Northern blot analysis

Size: px
Start display at page:

Download "Northern blot analysis"

Transcription

1 Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C um C um Angus dipocytes expressed SCD higher thn Wgyu dipocyte fter short term (1 wk) of differentition. Both c9,t11 nd t1,c12 CLA decresed SCD nd FAS expression s the dose incresed. Northern blot nlysis RNA C Arg C Arg C Arg C Arg C Arg C Arg SCD PPAR γ C/EBP β LPL TNF α Pref 1 Control Arg CLA Arg + CLA SCD, PPARγ, nd LPL were greter in predipocytes incubted with rginine thn in control. RNA SCD RNA PPAR γ Control Arg CLA Arg + CLA t1,c12 CLA decresed SCD gene expression nd not overcome by coincubting with rginine. TTU AFS 44/55 1

2 Metbolic nlysis Ftty cid composition Lipogenesis f MUFA/SFA (SCD index) Rtio o SCD index pmol/cell/2h C cette incorportion Control 5uM c9,t11 4uM c9,t11 5uM t1,c12 4uM t1,c12 Control 5uM c9,t11 4uM c9,t11 5uM t1,c12 4uM t1,c12 Postntl Adipose Tissue Models to study deposition Jpnese Blck vs. Angus Beef mrbling score: (Jpnese) 12 CAB crcsses pprox. 4 5 on Jpnese scle 1 12 equls greter thn 2% extrctble lipid in L.D. muscle vs % EE for USDA Prime TTU AFS 44/55 2

3 Animl Growth Rte 7 6 Corn-Angus Corn-Wgyu Hy-Angus Hy-Wgyu Body Weight, Kg st group (corn) 2 nd group (hy) 3 rd group (corn) 4 th group (hy) Trget weight Corn: 1.36 kg/d to 325 kg/8mo Hy:.9 kg/d to 325 kg/12mo 2 1 U.S. Endpoint Jpn Endpoint Dys on feed Crcss chrcteristics ) Percen ntge of ft content (IML 25 Corn Angus Hy Angus Corn Wgyu 2 Hy Wgyu 15 Prime + 1 Prime - Choice + 5 Choice - U.S. endpoint Jpn endpoint Time on Feed (mo) Angus fed corn hd greter IML thn hy nd Wgyu fed corn. Hy-fed Wgyu (Jpn endpoint) hd greter IML thn other diet group. Wgyu hd low finl body weights. P-vlue Endpoint : P<.1 B*E : P<.5 B*D : P<.5 TTU AFS 44/55 3

4 SCD enzyme ctivity vs. Time royl-coa desturse ctivity, mol per 7min per mg protein Ste Nm Hy Angus Corn Angus Incresed between the H A Corn Wgyu Hy Wgyu U.S. endpoint Time on Feed (mo) Jpn endpoint U.S. nd Jpnese endpoint, but not in the hy-fed Angus steers. Incresed most in hy- bsed Wgyu steers. P-vlue Endpoint : P=.6 D*E : P=.8 B*D*E : P=.8 SCD gene expression vs. Time SCD:28S RNA Corn Angus Hy Angus Corn Wgyu Hy Wgyu U.S. endpoint Jpn endpoint Time on Feed (mo) Greter in corn-fed steers Incresed most in Wgyu steers, but decresed with time in Angus steers. P-vlue Diet : P=.6 Endpoint : P=.7 D*E : P=.5 B*E : P=.1 TTU AFS 44/55 4

5 Postntl Adipose Tissue When looking t these nimls to study intrmusculr ft lrger dipocytes more dipocytes these were the predominnt theories they found tht dipocyte size is ctully less in Wgyuthn Angus Postntl Adipose Tissue Numbers of dipocytes re different rte ofpredipoc predipocyte prolifertion ws twice s high in both subcutneous nd intrmusculr dipose tissue from Wgyu vs. Angus cttle Jpnese Blck hve the bility to ccumulte IM lipid seemingly indefinitely Angus hve genetic limittions in predipocyte p differentition/prolifertion TTU AFS 44/55 5

6 Postntl Adipose Tissue Numbers of dipocytes re different rte ofpredipoc predipocyte prolifertion ws twice s high in both subcutneous nd intrmusculr dipose tissue from Wgyu vs. Angus cttle Jpnese Blck hve the bility to ccumulte IM lipid seemingly indefinitely Angus hve genetic limittions in predipocyte p differentition/prolifertion Hormone Production Adipose tissue s n endocrine tissue now more hormones produced in dipose tissue thn the nterior pituitry Leptin 16 kd protein secreted from white dipocytes belongs to clss of helicl cytokines similr to IL 2 nd GH four lph helicl bundle structures 1995 ob protein leptin dministrtion could eliminte obesity in the ob /ob mouse (ob protein = leptin) TTU AFS 44/55 6

7 Hormone Production Long-term signls regulting energy blnce. Insulin nd leptin re the two hormones tht ct s long-term regultors of food intke nd energy blnce. Both insulin nd leptin ct in the centrl nervous system to inhibit food intke nd to increse energy expenditure. Activtion of the sympthetic nervous system (SNS) is likely to contribute to the increse in energy expenditure. (Hvel et l. 2.) Hormone Production AgRP: Agouti-relted protein Arc: rcute nucleus CART: cocine nd mphetmine relted trnscript MC4R: melnocortin 4 receptor NPY: neuropeptide Y POMC: proopiomelnocortin PVN: prventriculr nucleus VMN: ventromedil nucleus. TTU AFS 44/55 7

8 ob muttion Leptin Receptor Receptor high h ffinity it severl splice vrints of single gene long form contins 32 mino cids in intrcellulr domin expressed in vrious regions of the brin ctegorized s clss I cytokine receptor (much like IL 6, LIF) TTU AFS 44/55 8

9 Leptin Signling Signl trnsduction pthwys of clss I cytokine receptors typiclly lck intrinsic tyrosine kinse ctivity ctivtion usully occurs following formtion of homodimers leptin ctully forms homodimers ggregtion ctivtes JAK/STAT pthwy JAK = Jnus Kinse STAT = signl trnsducers nd ctivtors of trnscription Leptin Leptin tretment (exogenous ddition) dose dependent decrese in food intke loss of body weight loss of ft depots incresed metbolic rte TTU AFS 44/55 9

10 Leptin Leptin is synthesized/secreted from white dipocytes exmple of dipose tissue cting s n endocrine tissue cting on other tissues (brin e.g.) promoter of region of Leptin gene contins sites for C/EBP α nd PPAR γ; therefore, dipose specific gene incresed leptin hs negtive feedbck loop on dipocytes to decrese the leptin production discovered in 21 Resistin expression reduced by TZDs C/EBP responsive gene Biologicl ctivities impirment of glucose tolernce ntgonism of glucose uptke inhibition of 3T3-L1 differentition TTU AFS 44/55 1

11 discovered in 1995 Adiponectin secreted by differentited dipocytes models of insulin resistnce hve reduced diponectin levels exogenous diponectin cn stimulte ftty cid oxidtion by skeletl muscle secretion is stimulted by TZDs TNFα TNFα (pro inflmmtory cytokine) synthesized in neutrophils, ctivted T nd B lymphocytes AND dipocytes neutrophils, T nd B lymphocytes endocrine fshion dipocytes prcrine/utocrine effect polypeptide = 157 mino cids(humn) = 17 kd species vrition incresed no signl peptide but it is nchored to membrne nd relesed in soluble form TTU AFS 44/55 11

12 TNFα TNFα Receptors (two distinct) TNFR I (55 kd) single trnsmembrne glycoprotein TNFR II (75 kd) single trnsmembrne glycoprotein both hve similr extrcellulr domin but highly distinct intrcellulr domins tht led to unrelted, different dignl trnsduction pthwys Stellite cell development nd differentition Stellite cell Trnsdifferentition Prolifertion Fuse TTU AFS 44/55 12

13 In vitro mrbling study Stellite cell Prolifertion (MUFA,PUFA) Long chin ftty cid (Ciglitzone, Troglitzone, T-174) Thizolidinedione Horse Serum Long chin ftty cid (PUFA) Trnsdifferentition Differentition Gene experession during trnsdifferentition Muscle derived cell Trnsdifferentition Predipocyte Differentition Adipocyte Erly Intermedite Lte Trnscriptionl ctivtion ADD1/ SREBP1 C/EBPβ Lignds C/EBPα PPAR RXR Fctors binding region Leptin SCD Adipose gene expression Functionl Activtion TNF α FAS TTU AFS 44/55 13

14 BSC trnsdifferentition Arbit. Rtio C/EBP β ( P =.8) Arbit. Rtio PPAR γ ( P <.1) Arbit. Rtio Myogenin ( P <.1) BSC trnsdifferentition nd growth promotnts * Arbit. Rtio * C/EBP β * ( P <.3) E2 : Estrdiol MGA : Melnegesterol Acette M+E: MGA + E2 Tretment TTU AFS 44/55 14

15 BSC trnsdifferentition nd growth promotnts * Arbit. Rtio PPAR γ * ( P <.5) E2 : Estrdiol MGA : Melnegesterol Acette M+E: MGA + E2 Tretment BSC trnsdifferentition nd growth promotnts Arbit. Rtio SCD * ( P =.5) E2 : Estrdiol MGA : Melnegesterol Acette M+E: MGA + E2 Tretment TTU AFS 44/55 15

16 BSC trnsdifferentition nd growth promotnts Arbit. Rtio Myogenin * ( P =.5) E2 : Estrdiol MGA : Melnegesterol Acette M+E: MGA + E2 Tretment BSC trnsdifferentition nd growth promotnts Positive Control : Insulin, Oleic cid, nd Ciglitizone 1nM estrdiol 2nM 17β trenbolone 1nM Melengestrol cette TTU AFS 44/55 16

17 Muscle Biopsy Study Muscle Biopsy Study TTU AFS 44/55 17

18 BSC trnsdifferentition in Biopsy study NA, dnce C/EBPβ mr reltive bund b PPARγ mrn NA, reltive bund dnce b Dy Dy 7 Dy 14 Dy 28 Dy Dy 7 Dy 14 Dy 28 Muscle biopsy dte Muscle biopsy dte e SCD mrna, reltive bundnce 5 b 4 b e Myogenin mrna, reltive bundnce Dy Dy 7 Dy 14 Dy 28 Dy Dy 7 Dy 14 Dy 28 Muscle biopsy dte Muscle biopsy dte BSC trnsdifferentition in Biopsy study C/EBPβ mrn NA, reltive bund dnce b A, dnce PPARγ mrn reltive bund b b Cont E2 TBA T+E Tretment Cont E2 TBA T+E Tretment e SCD mrna, reltive bundnce b e Myogenin mrna, reltive bundnce 2 1 Cont E2 TBA T+E Cont E2 TBA T+E Tretment Tretment TTU AFS 44/55 18

* * * * * liver kidney ileum. Supplementary Fig.S1

* * * * * liver kidney ileum. Supplementary Fig.S1 Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).

More information

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat

The effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA

More information

Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK

Cyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK 3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α

More information

2018 American Diabetes Association. Published online at

2018 American Diabetes Association. Published online at Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison

More information

Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue

Expression of Three Cell Cycle Inhibitors during Development of Adipose Tissue Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy

More information

Effect of environmental stress on biochemical and physiological features in cultured fish

Effect of environmental stress on biochemical and physiological features in cultured fish Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune

More information

Effect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice

Effect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which

More information

Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality

Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,

More information

Roughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference

Roughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.

More information

Introduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010

Introduction. Lance Baumgard. Introduction con t. Research Emphasis at AZ. Teaching and Advising. Research Emphasis at ISU 4/29/2010 Introduction Lnce Bumgrd Associte Professor Ntive of southwest Minnesot BS: U of Minnesot MS: U of Minnesot Advisor: Brin Crooker Thesis: Effects of genetic selection for milk yield on somtotropin prmeters

More information

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids

Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers

More information

EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1

EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were

More information

obesità nel bambino: epidemiologia e prevenzione

obesità nel bambino: epidemiologia e prevenzione Obesità, Nutrizione e Stili di vit. Trento 31 Mrzo 27 obesità nel bmbino: epidemiologi e prevenzione Cludio Mffeis Diprtimento Mterno Infntile e Biologi-Genetic Sezione di Peditri - Università di Veron

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Inhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin

Inhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2012 Inhibition of dipocyte differentition in 3T3-L1 cell line by quercetin or isorhmnetin Din Gbriel Crvjl-Aldz Louisin Stte

More information

Overview: The Cellular Internet. General Biology. 7. Cell Communication & Signalling

Overview: The Cellular Internet. General Biology. 7. Cell Communication & Signalling Course o: BG00 Credits:.00 Generl Biology Overview: The Cellulr Internet Cell-to-cell communiction is bsolutely essentil for multicellulr orgnisms Biologists hve discovered some universl mechnisms of cellulr

More information

Effect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1

Effect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1 Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5

More information

ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,

ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum, DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,

More information

USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS

USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two

More information

Hormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.

Hormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L. Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,

More information

ENERGY CONTENT OF BARLEY

ENERGY CONTENT OF BARLEY ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree

More information

Effects of Rosiglitazone on Inflammation in Otsuka Long-Evans Tokushima Fatty Rats

Effects of Rosiglitazone on Inflammation in Otsuka Long-Evans Tokushima Fatty Rats Originl Article Koren Dibetes J 21;34:191-199 doi: 1.493/kdj.21.34.3.191 pissn 1976-918 eissn 293-265 Effects of Rosiglitzone on Inflmmtion in Otsuk Long-Evns Tokushim Ftty Rts Jin Woo Lee 1, Il Seong

More information

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens

Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler

More information

Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids

Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids Project Summary Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids Principal Investigators: S. Smith 1, B. Johnson 2 and M. Doumit 3 Texas A&M University 1, Texas Tech University

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1

More information

A. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5

A. Kinoshita 1, L. Locher 2, R. Tienken 3, U. Meyer 3, S. Dänicke 3, J. Rehage 4, K. Huber 5 Effects of dietry nicin supplementtion on heptic expression of FoxO nd genes involved in glucose production in diry cows during the trnsition period A. Kinoshit, L. Locher, R. Tienken 3, U. Meyer 3, S.

More information

Supplementary figure 1

Supplementary figure 1 Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22

More information

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO

Ulk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1

More information

Interleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes

Interleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,

More information

Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar)

Inflammatory responses in primary muscle cell cultures in Atlantic salmon (Salmo salar) Pooley et l. BMC Genomics 213, 14:747 http://www.iomedcentrl.com/1471-2164/14/747 ESEACH ATICLE Open Access Inflmmtory responses in primry muscle cell cultures in Atlntic slmon (Slmo slr) Nichols J Pooley

More information

Molecular Pharmacology Fast Forward. Published on June 1, 2010 as DOI: /mol

Molecular Pharmacology Fast Forward. Published on June 1, 2010 as DOI: /mol Moleculr Phrmcology Fst Forwrd. Published on June 1, 2010 s DOI: 10.1124/mol.110.065508 Moleculr Phrmcology This rticle hs not Fst been Forwrd. copyedited nd Published formtted. The on finl June version

More information

British Journal of Nutrition

British Journal of Nutrition (11), 16, 1449 1456 q The Authors 11 doi:1.117/s71145111917 Fish oil comined with SCFA synergisticlly prevent tissue ccumultion of NEFA during weight loss in oese mice Miken H. Pedersen 1,, Lotte Luritzen

More information

TNF-α (pg/ml) IL-6 (ng/ml)

TNF-α (pg/ml) IL-6 (ng/ml) Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6

More information

You only get to change two things: the cardiac output and the resistance of the vasculature

You only get to change two things: the cardiac output and the resistance of the vasculature Vsculr Biology 3 Regultion of Flow nd Pressure A. Arteril Pressure (oeriew) 1. Arteril pressure pulse 2. Men rteril pressure 2 MAP 1 P + s P 3 3 d MAP = men rteril pressure, P s = systolic pressure, P

More information

Compound K attenuates glucose intolerance and hepatic steatosis through AMPK-dependent pathways in type 2 diabetic OLETF rats

Compound K attenuates glucose intolerance and hepatic steatosis through AMPK-dependent pathways in type 2 diabetic OLETF rats ORIGINAL ARTICLE Koren J Intern Med 218;33:347-355 Compound K ttenutes glucose intolernce nd heptic stetosis through AMPK-dependent pthwys in type 2 dibetic OLETF rts Yoo-Cheol Hwng 1, D-Hee Oh 1, Moon

More information

ROLE OF CALCIUM IN ACTIVATION OF ESTROGEN RECEPTOR-α

ROLE OF CALCIUM IN ACTIVATION OF ESTROGEN RECEPTOR-α ROLE OF CALCIUM IN ACTIVATION OF ESTROGEN RECEPTOR-α A Disserttion submitted to the Fculty of the Grdute School of Arts nd Sciences of Georgetown University in prtil fulfillment of the requirements for

More information

Effect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows

Effect of Oral Administration of Propylene Glycol on Serum Glucose Concentrations in Periparturient Dairy Cows Ksetsrt J. (Nt. Sci.) 37 : 145-149 (2003) Effect of Orl Administrtion of Propylene Glycol on Serum Glucose Concentrtions in Periprturient Diry Cows Theer Rukkwmsuk, Nrongpol Petploi, Ing-orn Preechnvinit,

More information

Supplementary Figure 1

Supplementary Figure 1 Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.

More information

Martinez-Rubio et al. BMC Genomics 2014, 15:462

Martinez-Rubio et al. BMC Genomics 2014, 15:462 Mrtinez-Rubio et l. BMC Genomics 2014, 15:462 RESEARCH ARTICLE Open Access Effects of functionl feeds on the lipid composition, trnscriptomic responses nd pthology in hert of Atlntic slmon (Slmo slr L.)

More information

Regulating Hypothalamus Gene Expression in Food Intake: Dietary Composition or Calorie Density?

Regulating Hypothalamus Gene Expression in Food Intake: Dietary Composition or Calorie Density? Originl rticle Obesity nd Metbolic Syndrome Dibetes Metb J 7;4:-7 https://doi.org/.493/dmj.7.4.. pissn 33-679 eissn 33-687 DIETES & METOLISM JOURNL Regulting Hypothlmus Gene Expression in Food Intke: Dietry

More information

Role of hydroxytyrosol in ameliorating effects of high fat

Role of hydroxytyrosol in ameliorating effects of high fat Role of hydroxytyrosol in meliorting effects of high ft diet on mle rts CNS Hyder A. N. Al-Zmely, Zen Shkir Mhmoud Al -Tmemi Dept. of physiology nd biochemistry, College of veterinry Medicine, AL-Qssim

More information

Myricetin Ameliorates Defective Post-Receptor Insulin Signaling via

Myricetin Ameliorates Defective Post-Receptor Insulin Signaling via Evidence-Bsed Complementry nd Alterntive Medicine Volume 211, Article ID 15752, 9 pges doi:1.193/ecm/neq17 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi β-endorphin Signling in

More information

Type II monocytes modulate T cell-mediated central nervous system autoimmunity

Type II monocytes modulate T cell-mediated central nervous system autoimmunity Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.

More information

doi: /s British Journal of Nutrition (2016), 115, The Authors 2016

doi: /s British Journal of Nutrition (2016), 115, The Authors 2016 British Journl of Nutrition (2016), 115, 2236 2245 The Authors 2016 doi:10.1017/s0007114516000842 Supplementtion of rnched-chin mino cids to reduced-protein diet improves growth performnce in piglets:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:

More information

Myricetin Ameliorates Defective Post-Receptor Insulin Signaling via b-endorphin Signaling in the Skeletal Muscles of Fructose-Fed Rats

Myricetin Ameliorates Defective Post-Receptor Insulin Signaling via b-endorphin Signaling in the Skeletal Muscles of Fructose-Fed Rats ecam Advnce Access published Mrch 3, 2010 ecam 2010;Pge 1 of 9 doi:10.1093/ecm/neq017 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi b-endorphin Signling in the Skeletl Muscles

More information

Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)

Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model) Ingestive Behaviors 21 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical

More information

A study of the chicken IFN lambda system

A study of the chicken IFN lambda system A study of the chicken IFN system by Andres Rohringer B.Sc., M.Sc. Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy School of Medicine Dekin University August, 2016 Funding

More information

MBB317. Dr D MANGNALL OBESITY. Lecture 2

MBB317. Dr D MANGNALL OBESITY. Lecture 2 MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular

More information

Livestock Science 140 (2011) Contents lists available at ScienceDirect. Livestock Science. journal homepage:

Livestock Science 140 (2011) Contents lists available at ScienceDirect. Livestock Science. journal homepage: Livestock Science 140 (2011) 111 116 Contents lists ville t ScienceDirect Livestock Science journl homepge: www.elsevier.com/locte/livsci Effects of dietry protein/crohydrte rtio on ft deposition nd gene

More information

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number

Clinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess

More information

Randomized Controlled Trial to Improve Adiposity, Inflammation, and Insulin Resistance in Obese African-American and Latino Youth

Randomized Controlled Trial to Improve Adiposity, Inflammation, and Insulin Resistance in Obese African-American and Latino Youth nture publishing group rticles Rndomized Controlled Tril to Improve Adiposity, Inflmmtion, nd Insulin Resistnce in Obese -Americn nd Ltino Youth Rebecc E. Hsson 1, Tnj C. Adm 1, Jimie N. Dvis 1, Louise

More information

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons

Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized

More information

EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS

EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Effects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle

Effects of Recombinant Bovine Somatotropin Administration at Breeding on the Cow, Conceptus and Subsequent Offspring Performance of Beef Cattle Effects of Recominnt Bovine Somtotropin Administrtion t Breeding on the Cow, Conceptus nd Susequent Offspring Performnce of Beef Cttle V. R. G. Mercdnte 1, F. M. Cirico 1, D. D. Henry 1, P. L. P. Fontes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE

More information

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Project Summary. Principal Investigator: C. Krehbiel Oklahoma State University

Project Summary. Principal Investigator: C. Krehbiel Oklahoma State University Project Summary Skeletal muscle differentially influences marbling development through IGF-I and myostatin pathways in growing versus finishing beef cattle Principal Investigator: C. Krehbiel Oklahoma

More information

Departments of Anatomy, Physiology, and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, AL 36849, USA 2

Departments of Anatomy, Physiology, and Pharmacology, College of Veterinary Medicine, Auburn University, Auburn, AL 36849, USA 2 Hindwi Publishing Corportion PPAR Reserch Volume 2008, Article ID 651419, 10 pges doi:10.1155/2008/651419 Reserch Article Activtion of Penile Prodipogenic Peroxisome Prolifertor-Activted Receptor γ with

More information

Soybean Hulls as an Alternative Feed for Horses

Soybean Hulls as an Alternative Feed for Horses Animl Industry Report AS 650 ASL R1931 2004 Soyben Hulls s n Alterntive Feed for Horses Josie Booth Iow Stte University Howrd Tyler Iow Stte University Peggy Miller-Auwerd Iow Stte University Jenette Moore

More information

SOME MECHANISTIC CONCEPTS IN ELECTROPHILIC ADDITION REACTIONS TO C=C BONDS

SOME MECHANISTIC CONCEPTS IN ELECTROPHILIC ADDITION REACTIONS TO C=C BONDS SM MANISTI NPTS IN LTPILI AITIN ATINS T = BNS The = ond is considered to e wek se/nucleophile. The high concentrtion of electron density mkes the pi ond Lewis se, ut in order to donte electrons the pi

More information

Empower Preventive Medicine. Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL

Empower Preventive Medicine. Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL Empower Preventive Medicine Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL 32217 904-367-4005 Drtim@emprevmed.com Obesity Medicine Old paradigm: Obesity was a matter of willpower,

More information

TLR7 induces anergy in human CD4 + T cells

TLR7 induces anergy in human CD4 + T cells TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is

More information

Fasting alters histone methylation in paraventricular nucleus through regulating of polycomb repressive complex 2. Ying Jiang

Fasting alters histone methylation in paraventricular nucleus through regulating of polycomb repressive complex 2. Ying Jiang Fsting lters histone methyltion in prventriculr nucleus through regulting of polycom repressive complex 2 Ying Jing Disserttion sumitted to the fculty of the Virgini Polytechnic Institute nd Stte University

More information

Chapter 5: The peripheral nervous system Learning activity suggested answers

Chapter 5: The peripheral nervous system Learning activity suggested answers Chpter 5: The peripherl nervous system Lerning ctivity suggested nswers Lerning Activity 5.1 (p. 222) 1 Briefly descrie the two min functions of the somtic nervous system. Description should refer to:

More information

DOI /mnfr

DOI /mnfr 3 Mol. Nutr. Food Res. 15, 59, 3 35 DOI 1.1/mnfr.1399 RESEARCH ARTICLE Ursolic cid improves lipid nd glucose metolism in high-ft-fed C57BL/6J mice y ctivting peroxisome prolifertor-ctivted receptor lph

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

NCBA Ground Beef Diet/Health Study

NCBA Ground Beef Diet/Health Study NCBA Ground Beef Diet/Health Study Stephen B. Smith Department of Animal Science Rosemary L. Walzem Department of Poultry Science Texas A&M University Assumptions: Corn-fed beef is healthier than pasture-fed

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity

More information

Metabolic Syndrome: Bad for the Heart and Bad for the Brain? Kristine Yaffe, MD Univ. of California, San Francisco

Metabolic Syndrome: Bad for the Heart and Bad for the Brain? Kristine Yaffe, MD Univ. of California, San Francisco Metabolic Syndrome: Bad for the Heart and Bad for the Brain? Kristine Yaffe, MD Univ. of California, San Francisco Why would diabetes and obesity be bad for the brain? Insulin receptors in brain Insulin

More information

Activation of Skeletal Muscle Casein Kinase 11 by Insulin is not Diminished in Subjects with Insulin Resistance

Activation of Skeletal Muscle Casein Kinase 11 by Insulin is not Diminished in Subjects with Insulin Resistance Activtion of Skeletl Muscle Csein Kinse 11 by Insulin is not Diminished in Subjects with Insulin Resistnce Ryo Med, Itmr Rz, Frncesco Zurlo, nd Jmes Sommercorn Clinicl Dibetes nd Nutrition Section, Ntionl

More information

Leptin induces TGF-b synthesis through functional leptin receptor expressed by human peritoneal mesothelial cell

Leptin induces TGF-b synthesis through functional leptin receptor expressed by human peritoneal mesothelial cell originl rticle http://www.kidney-interntionl.org & 2006 Interntionl Society of Nephrology Leptin induces TGF- synthesis through functionl leptin receptor expressed y humn peritonel mesothelil cell JCK

More information

Dietary fat source alters hepatic gene expression profile and determines the type of liver pathology in rats overfed via total enteral nutrition

Dietary fat source alters hepatic gene expression profile and determines the type of liver pathology in rats overfed via total enteral nutrition Physiol Genomics 44: 173 189, 212. First published September 18, 212; doi:1.1152/physiolgenomics.69.212. Dietry ft source lters heptic gene expression profile nd determines the type of liver pthology in

More information

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity

ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.

More information

Type 2 diabetes is characterized by hyperglycemia,

Type 2 diabetes is characterized by hyperglycemia, ORIGINL RTICLE Ftty cid Incubtion of Myotubes From Humns With Type Dietes Leds to Enhnced Relese of -Oxidtion Products ecuse of Impired Ftty cid Oxidtion Effects of Tetrdecylthiocetic cid nd Eicospentenoic

More information

THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS

THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY

More information

Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids

Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress

More information

SPHINGOLIPIDS INTRODUCTION TO SPHINGOLIPIDS AND RAFTS. 1. Sphingolipids

SPHINGOLIPIDS INTRODUCTION TO SPHINGOLIPIDS AND RAFTS. 1. Sphingolipids SPHINGOLIPIDS INTRODUCTION TO SPHINGOLIPIDS AND RAFTS 1. Sphingolipids The sphingolipids comprise complex rnge of lipids in which ftty cids re linked vi mide bonds to long-chin bse or sphingoid. The root

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.

More information

Effects of phospholipids and HUFA levels on ontogene7c development and performance of pikeperch (Sander lucioperca) larvae

Effects of phospholipids and HUFA levels on ontogene7c development and performance of pikeperch (Sander lucioperca) larvae Effects of phospholipids nd HUFA levels on ontogene7c development nd performnce of pikeperch (Snder lucioperc) lrve DTU Aqu, FUNDP, ULPGC ACM 2017 Brcelon, Jnury 2017 The outcome of the experiments should

More information

Dr. Javier Polo Vice President Research & Development

Dr. Javier Polo Vice President Research & Development Efecto de l suplementción con concentrdo de inmunoglobulins prtir del suero bovino en l Microbiot y su contribución l slud intestinl y l sistem nervioso centrl Dr. Jvier Polo Vice President Reserch & Development

More information

Insulin-Leptin Interactions

Insulin-Leptin Interactions Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling

More information

Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)

Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model) Ingestive Behaviors 33 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical

More information

Induction of peroxisomal lipid metabolism in mice fed a high-fat diet

Induction of peroxisomal lipid metabolism in mice fed a high-fat diet MOLECULAR MEDICINE REPORTS 4: 1157-1162, 2011 Induction of peroxisoml lipid metbolism in mice fed high-ft diet SACHI KOZAWA 1,4, AYAKO HONDA 1, NAOMI KAJIWARA 1, YASUHIKO TAKEMOTO 1, TOMOKO NAGASE 1, HIDEKI

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION . Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,

More information

Atlantic halibut larval nutrition and the drivers of pigmentation and eye migration in flounders. Kristin Hamre. MH (mm) Drawing: Øystein Sæle (2003)

Atlantic halibut larval nutrition and the drivers of pigmentation and eye migration in flounders. Kristin Hamre. MH (mm) Drawing: Øystein Sæle (2003) 8.5 8.0 7.5 MH (mm) 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 Stge 9 Stge 8 Stge 7 Atlntic hlibut lrvl nutrition nd the drivers of pigmenttion nd eye migrtion in flounders Kristin Hmre 2.5 Stge 6 2.0 1.5 Stge

More information

Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection

Supplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine

More information

The Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers

The Effects of High-Oil Corn or Typical Corn with or without Supplemental Fat on Diet Digestibility in Finishing Steers Beef Reserch Report, 2000 Animl Science Reserch Reports 2001 The Effects of High-Oil Corn or Typicl Corn with or without Supplementl Ft on Diet Digestibility in Finishing Steers Crig R. Belknp Iow Stte

More information

R-α-Lipoic acid and acetyl-l-carnitine complementarily promote mitochondrial biogenesis in murine 3T3-L1 adipocytes

R-α-Lipoic acid and acetyl-l-carnitine complementarily promote mitochondrial biogenesis in murine 3T3-L1 adipocytes Dietologi (28) 51:165 174 DOI 1.17/s125-7-852-4 ARTICLE R-α-Lipoic cid nd cetyl-l-crnitine complementrily promote mitochondril iogenesis in murine 3T3-L1 dipocytes W. Shen & K. Liu & C. Tin & L. Yng &

More information

39 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /1, No. 0,,0-,01 (,*+*)

39 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /1, No. 0,,0-,01 (,*+*) 39 Nippon Shokuhin Kgku Kogku Kishi Vol. /1, No. 0,,0-,01 (,*+*) 263 * Tkko Ymd, Tetsuo Iid, Noriko Hyshi, 0 1 23 +* ++ + 0 -ribo-,-hexulose :, HL -. 0 3132 * 00. 2/*2 / - * 10+ *13/,-3- Corresponding

More information

British Journal of Nutrition

British Journal of Nutrition British Journl of Nutrition (215), 113, 1862 1875 q The Authors 215 doi:1.117/s7114515121x Anormlities in myo-inositol metolism ssocited with type 2 dietes in mice fed high-ft diet: enefits of dietry myo-inositol

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE

EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.

More information