp2c Pdh1 Adh1 Adh7 Lyn Uqcrfs1 Pzp Rho Fn1 Cyp2c37 Mpk14 Gpd1 Grhpr Txnrd1 Gpdh Plg Hdh Mpk1 Ndufs1 Nqo1 Por Cd36 Sod1 Id3 Apo4 Scd1 Aldh11 Egr1 Cyp2b3 Ednrb Agt Ndufv3 Dcn Hsd17b8 Prkcb Pthr1 Il18 Fdx1 Add3 Ccl5 Prodh2 Slk Vt1 Mrlc2 Ntf3 P2ry2 7% CO 7% OO { { EGR-1 Normlized EGR % Corn Oil 7% Olive Oil Fig. 7. Microrry results for rts exposed to 7% OO nd 7% CO vi totl enterl nutrition for 21 dys. Dt re bsed on nlysis using RGU34A GeneChip microrrys of 3 mrna pools prepred from ech tretment group with n 1 2 livers/pool. A: hierrchicl clustering for genes exhibiting 1.5-fold chnge, B: het mp for genes involved in metbolic redox process. C: pthwy nlysis of relevnt genes expressed t higher level in the 7% OO group (red) nd expressed t lower level in the 7% OO group (green) reltive to the 7% CO group. D: Western blot nd immunoquntittion of heptic Egr-1 protein expression compring 7% OO nd 7% CO groups, P.5. 7, 13, 15, 3, 35, 4, 56, 72). Studies of lcoholic liver injury, which is pthologiclly very similr to NAFLD/NASH, hve suggested tht both short- nd long-chin sturted FA diets re protective ginst development of both stetosis nd progression of injury nd tht the more unsturted the dietry ftty cid, the more severe the liver injury (43, 44, 49). However, only reltively smll number of studies hve exmined the effects of dietry ft composition on development of NAFLD. Liver pthology differed drmticlly with dietry ft content nd type. For exmple, in the ft, high crbohydrtediet groups, the CO nd EO diets produced low levels of stetosis reltive to OO. In the CO group, this ppered to reflect lower levels of FA import nd lower rte of FA synthesis. Supplementtion of high crbohydrte diets with oils like CO, which re rich in -6 PUFAs hve previously been shown to result in reduced expression of lrge number of lipogenic genes such s FASN nd ACC (19, 2, 26). At lest

14 186 EFFECT OF FATTY ACIDS ON NAFLD A B Fig. 8. Liver pthology results for experiment 2 compring mle rts fed AIN-93G pelleted control diet d libitum with rts overfed 7% OO diets vi totl enterl nutrition for 5 dys. A: representtive H&E-stined control liver ( 1). B: representtive H&E-stined 7% OO liver ( 1). C: pthology scores for inflmmtion necrosis, lipidosis, nd totl pthology. Dt re mens SE for n 1 control nd n 6 7% OO livers, P.5 OO vs. control. D: mrna expression in control nd 7% OO livers. TNF, tumor necrosis fctor lph; TGFb, trnsforming growth fctor bet; Col13, collgen 13; CD45/ CD85, cell surfce mrker rtio is mesure of leukocyte ctivtion nd heptic infiltrtion; SMA, smooth muscle ctin; PDGFRb, pltelet-derived growth fctor receptor bet. Dt re mens SE for n 1 control nd n 6 7% OO livers, P.5 OO vs. control. Pthology Score C Inflmmtion + Necrosis Lipidosis Totl Pthology Score CONTROL OO Vlues Normlized to 18S D TNF TGFb Col13 CD45 CD68 CD68/CD45 Control OO SMA PDGFRb prt of the effect of CO ppers to be due to reduced nucler expression of the trnscription fctor ChREBP, which is positive regultor of lipogenesis. This is consistent with studies from Dentin et l. (2) demonstrting inhibition of ChREBP signling nd nucler trnsloction in crbohydrte-fed mice fsted for 24 h nd then switched to diet high in linolete. Consistent with previous studies suggesting -6 PUFAs lso interfere with SREBP-1c gene trnscription nd proteolytic processing (11, 17, 31), in the current study we observed tht dietry CO reduced nucler SREBP-1c protein concentrtions nd binding to the FASN promoter in the diets reltive to OO. These dt suggest tht differences in FA synthesis cn lso be ttributed to possible effects of CO on SREBP-1c ctivtion nd recruitment of coctivtors to the SREBP-1c response element. SREBP-1c hs been shown to undergo extensive posttrnsltionl modifictions including phosphoryltion, cetyltion, nd sumoyltion, which cn lter its trnscriptionl ctivity (4, 9, 51). In ddition, severl SREBP-1c coctivtors hve been identified, including the Sp1 protein fmily nd PGC-1 (6, 32). We observed higher expression of mrna encoding PGC-1 in the OO compred with CO group. However, detiled exmintion of the effects of FA type on SREBP-1c signling nd the potentil role of PGC-1 in this process will require dditionl studies. The signling mechnisms underlying such lrge differences in ChREBP nd SREBP-1c signling nd heptic FA homeostsis produced by vritions in the FA composition of only of the diet remin uncler. Arry nlysis suggested tht differences in MAP kinse-medited phosphoryltion ptterns or chnges in PPAR or retinoid signling pthwys my ply role. In ddition, FAs themselves, their thiolesters nd oxidtion products produced by the ction of cytochrome P45, cyclooxygense, nd lipoxygense enzymes, hve ll been suggested to ct s signling molecules regulting gene trnscription (17, 24, 26, 57). A drmtic increse in expression of the FA trnsporter CD36 ws observed in the 7% CO group compred with the CO group, consistent with our previous observtions using CO in this model (7). As result of this, heptic triglyceride ccumultion ws similr between FA sources with overfeeding t 7% clories. However, despite similr levels of triglycerides, the type of stetosis produced differed drmticlly. Rts overfed OO hd mcrostetosis, rts overfed CO hd mixed mcro- nd microstetosis, nd rts overfed EO hd only microstetosis. The mechnisms underlying the differences in lipid droplet size remin obscure. Although the PAT protein, perilipin, hs been reported to influence droplet size (46), perilipin ws not detected in the current study. Since the proportions of different FAs incorported in heptic triglycerides reflect the composition of FAs in dietry ft (31, 32, 74), it is possible tht the physicl stbility of heptic lipid droplets composed of triglycerides with FA chins composed minly of MUFA is greter thn tht of lipid droplets composed of triglycerides with FA chins composed minly of PUFA. The end result is smller lipid droplets with n overll increse in surfce re in 7% EO fed rts compred with the 7% CO-fed nd 7% OO-fed groups. Progression of injury beyond simple stetosis ppered to be minly linked to the susceptibility of free FAs nd FAs incorported into lipid droplets to rdicl ttck. Even though high-ft diets incresed expression of CYP2E1 nd CYP4A1, which re sources of ROS, to the sme degree, elevted serum ALT vlues