Innate immune response to a H3N2 subtype swine influenza virus in newborn porcine trachea cells, alveolar macrophages, and precision-cut lung slices

Transcription

1 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 VETERINARY RESEARCH RESEARCH Open Access Innte immune response to H3N2 sutype swine influenz virus in neworn porcine trche cells, lveolr mcrophges, nd precision-cut lung slices Mrio Delgdo-Orteg 1,2, Sndrine Melo 1,2, Drsniy Punydrsniy 3, Christelle Rmé 4, Michel Olivier 1,2, Denis Souieux 1,2, Dniel Mrc 1,2, Gëlle Simon 5,6, Georg Herrler 7, Mustph Berri 1,2, Joëlle Dupont 4 nd Frnçois Meurens 8* Astrct Virl respirtory diseses remin of mjor importnce in swine reeding units. Swine influenz virus (SIV) is one of the min known contriutors to infectious respirtory diseses. The innte immune response to swine influenz viruses hs een ssessed in mny previous studies. However most of these studies were crried out in single-cell popultion or directly in the live niml, in ll its complexity. In the current study we report the use of trche epithelil cell line (neworn pig trche cells NPTr) in comprison with lveolr mcrophges nd lung slices for the chrcteriztion of innte immune response to n infection y Europen SIV of the H3N2 sutype. The expression pttern of trnscripts involved in the recognition of the virus, interferon type I nd III responses, nd the host-response regultion were ssessed y quntittive PCR in response to infection. Some significnt differences were oserved etween the three systems, notly in the expression of type III interferon mrna. Then, results show cler induction of JAK/STAT nd MAPK signling pthwys in infected NPTr cells. Conversely, PI3K/Akt signling pthwys ws not ctivted. The inhiition of the JAK/STAT pthwy clerly reduced interferon type I nd III responses nd the induction of SOCS1 t the trnscript level in infected NPTr cells. Similrly, the inhiition of MAPK pthwy reduced virl repliction nd interferon response. All together, these results contriute to n incresed understnding of the innte immune response to H3N2 SIV nd my help identify strtegies to effectively control SIV infection. Introduction Virl respirtory diseses re still mjor helth issue in pigs rered under confined conditions on intensive reeding frms worldwide. Currently the most common virl pthogens re porcine reproductive nd respirtory syndrome virus (PRRSV), swine influenz virus (SIV), pseudories virus, nd porcine circovirus type 2 [1-3]. In the field, these viruses re usully found in ssocition with ech other or with cteri such s Actinocillus spp., Bordetell ronchiseptic, Hemophilus prsuis, Mycoplsm hyopneumonie, Psteurell multocid, * Correspondence: frncois.meurens@ussk.c 8 Vccine nd Infectious Disese Orgniztion-InterVc, University of Ssktchewn, 12 Veterinry Rod, S7N 5E3 Ssktoon, Ssktchewn, Cnd Full list of uthor informtion is ville t the end of the rticle nd Streptococcus suis [1,3-5]. In prticulr, influenz A viruses re mjor cuse of cute respirtory disese on pig reeding frms [6]. Usully, the disese is chrcterized y depression, loss of ppetite, dominl rething, tchypne, fever, nd less often, coughing. Moridity ssocited with the virus is high nd mortlity is often very low [6]. Influenz A viruses re clssified into sutypes sed on the ntigenicity of their hemgglutinin (HA) nd their neurminidse (NA) surfce proteins [6]. In pigs, three sutypes re descried worldwide: H1N1, H1N2, nd H3N2 [7,8], however genetic linege my vry within ech sutype depending on the geogrphicl loction (North Americ, Europe, nd Asi). Viruses of the three sutypes hve een reported frequently in Europen pigs, often ssocited with clinicl disese [9,1]. 214 Delgdo-Orteg et l.; licensee BioMed Centrl Ltd. This is n Open Access rticle distriuted under the terms of the Cretive Commons Attriution License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly credited. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.

2 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 2 of 18 The innte immune response is crucil in the fight ginst respirtory viruses. It controls virl invsion nd repliction while the dptive response is effective for virl clernce through the ctivity of dptive immune cells such s lymphocytes [11,12]. Among innte immune cells, epithelil cells, lveolr mcrophges, nd dendritic cells provide the first line of defense [11-15]. They rpidly recognize pthogens through pttern recognition receptors (PRRs) such s Toll-like receptors (TLRs), intrcellulr virl sensors such s retinoic cidinducile gene I (RIG-I) nd melnom differentitionssocited gene 5 (MDA5), nd the nucleotide-inding domin, leucine-rich repet-contining proteins (NLRs) [16,17]. The innte immune response to SIV hs een ssessed in mny previous studies (for review see [6,16]). However, most of these studies were crried out in single-cell popultion, sometimes isolted from other species, or directly in the pig in ll its complexity mking the estlishment of cler conclusions difficult. Neworn porcine trche (NPTr) cells [18], porcine lveolr mcrophges (PAMs), nd precision-cut lung slices (PCLS) my constitute informtive nd complementry models to study the innte immune response to SIV. Respirtory epithelil cells nd PAMs re the min trget of the virus in vivo nd hve een successfully used for in vitro infection studies [6,15,16,19]. PCLS hve previously een used for infection studies in irds [2], cttle [21], nd pigs [22,23]. The PCLS culture system hs severl dvntges over other systems: the slices cn e otined in lrge numers nd the generl rchitecture of the tissue is preserved. Thus, differentited epithelil cells, which re the min trget cells of SIV, re mintined in situ nd the slices remin vile for more thn 7 dys [23]. Thus, NPTr cells, PAMs nd PCLS together enle the study of host/pthogen interctions in single-cell type popultions s well s multicellulr tissue, grnting more ccurte nlysis of the contriution of epithelil cells nd mcrophges to the glol disese response. Use of lung explnts (ie PCLS) to study SIV infection hs only een reported in few cses [23-27]. However, the focus of these studies ws not the chrcteriztion of the innte immune response to the virus. Here, we report the use of NPTr cells in comprison to PAMs nd PCLS for the study of the innte immune response to Europen H3N2 SIV. Trnscripts involved in the recognition of virl ptterns, interferon (IFN) type I nd III responses, nd regultion of the host response (suppressor of cytokine signling, SOCS) were ssessed y qpcr for their expression in response to the infection t different time points. Some significnt differences were oserved etween the three systems, notly in the expression of type III IFN mrna. For instnce, in NPTr cells nd PCLS we oserved mostly IFNβ nd IFNλ1 trnscript expression in response to the virus while in PAMs, IFN type III ws not significntly induced. The involvement of different signling pthwys such s jnus kinse (JAK)/signl trnsducer nd ctivtor of trnscription (STAT), mitogen-ctivted protein kinse (MAPK)/extrcellulr signl-regulted kinse (ERK1/2), nd phosphtidylinositide 3-kinse (PI3K)/protein kinse B (Akt) ws lso evluted in NPTr cells. Our results show cler induction of JAK/STAT nd MAPK (ERK1/2, p38) signling pthwys while the H3N2 SIV did not induce PI3K/Akt ctivtion in infected NPTr cells. The inhiition of the JAK/STAT pthwy using JAK Inhiitor I (4299) in infected NPTR cells hd cler impct on the response of IFN types I nd III nd the induction of SOCS1 t the trnscript level. All together, our dt contriute to n incresed understnding of the innte immune response of pigs to SIV. Mterils nd methods Ethics sttement Pigs used for this reserch were kept in the clinic for swine nd smll ruminnts for demonstrtion nd veterinry student trining (pprovl numer A627) or were otined from the INRA experimentl unit (Nouzilly, Frnce). A totl of 12 eight-week-old pigs (Germn Lndrce nd Lrge White) were used. Pigs were helthy nd showed no clinicl symptoms or serologicl evidence of influenz nd other respirtory or systemic diseses. All studies were crried out in ccordnce with the recommendtions of the Europen Convention for the Protection of Verterte Animls used for Experimentl nd Other Scientific Purposes (Europen Trety Series, nos. 123 [28] nd 17 [29] nd in ccordnce with the guidelines of the Institutionl Animl Cre nd Use committee t INRA (Frnce). The protocol ws pproved y the ntionl nd locl permitting uthorities (niml welfre officer of the University of Veterinry Medicine, Lower Sxony Stte Office for Consumer Protection nd Food Sfety). All experimentl mesurements were in ccordnce with the requirements of the ntionl niml welfre lw. Euthnsi nd tissue smpling were performed under sodium pentoritl nesthesi, nd ll efforts were mde to minimize suffering of the nimls. Epithelil cell line culture The neworn pig trche (NPTr, purchsed from Istituto Zooprofilttico Sperimentle, dell Lomrdi e dell Emili Romgn, Bresci, Itly) cells [18] (etween 3 nd 5 pssges) were cultured in Dulecco s modified Egle medium (DMEM) (Invitrogen, Cergy Pontoise, Frnce) supplemented with 1% fetl clf serum (FCS) (Sigm- Aldrich, Sint-Quentin, Frnce), 2 IU/mL of penicillin, nd 2 mg/ml of streptomycin (Invitrogen). Cells were plted onto sterile 24-well plstic pltes (Greiner ioone, Courtœuf, Frnce) nd incuted t 37 C in 5%

3 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 3 of 18 CO 2 humidified tmosphere. Su-pssges were mde when cells reched 1% confluence. Porcine lveolr mcrophges Porcine lveolr mcrophges (PAMs) were otined from roncho-lveolr lvge (BAL) fluid from totl of 7 eight-week-old pigs nd mintined in DMEM supplemented with 2% FCS, 14 mm 4-(2-hydroxyethyl)-1-piperzineethnesulfonic cid (HEPES) (Gico-Life Technologies SAS, Sint-Auin, Frnce),.1 mm non-essentil mino cids (Gico), 1 μg/ml gentmycin (Gico), 2 IU/mL of penicillin, nd 2 mg/ml of streptomycin (Invitrogen). Red lood cells were eliminted nd PAMs were isolted y multiple wshes nd low-speed centrifugtions. PAMs were plted onto sterile 24-well plstic pltes (Greiner io-one) nd incuted t 37 C nd 5% CO 2 for 3 h to llow mcrophges to dhere. Non-dherent cells were eliminted. PAMs represented > 9% of cells in roncho-lveolr lvge fluid s previously reported [3]. Precision-cut lung slices Precision-cut lung slices (PCLS) were prepred from the lungs of 5 eight-week-old pigs (minimum one slice/pig for ech time point). Immeditely fter euthnsi, lungs were crefully removed nd the left crnil, middle, nd cudl loes were filled with 37 C low-gelling temperture grose (GERBU Biotechnik GmH, Gierg, Germny) followed y polymeriztion on ice. Tissue ws excised in cylindricl portions (8-mm tissue-coring tool) nd roughly 2 slices/pig pproximtely 25 μm thick were prepred y using Krumdieck tissue slicer (model MD4-1, TSE systems, Chesterfield, MO, USA) with cycle speed of 6 slices/min. PCLS were incuted in 1 ml of Roswell Prk Memoril Institute medium (RPMI) 164 medium (Gico), supplemented with 1% ntiiotic/ntimycotic liquid (1X Antiiotic-Antimycotic, Gico), 1 μg/ml clotrimzole (Sigm Aldrich), 1 μg/ml enrofloxcin (Byer Animl Helth, Germny), nd 8 μg/ml knmycin (Gico) in sterile 24-well plte t 37 C nd 5% CO 2. The medium ws chnged every hour during the first 4 h nd once fter 24 h, prior to infection. Viility ws nlyzed y oserving ciliry ctivity under light microscope (Olympus CKX31, Tokyo, Jpn). In selected smples, slices were nlyzed for ronchoconstriction y ddition of 1-4 M methcholine (cetyl-ß-methylcholine chloride, Sigm-Aldrich), s previously descried [31]. Virus strin nd propgtion The swine influenz virus strin A/Swine/Bissendorf/ IDT1864/23 of the H3N2 sutype ws isolted from pig with cute respirtory syndrome in Germn herd nd kindly provided y Rlf Dürrwld, IDT Biologik GmH (Dessu-Rosslu, Germny). It ws further propgted in the porcine epithelil NPTr cell line y infection t low multiplicity of infection (MOI) (.1 plque forming unit/cell). NPTr cell line hs een demonstrted suitle for the culture of SIV [18]. Forty-eight hours post-infection, superntnts were clrified y low-speed centrifugtion (2 g, 5 min), then stored t -8 C until use. The virl titer of this stock reched plque forming units (pfu)/ml s determined y plque ssy on NPTr cells, s descried previously [32]. Virus infection NPTr cells nd PAMs were seeded onto sterile 24-well pltes t cells per well nd infected with H3N2 t n MOI of 1 (enling, ccording to the Poisson distriution, the infection of 63.2% of the cells with t lest one single prticle). After 1 h of incution t 37 C nd 5% CO 2 to llow virus dsorption, cells were wshed once with phosphte uffered sline (PBS) nd further mintined t 37 C nd 5% CO 2 in 1 ml of medium. For PCLS infection, the procedure ws nerly identicl except tht 1 6 pfu of virus/slice were used since it ws not possile to determine the numer of trget cells in single slice. The cells nd lung slices were incuted t 37 C nd 5% CO 2 for the different time points efore collection for RNA extrction or stining. Rel-time PCR ssys nd vlidtion of reference genes NPTr cells nd PAMs were lysed in RLT lysis uffer (Qigen, Courtœuf, Frnce). Precision-cut lung slices were lysed nd homogenized in Trizol regent (Invitrogen) using cermic eds (BioSpec Products, OK, USA) nd the FstPrep FP12 cell disrupter (Qiogene, Illkirch, Frnce). Totl RNA ws isolted using RNesy Mini Kit (Qigen) following the mnufcturer s recommendtions. Quntittive rel-time PCR (qpcr) ws performed using cdna synthesized s previously descried [33,34]. Primers to ssess trnscript expression nd virl repliction were lredy pulished or were designed using Clone Mnger 9 (Scientific & Eductionl Softwre, Cry, NC, USA) nd were purchsed from Eurogentec (Liège, Belgium) (Tle 1). Diluted cdna (4 ) ws comined with primer/proe sets nd IQ SYBR Green Supermix (Bio-Rd, Hercules, CA, USA) ccording to the mnufcturer s recommendtions. The qpcr conditions were 98 C for 3 s, followed y 37 cycles with denturtion t 95 C for 15 s nd nneling/elongtion for 3 s (nneling temperture, Tle 1). Rel time ssys were run on Bio-Rd Chromo 4 (Bio-Rd, Hercules, CA, USA). The specificity of the qpcr rections ws ssessed y nlyzing the melting curves of the products nd verifying the mplicon sizes. To minimize smple vrition we used identicl mounts of high qulity RNA from cells nd tissue. The RNA qulity ws ssessed y cpillry electrophoresis (Agilent 21 Bionlyzer, Agilent Technologies, Mssy, Frnce) nd RNA integrity numers

4 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 4 of 18 Tle 1 Primer sequences, nneling tempertures of primer sets ( C), expected PCR frgment sizes (p) nd ccession numers or references Primer nme ActB Bet ctin B2MI Bet-2-microgoulin CISH Cytokine-inducile SH2-contining protein GAPDH Glycerldehyde-3-phosphte dehydrogense HMBS-2 Hydroxymethylilne synthse 2 HPRT-1 Hypoxnthine phosphoriosyltrnsferse 1 IL-1β Interleukine 1 et IL-6 Interleukine 6 IL-8 Interleukine 8 IFNα (1-17) Interferon lph (Type I) IFNβ Interferon et (Type I) IFNγ Interferon gmm (Type II) IFNλ1/IL-29A Interferon lmd1 (Type III) IFNλ3/IL-28B Interferon lmd3 (Type III) inos Inducile nitric oxide synthse Mx1 Myxovirus resistnce 1 Mx2 Myxovirus resistnce 2 OAS Oligodenylte synthetse 1 SIV M protein PKR Protein Kinse RNA-dependent RPL-19 Riosoml protein L19 Primer sequence CACGCCATCCTGCGTCTGGA AGCACCGTGTTGGCGTAGAG CAAGATAGTTAAGTGGGATCGAGAC TGGTAACATCAATACGATTTCTGA GGGAATCTGGCTGGTATTGG CCGACAGTGTGAACAGGTAG CTTCACGACCATGGAGAAGG CCAAGCAGTTGGTGGTACAG AGGATGGGCAACTCTACCTG GATGGTGGCCTGCATAGTCT GGACTTGAATCATGTTTGTG CAGATGTTTCCAAACTCAAC AGAAGAGCCCATCGTCCTTG GAGAGCCTTCAGCTCATGTG ATCAGGAGACCTGCTTGATG TGGTGGCTTTGTCTGGATTC TCCTGCTTTCTGCAGCTCTC GGGTGGAAAGGTGTGGAATG GGCTCTGGTGCATGAGATGC CAGCCAGGATGGAGTCCTCC ATGTCAGAAGCTCCTGGGACAGTT AGGTCATCCATCTGCCCATCAAGT GCTCTGGGAAACTGAATGAC TCTCTGGCCTTGGAACATAG GAGGCTGAGCTAGACTTGAC CCTGAAGTTCGACGTGGATG GGCTCCTTGGCGAACTCATC TCCTTCTTCTGGGCCTCCTG GAGAGGCAGAGGCTTGAGAC TGGAGGAGCTGATGGAGTAG AGTGTCGGCTGTTTACCAAG TTCACAAACCCTGGCAACTC CCGACTTCAGTTCAGGATGG ACAGGAGACGGTCCGTTTAC CCCTGTTCGCGTCTCCAAAG GCGGGCAGGACATCAAACTC AGATGAGTCTTCTAACCGAGGTCG TGCAAAAACATCTTCAAGTCTCTG GACATCCAAAGCAGCTCTCC CGCTCTACCTTCTCGCAATC AACTCCCGTCAGCAGATCC AGTACCCTTCCGCTTACCG Anneling temperture (s) ( C) PCR product (p) Accession numer or reference 63 1 [38] [38] BE AF [38] 6 91 [38] NM_ NM_ NM_ [39] [39] NM_ NM_ GQ BI NM_ AB NM_ [4] NM_ [41]

5 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 5 of 18 Tle 1 Primer sequences, nneling tempertures of primer sets ( C), expected PCR frgment sizes (p) nd ccession numers or references (Continued) RIG-I Retinoic cid-inducile gene I SDHA Succinte dehydrogense complex suunit A SOCS1 Suppressor of cytokine signling 1 SOCS3 Suppressor of cytokine signling 3 TBP-1 TATA ox inding protein 1 TLR3 Toll Like Receptor 3 TLR7 Toll Like Receptor 7 TLR8 Toll Like Receptor 8 TNFα Tumor Necrosis Fctor lph Reference genes re in itlic. CGACATTGCTCAGTGCAATC TCAGCGTTAGCAGTCAGAAG CTACAAGGGGCAGGTTCTGA AAGACAACGAGGTCCAGGAG CGCCCTCAGTGTGAAGATGG GCTCGAAGAGGCAGTCGAAG CAGCTCCAAGAGCGAGTACC TGACGCTGAGCGTGAAGAGG AACAGTTCAGTAGTTATGAGCCAGA AGATGTTCTCAAACGCTTCG CCTGCATTCCAGAAGTTGAG TGAGGTGGAGTATTGCAGAG TCAGCTACAACCAGCTGAAG CAGATGTCGCAACTGGAAAG AGCGCGGGAGGAGTATTGTG GCCAGGGCAGCCAACATAAC CCAATGGCAGAGTGGGTATG TGAAGAGGACCTGGGAGTAG NM_ [38] EW NM_ [38] NM_ NM_ NM_ X54859 (RIN) were clculted. RIN were lwys 8.1 for tissue nd 9.5 for cells. Smples were normlized internlly y simultneously using the verge Cycle quntifiction (Cq) of the three most suitle reference genes in ech smple to void ny rtefct of vrition in the trget gene. These three most suitle reference genes were selected mong eight commonly used reference genes. The genes included et-ctin (ActB), et-2-microgloulin (B2MI), glycerl dehyde-3-phosphte dehydrogense (GAPDH), hydroxymethylilne synthse (HMBS), hypoxnthine phosphori osyltrnsferse-1 (HPRT-1), riosoml protein L-19 (RPL-19), succinte dehydrogense complex suunit A (SDHA) nd TATA ox inding protein-1 (TPB-1) (Tle 1). The stility of these reference genes ws investigted simultneously in control nd infected (1 to 24 h post-infection) NPTR cells, PAMs, nd PCLS using the genorm ppliction [31,35,36]. The threshold for eliminting gene ws M 1 for tissue smples nd M.5 for cells s recommended [36]. The correltion coefficients of the stndrd curves were >.995 nd the concentrtion of the test smples ws clculted from the stndrd curves, ccording to the formul y = -M*Cq + B, where M is the slope of the curve, Cq the first positive second derivtive mximum of mplifiction curve clculted using PCR Miner [37] nd B the y-xis intercept. All qpcrs displyed efficiency etween 9% nd 11%. Expression dt were expressed s reltive vlues fter Genex mcro nlysis (Bio-Rd, Hercules, CA, USA) [35]. Cryosections nd immunofluorescence nlysis Infected nd non-infected PCLS were mounted on smll pieces of filter pper with tissue-freezing medium (Jung, Heidelerg, Germny), then frozen in liquid nitrogen nd kept t -8 C prior to cutting. Ten μm-thick slices were cut y cryotome (Reichert-Jung, Nußloch, Germny). The sections were dried overnight t room temperture nd then kept frozen t -2 C until stining. The sections were fixed with 3% prformldehyde for 2 min nd permeilized with.2% Triton X-1 for 5 min followed y three wshing steps with PBS. All ntiodies were diluted in 1% ovine serum lumin (Sigm-Aldrich) nd incuted with the sections for 1 h t room temperture (RT) in humid incution chmer. After the finl incution step, the sections were wshed three times with PBS nd once with distilled wter. The slices were emedded in Mowiol 4-88 resin (Sigm-Aldrich), covered y no. 1½ circulr micro-cover glss (12 mm) (Electron Microscopy Sciences, Htfield, PA, USA), nd stored t 4 C until exmintion under the confocl microscope. For detection of infected cells, monoclonl ntiody (IgG2) ginst the influenz A virus nucleoprotein (NP) (Clone AA5H, ADSeroTec MCA4, Düsseldorf, Germny) ws used t 1:75 dilution followed y incution with n nti-mouse IgG (Sigm-Aldrich) secondry ntiody. To visulize cili, smples were treted with Cy3-leled monoclonl ntiody recognizing et-tuulin (dilution 1/6) (Sigm- Aldrich). Nuclei were stined y incuting sections for

6 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 6 of min t 37 C in 4,6 -dimidino-2-phenylindole (DAPI) (Life Technologies Inc., Drmstdt, Germny). Western lotting NPTr cells ( cells/well) were virus-infected t n MOI of 1, then incuted for 5, 1, 3, 6 or 24 min. Cells were then disrupted using the lysis uffer (1 mm Tris ph 7.4, 15 mm NCl, 1 mm ethylene glycol tetrcetic cid, 1 mm ethylene dimine tetrcetic cid-edta, 1% (v/v) Triton -1,.5% NP-4), protese inhiitors (2 mm phenyl methyl sulfonyl fluoride- PMSF, 1 μg/ml leupeptin, 1 μg/ml protinin) nd phosphtse inhiitors (1 mm sodium fluoride, 1 mm sodium pyrophosphte, 2 mm sodium orthovndte) (Sigm-Aldrich) (Bio-Rd, Mrnes-l-Coquette, Frnce). Lystes were incuted on ice for 3 min nd then centrifuged t 12 g for 2 min t 4 C. Equl mounts of proteins were seprted using sodium dodecyl sulfte polycrylmide gel electrophoresis (SDS- PAGE) nd trnsferred onto nitrocellulose memrne. Memrnes were then incuted for 1 h t RT with Tris-uffered sline (TBS, 2 mm Tris-HCL, ph 8, 15 mm NCl, ph 7.6), contining 5% non-ft dry milk powder (NFDMP) nd.1% Tween-2 (Bio-Rd) to sturte non-specific sites. Then memrnes were incuted overnight t 4 C with pproprite primry ntiodies (finl dilution 1:1, see Tle 2) in TBS contining.1% Tween-2 nd 5% NFDMP. The memrnes were wshed in TBS-.1% Tween-2 nd incuted for 2 h t RT with horserdish peroxidse-conjugted secondry ntiody (finl dilution 1:1 ). After wshing, proteins were detected y enhnced chemiluminescence (Western Lightning Plus-ECL, Perkin Elmer, Courtœuf, Frnce) using G:Box SynGene (Ozyme, Sint-Quentin-en- Yvelines, Frnce) with the GeneSnp softwre (Syngene UK, Cmridge, UK, relese ). Detected signls were quntified with the GeneTools softwre (Syngene UK, relese 4.1.2). The results re expressed s the signl intensity in ritrry units fter normliztion s indicted in the figure legends. Antiodies nd chemicl inhiitors Antiodies to phospho-akt (Ser 473), phospho-erk1/2 (Thr 22/Tyr 24), phospho-jak2 (Tyr 17/18), nd phospho-p38 (Thr18/Tyr182) were purchsed from Ozyme. Monoclonl nd polyclonl ntiodies to Akt, ERK2, p38, nd JAK2 were otined from Teu Bio (Le Perry-en-Yvelines, Frnce) nd Ozyme. All ntiodies were used t 1:1 dilution in ssys. Stock solutions of phrmcologicl inhiitors such s inhiitor U126 (inhiiting MEK1/2 nd ERK1/2), p38/sapk2-specific inhiitor SB 2219, nd JAK Inhiitor I (4299) (Millipore, Molsheim, Frnce) were ll prepred s 1- concentrted stocks in dimethyl sulfoxide (DMSO), in order to ensure tht the finl concentrtion of DMSO in the culture medium did not exceed.1%. Strting one hour efore infection, NPTr cells were treted for the whole procedure with ech inhiitor t concentrtion of 1 μm to lock the signling. The lockge of the cscdes ws verified t 3 min post-infection. Sttisticl nlysis Expression of mrna in cells nd tissues ws expressed s reltive vlues. All sttisticl nlyses were done using Prism 5 computer softwre (Prism 5 for Windows; GrphPd Softwre, Sn Diego, CA, USA). One-Wy ANOVA ws used to detect differences etween groups. To ccount for the non-norml distriution, ll dt were sorted y rnk prior to performing the ANOVA. Tukey s test ws used to compre the mens of the rnks mong the groups. P vlues less thn.5 were considered significnt. Tle 2 Antiodies used for Western lotting Trget Antiody Dilution Rit polyclonl nti-phospho-akt (Ser473) Phospho-Akt #9271 (Ozyme) 1/1 Rit monoclonl nti-phospho-p44/42 MAPK (Erk1/2) Phospho-ERK1/2 (Thr22/Tyr24) (D E) #437 (Ozyme) 1/1 Rit polyclonl nti-phospho-jak2 (Tyr17/18) Phospho-JAK2 #3771 (Ozyme) 1/1 Rit monoclonl nti-phospho-p38 MAPK (Thr18/Tyr182) Phospho-p38 (12 F8) #4631 (Ozyme) 1/1 Akt Rit monoclonl nti-akt (11E7) #4685 (Ozyme) 1/1 ERK2 Rit polyclonl nti-erk2 (GTX27948) (teu-io) 1/1 JAK2 Rit monoclonl nti-jak2 (D2E12) #323 (Ozyme) 1/1 p38 Rit polyclonl nti-p38 MAPK (GTX5566) (teu-io) 1/1 See lso Additionl files 1 nd 2.

7 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 7 of 18 Results Reference gene selection In order to chrcterize the immune response ginst our strin of SIV in vivo nd ex vivo using qpcr ssys, vlidtion of the three most stle reference genes in NPTr cells, PAMs, nd PCLS ws required (Figure 1). Eight previously descried reference genes [33,38,42] were selected for ssessment of their stility in our conditions. The selection ws sed on the M vlue using genorm. The threshold ws set t.5 for homogenous smples (e.g. NPTr cells nd PAMs) nd 1 for heterogeneous smples (PCLS) [36]. The genorm nlysis showed tht HPRT-1, HMBS-2, nd RPL-19 were the three most stle genes in NPTr cells with n M vlue of.119,.119, nd.117, respectively (Figure 1). All of the reference genes tested hd M vlues elow the threshold, except ActB (.51). In PAMs the sitution ws roughly similr nd gin ActB ws the only gene with n M vlue ove the elimintion threshold (.523); the three most stle genes were SDHA, RPL-19, nd TBP-1 (.293,.232, nd.232, respectively) (Figure 1). The selected genes for PCLS were TBP-1, HPRT-1 nd HMBS-2, hving n M vlue of.35,.211, nd.211, respectively (Figure 1). In the three systems, RPL19 ws considered the most stle reference gene. ActB ws the most vrile reference gene with n M vlue equl or higher thn the threshold. Virl repliction in neworn pig trche cells nd lveolr mcrophges In order to verify the cpcity of our SIV strin to infect NPTr cells nd PAMs, we ssessed virl repliction through quntifiction of the virl M-segment RNA (M-vRNA) in oth cell types (Figures 2 nd 3). M gene quntifiction ws elow the experimentl ckground in oth control groups (Figures 2 nd 3). In infected NPTr cells, M-vRNA ws detected (P <.1) t 1 h post-infection (hpi) nd reched its highest levels 8 nd 24 hpi (P <.1) (Figure 2). Similr results were otined in PAMs, with detection of M-vRNA s erly s 1 hpi (Figure 3); however its level remined slightly lower thn tht oserved in NPTr cells (Cq 28 t 1 h for oth cell types, nd 24 nd 18 t 8 h for PAMs nd NPTr, respectively). The highest levels of M-vRNA were lso oserved 8-24 hpi in PAMs (Figure 3). Innte immune response evlution in epithelil cells nd lveolr mcrophges Respirtory epithelil cells nd PAMs re the first cells encountered y the influenz A virus during n infection in the pig. To explore the innte cellulr response, the expression of vrious trnscripts ws ssessed (Tle 1 nd Figures 2 nd 3). The virus induced the expression of RIG-I mrna s erly s 3 hpi reching the highest levels of expression t 24 h in NPTr cells (Figure 2). In PAMs, significnt increse (P <.1) of RIG-I mrna ws oserved only fter 24 h of infection (Figure 3). Regrding TLR3, TLR7, nd TLR8 no sttisticlly significnt differences were oserved etween control nd infected NPTr cells (dt not shown). However in PAMs, TLR3, TLR7, nd TLR8 mrna expressions were significntly up-regulted y the virl infection (Figure 3). Expression of IFNβ mrna ws clerly incresed from 3 hpi in NPTr cells (P<.5), nd from 8 hpi in PAMs (P<.1) (Figures 2 nd 3), nd reched its highest level t 24 hpi in oth cell types (P<.1). No significnt differences in IFNα mrna were oserved etween controls nd infected cells, whtever the cell type (Additionl file 1). For IFN type III such s IFNλ1, sttisticlly significnt increses were oserved fter 8 nd 24 h in NPTr cells ut not in PAMs (Figures 2 nd 3) while no significnt differences were oserved for IFNλ3 (dt not shown). Regrding the interferon-stimulted genes (ISGs) (Figures 2 nd 3), virus-induced mrna over-expressions NPTr cells PAMs PCLS Mvlue.5 Mvlue.5 M vlue ActB GAPDH SDHA B2MI TBP-1 HPRT-1 HMBS-2 RPL-19. ActB HMBS-2 B2MI GAPDH HPRT-1 SDHA RPL-19 TBP-1. ActB B2MI GAPDH RPL-19 SDHA TBP-1 HPRT-1 HMBS-2 Figure 1 Selected cndidte reference genes nd their expression stility. The stility of the reference genes hs een ssessed in mix of non-infected nd infected neworn pig trche cells (NPTr), porcine lveolr mcrophges (PAMs) nd precision-cut lung slices (PCLS) t the different time points. Gene expression stility of cndidte reference genes ws nlyzed y the genorm ppliction. Threshold for eliminting gene ws 1. for PCLS nd.5 for NPTr cells nd PAMs. The three most stle reference genes re depicted in green.

8 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 8 of 18 NPTr cells Reltive Expression Virl repliction (MOI:1) RIG-I IFNβ ** * IFNλ1 Mx1 OAS1 3 2 PKR IL-6 SOCS ** 2 1 Figure 2 Reltive expression of M-virl RNA nd of host trnscripts in infected neworn pig trche cells. The NPTr cells were infected with the H3N2 SIV strin t different time points (1 h, 3 h, 8 h, nd 24 h). Green dots stnd for non-infected NPTr cells nd red dots for infected cells (individul vlues (dots) nd medin vlue (r), n = 6 wells per condition). Comprisons were mde using one wy ANOVA test nd Tukey s post-test. Differences were considered significnt when P <.5 (*), P <.1 (**) or P <.1 (). (P <.5 nd.1) were oserved for myxovirus resistnce 1 (Mx1), nd Mx2 (dt not shown), 2-5 oligodenylte synthetse 1 (OAS1), nd protein kinse R (PKR) from 3 hpi in NPTr cells nd from 8 (Mx1) or 24 hpi (Mx2 dt not shown) in PAMs (P<.1). The pttern of expression for these genes ws similr to tht oserved for IFNβ trnscripts. Among ll nlyzed SOCS trnscripts, only SOCS1 mrna showed sttisticlly incresed expression fter 24 h in oth NPTr cells nd PAMs (P<.1). IL-6 (Figure 2) nd IL-8 (dt not shown) mrnas were lso up-regulted in response to the infection in NPTr cells t 8 nd 24 hpi ut not in PAMs. Regrding IL-1β nd TNFα trnscripts, we did not detect ny significnt differences etween conditions in NPTr cells even though some trends of induction y the virus were oserved (dt not shown), while TNFα mrna expression ws significntly incresed (P <.1)in response to the virus in PAMs fter only 3 h of infection (Figure 3). Virl infection of precision-cut lung slices The innte response of PCLS infected with SIV ws lso nlyzed. A minimum of one slice/pig (n = 5) ws generted t ech time point. The viility of the PCLS ws verified prior to infection: the ciliry ctivity of the ronchil epithelium ws mintined when nlyzed t 24, 48, nd 96 h fter their preprtion (dt not shown).

9 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 9 of 18 PAMs Virl repliction (MOI:1) RIG-I TLR TLR7 TLR8 IFNβ Reltive Expression * * 2 IFNλ1 Mx1 OAS ** PKR TNFα SOCS1 15 ** Figure 3 Reltive expression of vrious virl nd host trnscripts in infected porcine lveolr mcrophges (PAMs). The cells were infected with the H3N2 SIV strin t different time points (1 h, 3 h, 8 h, nd 24 h). Green dots stnd for non-infected PAMs nd red dots for infected PAMs (ech individul vlue (n = 7) represents the dt otined with PAMs prepred from one pig, r represents the medin vlue). Comprisons were mde using one wy ANOVA test nd Tukey s post-test. Differences were considered significnt when P <.5 (*), P <.1(**)orP <.1 ().

10 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 1 of 18 3 h 8 h 24 h 48 h Figure 4 Immunostining of infected Precision-cut lung slices (PCLS). The slices were infected y the H3N2 SIV strin. Cryosections were prepred fter 3, 8, 24, nd 48 h of infection nd imge dt were collected using lser-scnning confocl microscope. Infected cells were stined with n nti-nucleoprotein polyclonl ntiody (green) for the detection of SIV. Cilited cells were stined using n nti-et-tuulin monoclonl ntiody (red). Cell nuclei of prepred slides were stined y incution with 4,6 -dimidino-2-phenylindole (DAPI, lue). Scle r = 2 μm. Additionlly, ronchoconstriction could e triggered y the use of 1-4 M methcholine in the four dys following slice preprtion (dt not shown) nd susequently reversed y removl of the drug. These oservtions provided evidence tht porcine PCLS remined vile for up to 96 h under the incution conditions descried in the mteril nd methods section. To monitor virl infection of the slices, cryosections of PCLS were stined with n ntiody-trgeting SIV nucleoprotein. Only few infected cells were oserved fter 3 h of culture with the virus (Figure 4), while the numer ws considerly incresed t 8 hpi. The generl rchitecture of the tissue ws progressively ltered y the virl infectious process, nd fter 24 nd 48 h significnt lysis of the epithelium ws oserved (Figure 4). In prllel, virl repliction ws ssessed in the PCLS y qpcr ssys trgeting the virl M gene segment (Figure 5). M-vRNA ws detected only in infected groups, reching its mximum t 24 hpi (verge Cq: 22). Host trnscript expression in precision-cut lung slices Lung slices offer more relistic system thn cell lines to study the interction etween host nd pthogen. To etter chrcterize the innte immune response towrd the SIV strin, PCLS were infected nd the expression of severl host genes involved in the ntivirl response ws ssessed t different time points using qpcr ssys (Tle 1 nd Figure 5). An increse in RIG-I trnscripts ws oserved t 8 h, ut it did not ecome significnt until 24 hpi (P <.1). We did not detect ny sttisticlly significnt increse in expression of TLR3, TLR7, nd TLR8 trnscripts post-infection, however some trends potentilly indicting virl induction were oserved (dt not shown). In response to the virus, IFNβ nd IFNλ1 mrna expression were significntly incresed (P <.1) t 24 hpi (Figure 5) while no significnt increse ws oserved for IFNα nd IFNλ3 (Additionl file 1 nd dt not shown). Along with the incresed expression of IFN types I nd III trnscripts, mrna expression of ISGs Mx1, Mx2, nd PKR ws lso significntly elevted reltive to controls fter 24 h of infection (P <.1) (Figure 5 nd dt not shown). The mrna expression of OAS1 ws significntly incresed (P <.5) fter only 8 h of infection (Figure 5). Unlike IL-1β, IL-8, nd TNFα, IL-6 trnscription ws significntly up-regulted 8 h fter infection (Figure 5). Overll, except for IFNλ1 nd IL-6, similr ptterns of trnscript expression were oserved in vitro in the epithelil cells nd lveolr mcrophges nd ex vivo in the PCLS. Regrding the mrna expression of SOCS (CISH, SOCS1, nd

11 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 11 of 18 PCLS Virl repliction (1 6 pfu/pcls) RIG-I IFNβ C I C I C I C I C I C I C I C I C I Reltive Expression h 8h 24h C I C I C I 3h 8h 24h 25 ** h 8h 24h C I C I C I 3h 8h 24h h 8h 24h IFNλ1 Mx1 OAS1 C I C I C I * 3h 8h 24h PKR IL-6 SOCS ** C I C I C I C I C I C I C I C I C I 3h 8h 24h 3h 8h 24h 3h 8h 24h Figure 5 Reltive expression of M-vRNA nd of host trnscripts in infected precision-cut lung slices (PCLS). The slices were infected with the H3N2 SIV strin t different time points (3 h, 8 h, nd 24 h). Green dots stnd for non-infected PCLS nd red dots for infected PCLS (minimum one slice/pig for ech time point, totl 5 pigs, n = 5-12 nd medin vlue). Comprisons were mde using one wy ANOVA test nd Tukey s post-test. Differences were considered significnt when P <.5 (*), P <.1 (**) or P <.1 (). SOCS3), only SOCS1 trnscripts were significntly incresed t 24 hpi in PCLS (P <.1) (Figure 5). These findings re similr to those oserved with NPTr cells nd PAMs nd suggest n involvement of SOCS1 in the immune response ginst SIV. Activtion of MAP kinses nd JAK/STAT pthwys in virus-infected epithelil cells During influenz A infection, vrious signling cscdes re triggered to counterct pthogen repliction nd spreding. Mny of these signling pthwys re controlled to certin extent y SOCS proteins [43]. We exmined the ctivtion of severl signling pthwys involved in pro-inflmmtory nd ntivirl gene expression in response to SIV infection in NPTr cells. MAPK pthwys, oth ERK1/2 nd p38, showed phosphoryltions fter 5 min of contct with the virus while phosphoryltion-medited ctivtion of JAK2 ppered etween 3 nd 6 min post-infection (Figures 6A, B, nd C). In contrst, ctivtion of the PI3K/Akt signling pthwy ws not oserved t ny time points (Figure 6D); in generl, pek of phosphoryltion ws oserved fter 3 to 6 min of infection, followed y decrese 4 hpi (Figures 6A, B, nd C). These results showed tht our SIV strin efficiently nd rpidly ctivted MAPK (ERK1/2, p38) nd JAK/STAT pthwys in NPTr cells.

12 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 12 of 18 A Reltive Density (perk-erk) B Reltive Density (pp38-p38) perk1/2 pp38 ERK1/2 p38 C TIME Reltive Density (pjak2-jak2) MINUTES, D TIME Reltive Density (pakt-akt) MINUTES pjak2 pakt JAK2 Akt TIME TIME MINUTES MINUTES Figure 6 Western lots in infected NPTr cells. Western lots for phospho-erk1/2 (perk1/2) (A), phospho-p38 (pp38) (B), phospho-jak2 (pjak2) (C), nd phospho-akt (pakt) (D) were performed in neworn porcine trche (NPTr) cells infected with H3N2 SIV t different time points (, 5, 1, 3, 6, nd 24 min). Totl ERK1/2, p38 nd JAK2 re shown s loding controls nd did not chnge with ech condition over time. Dt re presented s mens ± SEM, (n = 3). Results re representtive of three independent experiments. Different letters indicte significnt differences (one wy ANOVA, P <.5) s compred to control (time ). Specific inhiition of pthwys ctivted in epithelil cells To investigte whether the MAPK nd JAK/STAT pthwys re involved in the regultion of SOCS1 mrna expression in porcine epithelil cells, NPTr cells were pre-treted with chemicl inhiitors trgeting these pthwys, nd the expression of SOCS1 trnscripts ws ssessed t 24 hpi (Figures 7, 8 nd 9). One h fter the pre-tretment, NPTr cells were infected with the H3N2 strin nd phosphoryltion ws evluted t 3 min post-infection, corresponding to the pek of ctivtion (Figure 7). NPTr cells pre-treted with inhiitors of ERK1/2 (U126), p38 (SB 2219) nd JAK/STAT (JAK Inhiitor I) in the sence of virus infection showed sl levels of phosphoryltion similr to those oserved in control groups. By contrst, pre-treted infected cells displyed complete olition of phosphoryltion in ERK1/2, p38 nd JAK/STAT pthwys (Figure 7) lsting more thn 24 h (dt not shown). In order to determine whether these signling pthwys re involved in the regultion of SOCS1 mrna expression, the ssessment of SOCS1 mrna expression fter inhiitor tretments ws performed following the sme timing (Figure 8) s in the previous experiment (Figure 2). It ws oserved tht the lockde of ERK1/2 nd p38 did not significntly ffect SOCS1 mrna expression fter 24 h of infection (Figure 8). However, sttisticlly significnt decrese of SOCS1 mrna expression ws oserved in NPTr cells treted with JAK Inhiitor I demonstrting n ssocition etween ctivtion of JAK/STAT pthwy nd SOCS1 mrna expression in porcine respirtory epithelil cells. To further ssess the impct of JAK/ STAT pthwy-inhiition on virus repliction nd innte response, the reltive expression of M-vRNA nd mrnas for severl host proteins ws ssessed (Figure 9). Virl repliction ws not significntly modified y JAK Inhiitor I except fter 24 h of infection (P <.1) (Figure 9). Similrly the trnscript expression of RIG-I, IFNβ, IFNλ1, PKR, nd Mx1 ws significntly decresed (P <.1) under JAK Inhiitor I tretment fter 24 h of infection (Figure 9). The inhiition of ERK1/2 nd p38

13 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 13 of 18 ERK1/2 p38 JAK/STAT Reltive Density (perk-erk) c Reltive Density (pp38-p38) Reltive Density (pjak2-jak2) perk1/2 pp38 pjak2 ERK1/2 U126 H3N2 - - p SB H3N JAK2 JAK2 Inhi H3N Figure 7 Western lots in infected NPTr cells in presence or sence of chemicl inhiitor. Western lots for phospho-erk1/2 (perk1/2), phospho-p38 (pp38) nd phospho-jak2 (pjak2) in neworn porcine trche (NPTr) cells infected with H3N2 SIV t 3 min in presence or in sence of chemicl inhiitors UO126 (ERK1/2), SB2219 (p38), nd JAK inhiitor (JAK Inhiitor I). The control group ws cultured in presence of DMSO, dt re represented s mens ± SEM, (n = 3). Results re representtive of three independent experiments. Different letters indicte significnt differences (one wy ANOVA, P <.5) s compred to control (without inhiitor nd virus). + + hd less impct on virl repliction nd interferon response (Additionl file 2). Virl repliction ws significntly reduced (P <.1) t 8 (p38) nd 24 hpi (ERK1/2) nd OAS1 trnscript expression ws significntly reduced (P <.1) with oth inhiitors 24 hpi. All together these results demonstrted link etween the JAK/STAT pthwy nd SOCS1 in pigs. Discussion The innte immune response to swine influenz viruses hs een ssessed in mny previous studies [6,16]. However, to our knowledge most of these studies were crried out in single-cell popultions or directly in n niml host. In this study we compred n epithelil cell line (NPTr), lveolr mcrophges (PAMs), nd 6 SOCS1 ERK1/2 p38 JAK/STAT inhiitor inhiitor inhiitor 6 6 Reltive Expression 4 2 C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V Control Inhiitor Virus Inhiitor/Virus Figure 8 Reltive expression of SOCS1 trnscripts in infected NPTr cells in presence of chemicl inhiitors. The reltive expression of SOCS1 trnscripts ws mesured in neworn porcine trche (NPTr) cells infected with H3N2 SIV in presence of chemicl inhiitors UO126 (ERK1/2), SB2219 (p38), nd JAK Inhiitor I (JAK/STAT) t different time points (1 h, 3 h, 8 h, nd 24 h). The control groups were cultured either in the presence of.1% DMSO (C, green) or in the presence of inhiitor (I, lue). Infected cells were either untreted (V, red) or inhiitor-treted (I + V, ornge). Comprisons were mde using one wy ANOVA test nd Tukey s post-test (n = 5, men ± SEM). Differences were considered significnt when P <.5(*),P <.1 (**) or P <.1 ().

14 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 14 of 18 JAK/STAT inhiitor Virl repliction (MOI:1) RIG-I IFNβ Reltive Expression C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V IFNλ1 PKR Mx C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V Control Inhiitor Virus Inhiitor/Virus Figure 9 Reltive expression of vrious virl nd host trnscripts in infected NPTr cells in presence of JAK Inhiitor I. The reltive expression of vrious virl nd host trnscripts ws mesured in neworn porcine trche (NPTr) cells infected with H3N2 SIV in presence of JAK Inhiitor I t different time points (1 h, 3 h, 8 h, nd 24 h). The control groups were cultured either in the presence of.1% DMSO (C, green) or in the presence of inhiitor (I, lue). Infected cells were either untreted (V, red) or inhiitor-treted (I + V, ornge). Comprisons were mde using one wy ANOVA test nd Tukey s post-test (n = 5, men ± SEM). Differences were considered significnt when P <.5 (*), P <.1 (**) or P <.1 (). precision cut lung slices (PCLS) for their innte immune response to strin A/Swine/Bissendorf/IDT1864/ 23 (H3N2). Then, we ssessed severl signling pthwys nd their reltion to the innte immune response oserved in the NPTr cells. Virl repliction ws higher in NPTr cells thn in PCLS nd PAMs. This is in greement with the current knowledge of influenz pthogenesis. Indeed, it is well known tht the min trget of the virus is epithelil cells [12,15] nd NPTr is cell line consisting of trchel epithelil cells [18]. This ws lso confirmed y the immune-stining of the PCLS, where mny cilited epithelil cells were oserved in the ssocited ronchi. In the three systems used in this study, strong nd progressive innte immune response ws triggered y the virus. The response in NPTr cells nd PCLS ws very similr except for trend towrd TLR induction in the ltter. This could e explined y the presence of vrious cell types such s mcrophges nd/or dendritic cells in this tissue [6,14]. Moreover, oserved discrepncies etween NPTr cells nd PCLS my lso e relted to the less controlled percentge of cells infected in the PCLS (MOI cnnot e determined) nd to the potentil resistnce of significnt proportion of the vrious cell types to SIV infection. Our study further demonstrted the vlue of using PCLS in the study of pig/siv interctions. RIG-I trnscription ws induced y the virus in NPTr cells, PAMs, nd PCLS while TLR3, TLR7 s well s TLR8 trnscription were significntly induced only in PAMs. This result ws little it surprising since it hs een oserved recently tht irwy epithelil cells mostly use surfce nd endosoml TLR3 to detect influenz virus nd to initite IFN production [44]. Following recognition of the virus, interferon responses were triggered. In NPTr cells nd PCLS we oserved mostly IFNβ nd IFNλ1 trnscript expression in response to the virus while in PAMs, IFN type III ws not significntly induced. Regrding the expression of IFNα trnscripts,

15 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 15 of 18 no significnt differences etween infected nd noninfected cells/tissues were oserved. This result is surprising s IFNα trnscripts were previously detected in PAMs infected y nother strin of SIV [45]. In tht study IFNα mrna ws detected erlier thn IFNβ mrna. The use of qpcr primers trgeting IFNα 1-17 my hve msked differences in the expression of trnscripts ssocited to specific IFNα gene. It is known tht significnt vritions in the expression of the vrious IFNα trnscripts upon infection cn e oserved [46]. Recently, it hs een demonstrted tht type III IFN is the predominnt IFN produced y the irwy epithelium [44]. Our dt showed the incresed production of mrnas encoding oth type I nd type III IFNs in epithelil cells. The sence of type III IFN induction in PAMs supports the ide of predominnt role of type III IFN in specific cell type such s epithelil cells s suggested y Ionnidis et l. [44]. In response to IFN, ISG (Mx1, Mx2, OAS1, PKR) trnscripts were identified in the three systems. This oservtion ws prticulrly cler with the NPTr cells proly ecuse of their nture (epithelil versus lveolr mcrophges) nd their high purity in comprison to primry epithelil cells locted in the slices. These two fetures lso proly ccount for the quicker nd higher response oserved in NPTr cells when compred to PAMs nd PCLs. Becuse of their role in the regultion of immune response [47,48] nd in influenz pthogenesis [49], we looked t the expression of SOCS trnscripts in response to SIV in the three systems. Twenty-four hpi SOCS1 trnscripts were up-regulted in the three systems. This oservtion confirmed our previous study postulting the inducile nture of SOCS1 in porcine lungs [33]. Insted of SOCS1, role for SOCS3 hs een recently identified in pigs [5]. The uthors showed tht the lower susceptiility of pigs to contemporry Eursin highly pthogenic vin influenz (HPAI) H5N1 virus infection is linked to SOCS3 induction. Under their conditions, swine epithelil cells were expressing SOCS3 proteins in response to oth humn H1N1 virus nd HPAI H5N1 virus [5]. In nother study, it ws demonstrted tht influenz A virus induced NF-κB dependent SOCS3 gene expression in humn epithelil cells, suppressing type I IFN response through the JAK/STAT pthwy [51]. In our conditions, SOCS3 ws never significntly induced in response to H3N2 SIV. It remins to e shown whether these differences re due to different experimentl prmeters (e.g. virus strin nd timing of mesurements) or potentil discrepncies etween RNA levels nd protein expression. In NPTr cells, the Akt signling pthwy ws not significntly induced, while we did oserve the triggering of MAPK (ERK1/2 nd p38) nd JAK/STAT pthwys. The sence of Akt ctivtion ws unexpected, since this signling pthwy ws shown to e ctivted y influenz A virus, proly fvoring virl repliction [32,52]. However, we ssessed different pthwy ctivtions erly in the infection process, nd the protocol used in our study did not llow for the oservtion of Akt ctivtion. The ctivtion of JAK/STAT pthwy hs een reported in other species [13]. This pthwy controls type I IFN response. JAK/STAT signling induced formtion of trimeric trnscription fctor ISGF3, consisting of STAT1, STAT2, nd interferon regultory fctor 9 (IRF-9), which regultes the expression of severl ISGs [13]. Four MAPK cscdes hve een descried including two isoforms of the ERK1/2, the Jun-terminl kinse (JNK), p38, nd ERK5 [52,53]. The signling pthwys convert extr- nd intrcellulr signls into cellulr responses, regulting cell ctivtion, differentition, immune responses, nd prolifertion [52,53]. In our study we ssessed the ctivtion of ERK1/2 nd p38, nd ctivtion of oth cscdes ws oserved. p38 predominntly responds to stress conditions nd pro-inflmmtory cytokines, wheres ERK1/2 senses mitogenic stimuli [52,53]. MAPK signling pthwys nd their role in the regultion of innte response nd virl repliction hve not een well studied in porcine cells infected y influenz virus. However, recent study showed roust ctivtion of ERK1/2 in influenz virus-infected swine mcrophges [54] nd demonstrted tht the induction of RIG-I nd MDA-5 depends on the ctivtion of ERK1/2 nd JNK in these cells. Interestingly nd similr to our findings, these uthors did not oserve ny IL-1β induction in response to the tested influenz virus [54]. Unlike IL-1β expression, TNFα ws clerly induced erly t 3 hpi. We lso investigted to wht extent inhiitors of the different pthwys could impct SOCS1 trnscription. Only JAK/STAT pthwy inhiition ws ccompnied y significnt decrese in the expression of SOCS1 trnscripts. This oservtion confirms the strong ssocition of SOCS (prticulrly CISH, SOCS1, nd SOCS3) with the JAK/STAT pthwy. Nevertheless, in our conditions the ssocition ws only cler for SOCS1 nd not for the two other SOCS fmily memers. To further ssess the impct of JAK/STAT pthwy inhiition, we then looked t the expression of trnscripts ccounting for virl repliction, virl recognition nd interferon response. The tretment with JAK Inhiitor I ws ccompnied y significnt decrese in virl repliction (s ssessed y quntifiction of M-vRNA) nd y diminished expression of RIG-I, IFNβ, IFNλ1, PKR, nd Mx1 trnscripts 24 h post-infection. The decrese in virl repliction remins unexplined, lthough it could e linked to the presence of more IFN in the culture superntnt consecutive to n inhiition of SOCS1. However, the lower level of expression of IFN trnscripts rgues ginst this hypothesis. In nother set of experiments using nother