Innate immune response to a H3N2 subtype swine influenza virus in newborn porcine trachea cells, alveolar macrophages, and precision-cut lung slices
|
|
- Rolf Hodges
- 5 years ago
- Views:
Transcription
1 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 VETERINARY RESEARCH RESEARCH Open Access Innte immune response to H3N2 sutype swine influenz virus in neworn porcine trche cells, lveolr mcrophges, nd precision-cut lung slices Mrio Delgdo-Orteg 1,2, Sndrine Melo 1,2, Drsniy Punydrsniy 3, Christelle Rmé 4, Michel Olivier 1,2, Denis Souieux 1,2, Dniel Mrc 1,2, Gëlle Simon 5,6, Georg Herrler 7, Mustph Berri 1,2, Joëlle Dupont 4 nd Frnçois Meurens 8* Astrct Virl respirtory diseses remin of mjor importnce in swine reeding units. Swine influenz virus (SIV) is one of the min known contriutors to infectious respirtory diseses. The innte immune response to swine influenz viruses hs een ssessed in mny previous studies. However most of these studies were crried out in single-cell popultion or directly in the live niml, in ll its complexity. In the current study we report the use of trche epithelil cell line (neworn pig trche cells NPTr) in comprison with lveolr mcrophges nd lung slices for the chrcteriztion of innte immune response to n infection y Europen SIV of the H3N2 sutype. The expression pttern of trnscripts involved in the recognition of the virus, interferon type I nd III responses, nd the host-response regultion were ssessed y quntittive PCR in response to infection. Some significnt differences were oserved etween the three systems, notly in the expression of type III interferon mrna. Then, results show cler induction of JAK/STAT nd MAPK signling pthwys in infected NPTr cells. Conversely, PI3K/Akt signling pthwys ws not ctivted. The inhiition of the JAK/STAT pthwy clerly reduced interferon type I nd III responses nd the induction of SOCS1 t the trnscript level in infected NPTr cells. Similrly, the inhiition of MAPK pthwy reduced virl repliction nd interferon response. All together, these results contriute to n incresed understnding of the innte immune response to H3N2 SIV nd my help identify strtegies to effectively control SIV infection. Introduction Virl respirtory diseses re still mjor helth issue in pigs rered under confined conditions on intensive reeding frms worldwide. Currently the most common virl pthogens re porcine reproductive nd respirtory syndrome virus (PRRSV), swine influenz virus (SIV), pseudories virus, nd porcine circovirus type 2 [1-3]. In the field, these viruses re usully found in ssocition with ech other or with cteri such s Actinocillus spp., Bordetell ronchiseptic, Hemophilus prsuis, Mycoplsm hyopneumonie, Psteurell multocid, * Correspondence: frncois.meurens@ussk.c 8 Vccine nd Infectious Disese Orgniztion-InterVc, University of Ssktchewn, 12 Veterinry Rod, S7N 5E3 Ssktoon, Ssktchewn, Cnd Full list of uthor informtion is ville t the end of the rticle nd Streptococcus suis [1,3-5]. In prticulr, influenz A viruses re mjor cuse of cute respirtory disese on pig reeding frms [6]. Usully, the disese is chrcterized y depression, loss of ppetite, dominl rething, tchypne, fever, nd less often, coughing. Moridity ssocited with the virus is high nd mortlity is often very low [6]. Influenz A viruses re clssified into sutypes sed on the ntigenicity of their hemgglutinin (HA) nd their neurminidse (NA) surfce proteins [6]. In pigs, three sutypes re descried worldwide: H1N1, H1N2, nd H3N2 [7,8], however genetic linege my vry within ech sutype depending on the geogrphicl loction (North Americ, Europe, nd Asi). Viruses of the three sutypes hve een reported frequently in Europen pigs, often ssocited with clinicl disese [9,1]. 214 Delgdo-Orteg et l.; licensee BioMed Centrl Ltd. This is n Open Access rticle distriuted under the terms of the Cretive Commons Attriution License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly credited. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.
2 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 2 of 18 The innte immune response is crucil in the fight ginst respirtory viruses. It controls virl invsion nd repliction while the dptive response is effective for virl clernce through the ctivity of dptive immune cells such s lymphocytes [11,12]. Among innte immune cells, epithelil cells, lveolr mcrophges, nd dendritic cells provide the first line of defense [11-15]. They rpidly recognize pthogens through pttern recognition receptors (PRRs) such s Toll-like receptors (TLRs), intrcellulr virl sensors such s retinoic cidinducile gene I (RIG-I) nd melnom differentitionssocited gene 5 (MDA5), nd the nucleotide-inding domin, leucine-rich repet-contining proteins (NLRs) [16,17]. The innte immune response to SIV hs een ssessed in mny previous studies (for review see [6,16]). However, most of these studies were crried out in single-cell popultion, sometimes isolted from other species, or directly in the pig in ll its complexity mking the estlishment of cler conclusions difficult. Neworn porcine trche (NPTr) cells [18], porcine lveolr mcrophges (PAMs), nd precision-cut lung slices (PCLS) my constitute informtive nd complementry models to study the innte immune response to SIV. Respirtory epithelil cells nd PAMs re the min trget of the virus in vivo nd hve een successfully used for in vitro infection studies [6,15,16,19]. PCLS hve previously een used for infection studies in irds [2], cttle [21], nd pigs [22,23]. The PCLS culture system hs severl dvntges over other systems: the slices cn e otined in lrge numers nd the generl rchitecture of the tissue is preserved. Thus, differentited epithelil cells, which re the min trget cells of SIV, re mintined in situ nd the slices remin vile for more thn 7 dys [23]. Thus, NPTr cells, PAMs nd PCLS together enle the study of host/pthogen interctions in single-cell type popultions s well s multicellulr tissue, grnting more ccurte nlysis of the contriution of epithelil cells nd mcrophges to the glol disese response. Use of lung explnts (ie PCLS) to study SIV infection hs only een reported in few cses [23-27]. However, the focus of these studies ws not the chrcteriztion of the innte immune response to the virus. Here, we report the use of NPTr cells in comprison to PAMs nd PCLS for the study of the innte immune response to Europen H3N2 SIV. Trnscripts involved in the recognition of virl ptterns, interferon (IFN) type I nd III responses, nd regultion of the host response (suppressor of cytokine signling, SOCS) were ssessed y qpcr for their expression in response to the infection t different time points. Some significnt differences were oserved etween the three systems, notly in the expression of type III IFN mrna. For instnce, in NPTr cells nd PCLS we oserved mostly IFNβ nd IFNλ1 trnscript expression in response to the virus while in PAMs, IFN type III ws not significntly induced. The involvement of different signling pthwys such s jnus kinse (JAK)/signl trnsducer nd ctivtor of trnscription (STAT), mitogen-ctivted protein kinse (MAPK)/extrcellulr signl-regulted kinse (ERK1/2), nd phosphtidylinositide 3-kinse (PI3K)/protein kinse B (Akt) ws lso evluted in NPTr cells. Our results show cler induction of JAK/STAT nd MAPK (ERK1/2, p38) signling pthwys while the H3N2 SIV did not induce PI3K/Akt ctivtion in infected NPTr cells. The inhiition of the JAK/STAT pthwy using JAK Inhiitor I (4299) in infected NPTR cells hd cler impct on the response of IFN types I nd III nd the induction of SOCS1 t the trnscript level. All together, our dt contriute to n incresed understnding of the innte immune response of pigs to SIV. Mterils nd methods Ethics sttement Pigs used for this reserch were kept in the clinic for swine nd smll ruminnts for demonstrtion nd veterinry student trining (pprovl numer A627) or were otined from the INRA experimentl unit (Nouzilly, Frnce). A totl of 12 eight-week-old pigs (Germn Lndrce nd Lrge White) were used. Pigs were helthy nd showed no clinicl symptoms or serologicl evidence of influenz nd other respirtory or systemic diseses. All studies were crried out in ccordnce with the recommendtions of the Europen Convention for the Protection of Verterte Animls used for Experimentl nd Other Scientific Purposes (Europen Trety Series, nos. 123 [28] nd 17 [29] nd in ccordnce with the guidelines of the Institutionl Animl Cre nd Use committee t INRA (Frnce). The protocol ws pproved y the ntionl nd locl permitting uthorities (niml welfre officer of the University of Veterinry Medicine, Lower Sxony Stte Office for Consumer Protection nd Food Sfety). All experimentl mesurements were in ccordnce with the requirements of the ntionl niml welfre lw. Euthnsi nd tissue smpling were performed under sodium pentoritl nesthesi, nd ll efforts were mde to minimize suffering of the nimls. Epithelil cell line culture The neworn pig trche (NPTr, purchsed from Istituto Zooprofilttico Sperimentle, dell Lomrdi e dell Emili Romgn, Bresci, Itly) cells [18] (etween 3 nd 5 pssges) were cultured in Dulecco s modified Egle medium (DMEM) (Invitrogen, Cergy Pontoise, Frnce) supplemented with 1% fetl clf serum (FCS) (Sigm- Aldrich, Sint-Quentin, Frnce), 2 IU/mL of penicillin, nd 2 mg/ml of streptomycin (Invitrogen). Cells were plted onto sterile 24-well plstic pltes (Greiner ioone, Courtœuf, Frnce) nd incuted t 37 C in 5%
3 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 3 of 18 CO 2 humidified tmosphere. Su-pssges were mde when cells reched 1% confluence. Porcine lveolr mcrophges Porcine lveolr mcrophges (PAMs) were otined from roncho-lveolr lvge (BAL) fluid from totl of 7 eight-week-old pigs nd mintined in DMEM supplemented with 2% FCS, 14 mm 4-(2-hydroxyethyl)-1-piperzineethnesulfonic cid (HEPES) (Gico-Life Technologies SAS, Sint-Auin, Frnce),.1 mm non-essentil mino cids (Gico), 1 μg/ml gentmycin (Gico), 2 IU/mL of penicillin, nd 2 mg/ml of streptomycin (Invitrogen). Red lood cells were eliminted nd PAMs were isolted y multiple wshes nd low-speed centrifugtions. PAMs were plted onto sterile 24-well plstic pltes (Greiner io-one) nd incuted t 37 C nd 5% CO 2 for 3 h to llow mcrophges to dhere. Non-dherent cells were eliminted. PAMs represented > 9% of cells in roncho-lveolr lvge fluid s previously reported [3]. Precision-cut lung slices Precision-cut lung slices (PCLS) were prepred from the lungs of 5 eight-week-old pigs (minimum one slice/pig for ech time point). Immeditely fter euthnsi, lungs were crefully removed nd the left crnil, middle, nd cudl loes were filled with 37 C low-gelling temperture grose (GERBU Biotechnik GmH, Gierg, Germny) followed y polymeriztion on ice. Tissue ws excised in cylindricl portions (8-mm tissue-coring tool) nd roughly 2 slices/pig pproximtely 25 μm thick were prepred y using Krumdieck tissue slicer (model MD4-1, TSE systems, Chesterfield, MO, USA) with cycle speed of 6 slices/min. PCLS were incuted in 1 ml of Roswell Prk Memoril Institute medium (RPMI) 164 medium (Gico), supplemented with 1% ntiiotic/ntimycotic liquid (1X Antiiotic-Antimycotic, Gico), 1 μg/ml clotrimzole (Sigm Aldrich), 1 μg/ml enrofloxcin (Byer Animl Helth, Germny), nd 8 μg/ml knmycin (Gico) in sterile 24-well plte t 37 C nd 5% CO 2. The medium ws chnged every hour during the first 4 h nd once fter 24 h, prior to infection. Viility ws nlyzed y oserving ciliry ctivity under light microscope (Olympus CKX31, Tokyo, Jpn). In selected smples, slices were nlyzed for ronchoconstriction y ddition of 1-4 M methcholine (cetyl-ß-methylcholine chloride, Sigm-Aldrich), s previously descried [31]. Virus strin nd propgtion The swine influenz virus strin A/Swine/Bissendorf/ IDT1864/23 of the H3N2 sutype ws isolted from pig with cute respirtory syndrome in Germn herd nd kindly provided y Rlf Dürrwld, IDT Biologik GmH (Dessu-Rosslu, Germny). It ws further propgted in the porcine epithelil NPTr cell line y infection t low multiplicity of infection (MOI) (.1 plque forming unit/cell). NPTr cell line hs een demonstrted suitle for the culture of SIV [18]. Forty-eight hours post-infection, superntnts were clrified y low-speed centrifugtion (2 g, 5 min), then stored t -8 C until use. The virl titer of this stock reched plque forming units (pfu)/ml s determined y plque ssy on NPTr cells, s descried previously [32]. Virus infection NPTr cells nd PAMs were seeded onto sterile 24-well pltes t cells per well nd infected with H3N2 t n MOI of 1 (enling, ccording to the Poisson distriution, the infection of 63.2% of the cells with t lest one single prticle). After 1 h of incution t 37 C nd 5% CO 2 to llow virus dsorption, cells were wshed once with phosphte uffered sline (PBS) nd further mintined t 37 C nd 5% CO 2 in 1 ml of medium. For PCLS infection, the procedure ws nerly identicl except tht 1 6 pfu of virus/slice were used since it ws not possile to determine the numer of trget cells in single slice. The cells nd lung slices were incuted t 37 C nd 5% CO 2 for the different time points efore collection for RNA extrction or stining. Rel-time PCR ssys nd vlidtion of reference genes NPTr cells nd PAMs were lysed in RLT lysis uffer (Qigen, Courtœuf, Frnce). Precision-cut lung slices were lysed nd homogenized in Trizol regent (Invitrogen) using cermic eds (BioSpec Products, OK, USA) nd the FstPrep FP12 cell disrupter (Qiogene, Illkirch, Frnce). Totl RNA ws isolted using RNesy Mini Kit (Qigen) following the mnufcturer s recommendtions. Quntittive rel-time PCR (qpcr) ws performed using cdna synthesized s previously descried [33,34]. Primers to ssess trnscript expression nd virl repliction were lredy pulished or were designed using Clone Mnger 9 (Scientific & Eductionl Softwre, Cry, NC, USA) nd were purchsed from Eurogentec (Liège, Belgium) (Tle 1). Diluted cdna (4 ) ws comined with primer/proe sets nd IQ SYBR Green Supermix (Bio-Rd, Hercules, CA, USA) ccording to the mnufcturer s recommendtions. The qpcr conditions were 98 C for 3 s, followed y 37 cycles with denturtion t 95 C for 15 s nd nneling/elongtion for 3 s (nneling temperture, Tle 1). Rel time ssys were run on Bio-Rd Chromo 4 (Bio-Rd, Hercules, CA, USA). The specificity of the qpcr rections ws ssessed y nlyzing the melting curves of the products nd verifying the mplicon sizes. To minimize smple vrition we used identicl mounts of high qulity RNA from cells nd tissue. The RNA qulity ws ssessed y cpillry electrophoresis (Agilent 21 Bionlyzer, Agilent Technologies, Mssy, Frnce) nd RNA integrity numers
4 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 4 of 18 Tle 1 Primer sequences, nneling tempertures of primer sets ( C), expected PCR frgment sizes (p) nd ccession numers or references Primer nme ActB Bet ctin B2MI Bet-2-microgoulin CISH Cytokine-inducile SH2-contining protein GAPDH Glycerldehyde-3-phosphte dehydrogense HMBS-2 Hydroxymethylilne synthse 2 HPRT-1 Hypoxnthine phosphoriosyltrnsferse 1 IL-1β Interleukine 1 et IL-6 Interleukine 6 IL-8 Interleukine 8 IFNα (1-17) Interferon lph (Type I) IFNβ Interferon et (Type I) IFNγ Interferon gmm (Type II) IFNλ1/IL-29A Interferon lmd1 (Type III) IFNλ3/IL-28B Interferon lmd3 (Type III) inos Inducile nitric oxide synthse Mx1 Myxovirus resistnce 1 Mx2 Myxovirus resistnce 2 OAS Oligodenylte synthetse 1 SIV M protein PKR Protein Kinse RNA-dependent RPL-19 Riosoml protein L19 Primer sequence CACGCCATCCTGCGTCTGGA AGCACCGTGTTGGCGTAGAG CAAGATAGTTAAGTGGGATCGAGAC TGGTAACATCAATACGATTTCTGA GGGAATCTGGCTGGTATTGG CCGACAGTGTGAACAGGTAG CTTCACGACCATGGAGAAGG CCAAGCAGTTGGTGGTACAG AGGATGGGCAACTCTACCTG GATGGTGGCCTGCATAGTCT GGACTTGAATCATGTTTGTG CAGATGTTTCCAAACTCAAC AGAAGAGCCCATCGTCCTTG GAGAGCCTTCAGCTCATGTG ATCAGGAGACCTGCTTGATG TGGTGGCTTTGTCTGGATTC TCCTGCTTTCTGCAGCTCTC GGGTGGAAAGGTGTGGAATG GGCTCTGGTGCATGAGATGC CAGCCAGGATGGAGTCCTCC ATGTCAGAAGCTCCTGGGACAGTT AGGTCATCCATCTGCCCATCAAGT GCTCTGGGAAACTGAATGAC TCTCTGGCCTTGGAACATAG GAGGCTGAGCTAGACTTGAC CCTGAAGTTCGACGTGGATG GGCTCCTTGGCGAACTCATC TCCTTCTTCTGGGCCTCCTG GAGAGGCAGAGGCTTGAGAC TGGAGGAGCTGATGGAGTAG AGTGTCGGCTGTTTACCAAG TTCACAAACCCTGGCAACTC CCGACTTCAGTTCAGGATGG ACAGGAGACGGTCCGTTTAC CCCTGTTCGCGTCTCCAAAG GCGGGCAGGACATCAAACTC AGATGAGTCTTCTAACCGAGGTCG TGCAAAAACATCTTCAAGTCTCTG GACATCCAAAGCAGCTCTCC CGCTCTACCTTCTCGCAATC AACTCCCGTCAGCAGATCC AGTACCCTTCCGCTTACCG Anneling temperture (s) ( C) PCR product (p) Accession numer or reference 63 1 [38] [38] BE AF [38] 6 91 [38] NM_ NM_ NM_ [39] [39] NM_ NM_ GQ BI NM_ AB NM_ [4] NM_ [41]
5 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 5 of 18 Tle 1 Primer sequences, nneling tempertures of primer sets ( C), expected PCR frgment sizes (p) nd ccession numers or references (Continued) RIG-I Retinoic cid-inducile gene I SDHA Succinte dehydrogense complex suunit A SOCS1 Suppressor of cytokine signling 1 SOCS3 Suppressor of cytokine signling 3 TBP-1 TATA ox inding protein 1 TLR3 Toll Like Receptor 3 TLR7 Toll Like Receptor 7 TLR8 Toll Like Receptor 8 TNFα Tumor Necrosis Fctor lph Reference genes re in itlic. CGACATTGCTCAGTGCAATC TCAGCGTTAGCAGTCAGAAG CTACAAGGGGCAGGTTCTGA AAGACAACGAGGTCCAGGAG CGCCCTCAGTGTGAAGATGG GCTCGAAGAGGCAGTCGAAG CAGCTCCAAGAGCGAGTACC TGACGCTGAGCGTGAAGAGG AACAGTTCAGTAGTTATGAGCCAGA AGATGTTCTCAAACGCTTCG CCTGCATTCCAGAAGTTGAG TGAGGTGGAGTATTGCAGAG TCAGCTACAACCAGCTGAAG CAGATGTCGCAACTGGAAAG AGCGCGGGAGGAGTATTGTG GCCAGGGCAGCCAACATAAC CCAATGGCAGAGTGGGTATG TGAAGAGGACCTGGGAGTAG NM_ [38] EW NM_ [38] NM_ NM_ NM_ X54859 (RIN) were clculted. RIN were lwys 8.1 for tissue nd 9.5 for cells. Smples were normlized internlly y simultneously using the verge Cycle quntifiction (Cq) of the three most suitle reference genes in ech smple to void ny rtefct of vrition in the trget gene. These three most suitle reference genes were selected mong eight commonly used reference genes. The genes included et-ctin (ActB), et-2-microgloulin (B2MI), glycerl dehyde-3-phosphte dehydrogense (GAPDH), hydroxymethylilne synthse (HMBS), hypoxnthine phosphori osyltrnsferse-1 (HPRT-1), riosoml protein L-19 (RPL-19), succinte dehydrogense complex suunit A (SDHA) nd TATA ox inding protein-1 (TPB-1) (Tle 1). The stility of these reference genes ws investigted simultneously in control nd infected (1 to 24 h post-infection) NPTR cells, PAMs, nd PCLS using the genorm ppliction [31,35,36]. The threshold for eliminting gene ws M 1 for tissue smples nd M.5 for cells s recommended [36]. The correltion coefficients of the stndrd curves were >.995 nd the concentrtion of the test smples ws clculted from the stndrd curves, ccording to the formul y = -M*Cq + B, where M is the slope of the curve, Cq the first positive second derivtive mximum of mplifiction curve clculted using PCR Miner [37] nd B the y-xis intercept. All qpcrs displyed efficiency etween 9% nd 11%. Expression dt were expressed s reltive vlues fter Genex mcro nlysis (Bio-Rd, Hercules, CA, USA) [35]. Cryosections nd immunofluorescence nlysis Infected nd non-infected PCLS were mounted on smll pieces of filter pper with tissue-freezing medium (Jung, Heidelerg, Germny), then frozen in liquid nitrogen nd kept t -8 C prior to cutting. Ten μm-thick slices were cut y cryotome (Reichert-Jung, Nußloch, Germny). The sections were dried overnight t room temperture nd then kept frozen t -2 C until stining. The sections were fixed with 3% prformldehyde for 2 min nd permeilized with.2% Triton X-1 for 5 min followed y three wshing steps with PBS. All ntiodies were diluted in 1% ovine serum lumin (Sigm-Aldrich) nd incuted with the sections for 1 h t room temperture (RT) in humid incution chmer. After the finl incution step, the sections were wshed three times with PBS nd once with distilled wter. The slices were emedded in Mowiol 4-88 resin (Sigm-Aldrich), covered y no. 1½ circulr micro-cover glss (12 mm) (Electron Microscopy Sciences, Htfield, PA, USA), nd stored t 4 C until exmintion under the confocl microscope. For detection of infected cells, monoclonl ntiody (IgG2) ginst the influenz A virus nucleoprotein (NP) (Clone AA5H, ADSeroTec MCA4, Düsseldorf, Germny) ws used t 1:75 dilution followed y incution with n nti-mouse IgG (Sigm-Aldrich) secondry ntiody. To visulize cili, smples were treted with Cy3-leled monoclonl ntiody recognizing et-tuulin (dilution 1/6) (Sigm- Aldrich). Nuclei were stined y incuting sections for
6 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 6 of min t 37 C in 4,6 -dimidino-2-phenylindole (DAPI) (Life Technologies Inc., Drmstdt, Germny). Western lotting NPTr cells ( cells/well) were virus-infected t n MOI of 1, then incuted for 5, 1, 3, 6 or 24 min. Cells were then disrupted using the lysis uffer (1 mm Tris ph 7.4, 15 mm NCl, 1 mm ethylene glycol tetrcetic cid, 1 mm ethylene dimine tetrcetic cid-edta, 1% (v/v) Triton -1,.5% NP-4), protese inhiitors (2 mm phenyl methyl sulfonyl fluoride- PMSF, 1 μg/ml leupeptin, 1 μg/ml protinin) nd phosphtse inhiitors (1 mm sodium fluoride, 1 mm sodium pyrophosphte, 2 mm sodium orthovndte) (Sigm-Aldrich) (Bio-Rd, Mrnes-l-Coquette, Frnce). Lystes were incuted on ice for 3 min nd then centrifuged t 12 g for 2 min t 4 C. Equl mounts of proteins were seprted using sodium dodecyl sulfte polycrylmide gel electrophoresis (SDS- PAGE) nd trnsferred onto nitrocellulose memrne. Memrnes were then incuted for 1 h t RT with Tris-uffered sline (TBS, 2 mm Tris-HCL, ph 8, 15 mm NCl, ph 7.6), contining 5% non-ft dry milk powder (NFDMP) nd.1% Tween-2 (Bio-Rd) to sturte non-specific sites. Then memrnes were incuted overnight t 4 C with pproprite primry ntiodies (finl dilution 1:1, see Tle 2) in TBS contining.1% Tween-2 nd 5% NFDMP. The memrnes were wshed in TBS-.1% Tween-2 nd incuted for 2 h t RT with horserdish peroxidse-conjugted secondry ntiody (finl dilution 1:1 ). After wshing, proteins were detected y enhnced chemiluminescence (Western Lightning Plus-ECL, Perkin Elmer, Courtœuf, Frnce) using G:Box SynGene (Ozyme, Sint-Quentin-en- Yvelines, Frnce) with the GeneSnp softwre (Syngene UK, Cmridge, UK, relese ). Detected signls were quntified with the GeneTools softwre (Syngene UK, relese 4.1.2). The results re expressed s the signl intensity in ritrry units fter normliztion s indicted in the figure legends. Antiodies nd chemicl inhiitors Antiodies to phospho-akt (Ser 473), phospho-erk1/2 (Thr 22/Tyr 24), phospho-jak2 (Tyr 17/18), nd phospho-p38 (Thr18/Tyr182) were purchsed from Ozyme. Monoclonl nd polyclonl ntiodies to Akt, ERK2, p38, nd JAK2 were otined from Teu Bio (Le Perry-en-Yvelines, Frnce) nd Ozyme. All ntiodies were used t 1:1 dilution in ssys. Stock solutions of phrmcologicl inhiitors such s inhiitor U126 (inhiiting MEK1/2 nd ERK1/2), p38/sapk2-specific inhiitor SB 2219, nd JAK Inhiitor I (4299) (Millipore, Molsheim, Frnce) were ll prepred s 1- concentrted stocks in dimethyl sulfoxide (DMSO), in order to ensure tht the finl concentrtion of DMSO in the culture medium did not exceed.1%. Strting one hour efore infection, NPTr cells were treted for the whole procedure with ech inhiitor t concentrtion of 1 μm to lock the signling. The lockge of the cscdes ws verified t 3 min post-infection. Sttisticl nlysis Expression of mrna in cells nd tissues ws expressed s reltive vlues. All sttisticl nlyses were done using Prism 5 computer softwre (Prism 5 for Windows; GrphPd Softwre, Sn Diego, CA, USA). One-Wy ANOVA ws used to detect differences etween groups. To ccount for the non-norml distriution, ll dt were sorted y rnk prior to performing the ANOVA. Tukey s test ws used to compre the mens of the rnks mong the groups. P vlues less thn.5 were considered significnt. Tle 2 Antiodies used for Western lotting Trget Antiody Dilution Rit polyclonl nti-phospho-akt (Ser473) Phospho-Akt #9271 (Ozyme) 1/1 Rit monoclonl nti-phospho-p44/42 MAPK (Erk1/2) Phospho-ERK1/2 (Thr22/Tyr24) (D E) #437 (Ozyme) 1/1 Rit polyclonl nti-phospho-jak2 (Tyr17/18) Phospho-JAK2 #3771 (Ozyme) 1/1 Rit monoclonl nti-phospho-p38 MAPK (Thr18/Tyr182) Phospho-p38 (12 F8) #4631 (Ozyme) 1/1 Akt Rit monoclonl nti-akt (11E7) #4685 (Ozyme) 1/1 ERK2 Rit polyclonl nti-erk2 (GTX27948) (teu-io) 1/1 JAK2 Rit monoclonl nti-jak2 (D2E12) #323 (Ozyme) 1/1 p38 Rit polyclonl nti-p38 MAPK (GTX5566) (teu-io) 1/1 See lso Additionl files 1 nd 2.
7 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 7 of 18 Results Reference gene selection In order to chrcterize the immune response ginst our strin of SIV in vivo nd ex vivo using qpcr ssys, vlidtion of the three most stle reference genes in NPTr cells, PAMs, nd PCLS ws required (Figure 1). Eight previously descried reference genes [33,38,42] were selected for ssessment of their stility in our conditions. The selection ws sed on the M vlue using genorm. The threshold ws set t.5 for homogenous smples (e.g. NPTr cells nd PAMs) nd 1 for heterogeneous smples (PCLS) [36]. The genorm nlysis showed tht HPRT-1, HMBS-2, nd RPL-19 were the three most stle genes in NPTr cells with n M vlue of.119,.119, nd.117, respectively (Figure 1). All of the reference genes tested hd M vlues elow the threshold, except ActB (.51). In PAMs the sitution ws roughly similr nd gin ActB ws the only gene with n M vlue ove the elimintion threshold (.523); the three most stle genes were SDHA, RPL-19, nd TBP-1 (.293,.232, nd.232, respectively) (Figure 1). The selected genes for PCLS were TBP-1, HPRT-1 nd HMBS-2, hving n M vlue of.35,.211, nd.211, respectively (Figure 1). In the three systems, RPL19 ws considered the most stle reference gene. ActB ws the most vrile reference gene with n M vlue equl or higher thn the threshold. Virl repliction in neworn pig trche cells nd lveolr mcrophges In order to verify the cpcity of our SIV strin to infect NPTr cells nd PAMs, we ssessed virl repliction through quntifiction of the virl M-segment RNA (M-vRNA) in oth cell types (Figures 2 nd 3). M gene quntifiction ws elow the experimentl ckground in oth control groups (Figures 2 nd 3). In infected NPTr cells, M-vRNA ws detected (P <.1) t 1 h post-infection (hpi) nd reched its highest levels 8 nd 24 hpi (P <.1) (Figure 2). Similr results were otined in PAMs, with detection of M-vRNA s erly s 1 hpi (Figure 3); however its level remined slightly lower thn tht oserved in NPTr cells (Cq 28 t 1 h for oth cell types, nd 24 nd 18 t 8 h for PAMs nd NPTr, respectively). The highest levels of M-vRNA were lso oserved 8-24 hpi in PAMs (Figure 3). Innte immune response evlution in epithelil cells nd lveolr mcrophges Respirtory epithelil cells nd PAMs re the first cells encountered y the influenz A virus during n infection in the pig. To explore the innte cellulr response, the expression of vrious trnscripts ws ssessed (Tle 1 nd Figures 2 nd 3). The virus induced the expression of RIG-I mrna s erly s 3 hpi reching the highest levels of expression t 24 h in NPTr cells (Figure 2). In PAMs, significnt increse (P <.1) of RIG-I mrna ws oserved only fter 24 h of infection (Figure 3). Regrding TLR3, TLR7, nd TLR8 no sttisticlly significnt differences were oserved etween control nd infected NPTr cells (dt not shown). However in PAMs, TLR3, TLR7, nd TLR8 mrna expressions were significntly up-regulted y the virl infection (Figure 3). Expression of IFNβ mrna ws clerly incresed from 3 hpi in NPTr cells (P<.5), nd from 8 hpi in PAMs (P<.1) (Figures 2 nd 3), nd reched its highest level t 24 hpi in oth cell types (P<.1). No significnt differences in IFNα mrna were oserved etween controls nd infected cells, whtever the cell type (Additionl file 1). For IFN type III such s IFNλ1, sttisticlly significnt increses were oserved fter 8 nd 24 h in NPTr cells ut not in PAMs (Figures 2 nd 3) while no significnt differences were oserved for IFNλ3 (dt not shown). Regrding the interferon-stimulted genes (ISGs) (Figures 2 nd 3), virus-induced mrna over-expressions NPTr cells PAMs PCLS Mvlue.5 Mvlue.5 M vlue ActB GAPDH SDHA B2MI TBP-1 HPRT-1 HMBS-2 RPL-19. ActB HMBS-2 B2MI GAPDH HPRT-1 SDHA RPL-19 TBP-1. ActB B2MI GAPDH RPL-19 SDHA TBP-1 HPRT-1 HMBS-2 Figure 1 Selected cndidte reference genes nd their expression stility. The stility of the reference genes hs een ssessed in mix of non-infected nd infected neworn pig trche cells (NPTr), porcine lveolr mcrophges (PAMs) nd precision-cut lung slices (PCLS) t the different time points. Gene expression stility of cndidte reference genes ws nlyzed y the genorm ppliction. Threshold for eliminting gene ws 1. for PCLS nd.5 for NPTr cells nd PAMs. The three most stle reference genes re depicted in green.
8 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 8 of 18 NPTr cells Reltive Expression Virl repliction (MOI:1) RIG-I IFNβ ** * IFNλ1 Mx1 OAS1 3 2 PKR IL-6 SOCS ** 2 1 Figure 2 Reltive expression of M-virl RNA nd of host trnscripts in infected neworn pig trche cells. The NPTr cells were infected with the H3N2 SIV strin t different time points (1 h, 3 h, 8 h, nd 24 h). Green dots stnd for non-infected NPTr cells nd red dots for infected cells (individul vlues (dots) nd medin vlue (r), n = 6 wells per condition). Comprisons were mde using one wy ANOVA test nd Tukey s post-test. Differences were considered significnt when P <.5 (*), P <.1 (**) or P <.1 (). (P <.5 nd.1) were oserved for myxovirus resistnce 1 (Mx1), nd Mx2 (dt not shown), 2-5 oligodenylte synthetse 1 (OAS1), nd protein kinse R (PKR) from 3 hpi in NPTr cells nd from 8 (Mx1) or 24 hpi (Mx2 dt not shown) in PAMs (P<.1). The pttern of expression for these genes ws similr to tht oserved for IFNβ trnscripts. Among ll nlyzed SOCS trnscripts, only SOCS1 mrna showed sttisticlly incresed expression fter 24 h in oth NPTr cells nd PAMs (P<.1). IL-6 (Figure 2) nd IL-8 (dt not shown) mrnas were lso up-regulted in response to the infection in NPTr cells t 8 nd 24 hpi ut not in PAMs. Regrding IL-1β nd TNFα trnscripts, we did not detect ny significnt differences etween conditions in NPTr cells even though some trends of induction y the virus were oserved (dt not shown), while TNFα mrna expression ws significntly incresed (P <.1)in response to the virus in PAMs fter only 3 h of infection (Figure 3). Virl infection of precision-cut lung slices The innte response of PCLS infected with SIV ws lso nlyzed. A minimum of one slice/pig (n = 5) ws generted t ech time point. The viility of the PCLS ws verified prior to infection: the ciliry ctivity of the ronchil epithelium ws mintined when nlyzed t 24, 48, nd 96 h fter their preprtion (dt not shown).
9 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 9 of 18 PAMs Virl repliction (MOI:1) RIG-I TLR TLR7 TLR8 IFNβ Reltive Expression * * 2 IFNλ1 Mx1 OAS ** PKR TNFα SOCS1 15 ** Figure 3 Reltive expression of vrious virl nd host trnscripts in infected porcine lveolr mcrophges (PAMs). The cells were infected with the H3N2 SIV strin t different time points (1 h, 3 h, 8 h, nd 24 h). Green dots stnd for non-infected PAMs nd red dots for infected PAMs (ech individul vlue (n = 7) represents the dt otined with PAMs prepred from one pig, r represents the medin vlue). Comprisons were mde using one wy ANOVA test nd Tukey s post-test. Differences were considered significnt when P <.5 (*), P <.1(**)orP <.1 ().
10 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 1 of 18 3 h 8 h 24 h 48 h Figure 4 Immunostining of infected Precision-cut lung slices (PCLS). The slices were infected y the H3N2 SIV strin. Cryosections were prepred fter 3, 8, 24, nd 48 h of infection nd imge dt were collected using lser-scnning confocl microscope. Infected cells were stined with n nti-nucleoprotein polyclonl ntiody (green) for the detection of SIV. Cilited cells were stined using n nti-et-tuulin monoclonl ntiody (red). Cell nuclei of prepred slides were stined y incution with 4,6 -dimidino-2-phenylindole (DAPI, lue). Scle r = 2 μm. Additionlly, ronchoconstriction could e triggered y the use of 1-4 M methcholine in the four dys following slice preprtion (dt not shown) nd susequently reversed y removl of the drug. These oservtions provided evidence tht porcine PCLS remined vile for up to 96 h under the incution conditions descried in the mteril nd methods section. To monitor virl infection of the slices, cryosections of PCLS were stined with n ntiody-trgeting SIV nucleoprotein. Only few infected cells were oserved fter 3 h of culture with the virus (Figure 4), while the numer ws considerly incresed t 8 hpi. The generl rchitecture of the tissue ws progressively ltered y the virl infectious process, nd fter 24 nd 48 h significnt lysis of the epithelium ws oserved (Figure 4). In prllel, virl repliction ws ssessed in the PCLS y qpcr ssys trgeting the virl M gene segment (Figure 5). M-vRNA ws detected only in infected groups, reching its mximum t 24 hpi (verge Cq: 22). Host trnscript expression in precision-cut lung slices Lung slices offer more relistic system thn cell lines to study the interction etween host nd pthogen. To etter chrcterize the innte immune response towrd the SIV strin, PCLS were infected nd the expression of severl host genes involved in the ntivirl response ws ssessed t different time points using qpcr ssys (Tle 1 nd Figure 5). An increse in RIG-I trnscripts ws oserved t 8 h, ut it did not ecome significnt until 24 hpi (P <.1). We did not detect ny sttisticlly significnt increse in expression of TLR3, TLR7, nd TLR8 trnscripts post-infection, however some trends potentilly indicting virl induction were oserved (dt not shown). In response to the virus, IFNβ nd IFNλ1 mrna expression were significntly incresed (P <.1) t 24 hpi (Figure 5) while no significnt increse ws oserved for IFNα nd IFNλ3 (Additionl file 1 nd dt not shown). Along with the incresed expression of IFN types I nd III trnscripts, mrna expression of ISGs Mx1, Mx2, nd PKR ws lso significntly elevted reltive to controls fter 24 h of infection (P <.1) (Figure 5 nd dt not shown). The mrna expression of OAS1 ws significntly incresed (P <.5) fter only 8 h of infection (Figure 5). Unlike IL-1β, IL-8, nd TNFα, IL-6 trnscription ws significntly up-regulted 8 h fter infection (Figure 5). Overll, except for IFNλ1 nd IL-6, similr ptterns of trnscript expression were oserved in vitro in the epithelil cells nd lveolr mcrophges nd ex vivo in the PCLS. Regrding the mrna expression of SOCS (CISH, SOCS1, nd
11 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 11 of 18 PCLS Virl repliction (1 6 pfu/pcls) RIG-I IFNβ C I C I C I C I C I C I C I C I C I Reltive Expression h 8h 24h C I C I C I 3h 8h 24h 25 ** h 8h 24h C I C I C I 3h 8h 24h h 8h 24h IFNλ1 Mx1 OAS1 C I C I C I * 3h 8h 24h PKR IL-6 SOCS ** C I C I C I C I C I C I C I C I C I 3h 8h 24h 3h 8h 24h 3h 8h 24h Figure 5 Reltive expression of M-vRNA nd of host trnscripts in infected precision-cut lung slices (PCLS). The slices were infected with the H3N2 SIV strin t different time points (3 h, 8 h, nd 24 h). Green dots stnd for non-infected PCLS nd red dots for infected PCLS (minimum one slice/pig for ech time point, totl 5 pigs, n = 5-12 nd medin vlue). Comprisons were mde using one wy ANOVA test nd Tukey s post-test. Differences were considered significnt when P <.5 (*), P <.1 (**) or P <.1 (). SOCS3), only SOCS1 trnscripts were significntly incresed t 24 hpi in PCLS (P <.1) (Figure 5). These findings re similr to those oserved with NPTr cells nd PAMs nd suggest n involvement of SOCS1 in the immune response ginst SIV. Activtion of MAP kinses nd JAK/STAT pthwys in virus-infected epithelil cells During influenz A infection, vrious signling cscdes re triggered to counterct pthogen repliction nd spreding. Mny of these signling pthwys re controlled to certin extent y SOCS proteins [43]. We exmined the ctivtion of severl signling pthwys involved in pro-inflmmtory nd ntivirl gene expression in response to SIV infection in NPTr cells. MAPK pthwys, oth ERK1/2 nd p38, showed phosphoryltions fter 5 min of contct with the virus while phosphoryltion-medited ctivtion of JAK2 ppered etween 3 nd 6 min post-infection (Figures 6A, B, nd C). In contrst, ctivtion of the PI3K/Akt signling pthwy ws not oserved t ny time points (Figure 6D); in generl, pek of phosphoryltion ws oserved fter 3 to 6 min of infection, followed y decrese 4 hpi (Figures 6A, B, nd C). These results showed tht our SIV strin efficiently nd rpidly ctivted MAPK (ERK1/2, p38) nd JAK/STAT pthwys in NPTr cells.
12 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 12 of 18 A Reltive Density (perk-erk) B Reltive Density (pp38-p38) perk1/2 pp38 ERK1/2 p38 C TIME Reltive Density (pjak2-jak2) MINUTES, D TIME Reltive Density (pakt-akt) MINUTES pjak2 pakt JAK2 Akt TIME TIME MINUTES MINUTES Figure 6 Western lots in infected NPTr cells. Western lots for phospho-erk1/2 (perk1/2) (A), phospho-p38 (pp38) (B), phospho-jak2 (pjak2) (C), nd phospho-akt (pakt) (D) were performed in neworn porcine trche (NPTr) cells infected with H3N2 SIV t different time points (, 5, 1, 3, 6, nd 24 min). Totl ERK1/2, p38 nd JAK2 re shown s loding controls nd did not chnge with ech condition over time. Dt re presented s mens ± SEM, (n = 3). Results re representtive of three independent experiments. Different letters indicte significnt differences (one wy ANOVA, P <.5) s compred to control (time ). Specific inhiition of pthwys ctivted in epithelil cells To investigte whether the MAPK nd JAK/STAT pthwys re involved in the regultion of SOCS1 mrna expression in porcine epithelil cells, NPTr cells were pre-treted with chemicl inhiitors trgeting these pthwys, nd the expression of SOCS1 trnscripts ws ssessed t 24 hpi (Figures 7, 8 nd 9). One h fter the pre-tretment, NPTr cells were infected with the H3N2 strin nd phosphoryltion ws evluted t 3 min post-infection, corresponding to the pek of ctivtion (Figure 7). NPTr cells pre-treted with inhiitors of ERK1/2 (U126), p38 (SB 2219) nd JAK/STAT (JAK Inhiitor I) in the sence of virus infection showed sl levels of phosphoryltion similr to those oserved in control groups. By contrst, pre-treted infected cells displyed complete olition of phosphoryltion in ERK1/2, p38 nd JAK/STAT pthwys (Figure 7) lsting more thn 24 h (dt not shown). In order to determine whether these signling pthwys re involved in the regultion of SOCS1 mrna expression, the ssessment of SOCS1 mrna expression fter inhiitor tretments ws performed following the sme timing (Figure 8) s in the previous experiment (Figure 2). It ws oserved tht the lockde of ERK1/2 nd p38 did not significntly ffect SOCS1 mrna expression fter 24 h of infection (Figure 8). However, sttisticlly significnt decrese of SOCS1 mrna expression ws oserved in NPTr cells treted with JAK Inhiitor I demonstrting n ssocition etween ctivtion of JAK/STAT pthwy nd SOCS1 mrna expression in porcine respirtory epithelil cells. To further ssess the impct of JAK/ STAT pthwy-inhiition on virus repliction nd innte response, the reltive expression of M-vRNA nd mrnas for severl host proteins ws ssessed (Figure 9). Virl repliction ws not significntly modified y JAK Inhiitor I except fter 24 h of infection (P <.1) (Figure 9). Similrly the trnscript expression of RIG-I, IFNβ, IFNλ1, PKR, nd Mx1 ws significntly decresed (P <.1) under JAK Inhiitor I tretment fter 24 h of infection (Figure 9). The inhiition of ERK1/2 nd p38
13 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 13 of 18 ERK1/2 p38 JAK/STAT Reltive Density (perk-erk) c Reltive Density (pp38-p38) Reltive Density (pjak2-jak2) perk1/2 pp38 pjak2 ERK1/2 U126 H3N2 - - p SB H3N JAK2 JAK2 Inhi H3N Figure 7 Western lots in infected NPTr cells in presence or sence of chemicl inhiitor. Western lots for phospho-erk1/2 (perk1/2), phospho-p38 (pp38) nd phospho-jak2 (pjak2) in neworn porcine trche (NPTr) cells infected with H3N2 SIV t 3 min in presence or in sence of chemicl inhiitors UO126 (ERK1/2), SB2219 (p38), nd JAK inhiitor (JAK Inhiitor I). The control group ws cultured in presence of DMSO, dt re represented s mens ± SEM, (n = 3). Results re representtive of three independent experiments. Different letters indicte significnt differences (one wy ANOVA, P <.5) s compred to control (without inhiitor nd virus). + + hd less impct on virl repliction nd interferon response (Additionl file 2). Virl repliction ws significntly reduced (P <.1) t 8 (p38) nd 24 hpi (ERK1/2) nd OAS1 trnscript expression ws significntly reduced (P <.1) with oth inhiitors 24 hpi. All together these results demonstrted link etween the JAK/STAT pthwy nd SOCS1 in pigs. Discussion The innte immune response to swine influenz viruses hs een ssessed in mny previous studies [6,16]. However, to our knowledge most of these studies were crried out in single-cell popultions or directly in n niml host. In this study we compred n epithelil cell line (NPTr), lveolr mcrophges (PAMs), nd 6 SOCS1 ERK1/2 p38 JAK/STAT inhiitor inhiitor inhiitor 6 6 Reltive Expression 4 2 C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V Control Inhiitor Virus Inhiitor/Virus Figure 8 Reltive expression of SOCS1 trnscripts in infected NPTr cells in presence of chemicl inhiitors. The reltive expression of SOCS1 trnscripts ws mesured in neworn porcine trche (NPTr) cells infected with H3N2 SIV in presence of chemicl inhiitors UO126 (ERK1/2), SB2219 (p38), nd JAK Inhiitor I (JAK/STAT) t different time points (1 h, 3 h, 8 h, nd 24 h). The control groups were cultured either in the presence of.1% DMSO (C, green) or in the presence of inhiitor (I, lue). Infected cells were either untreted (V, red) or inhiitor-treted (I + V, ornge). Comprisons were mde using one wy ANOVA test nd Tukey s post-test (n = 5, men ± SEM). Differences were considered significnt when P <.5(*),P <.1 (**) or P <.1 ().
14 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 14 of 18 JAK/STAT inhiitor Virl repliction (MOI:1) RIG-I IFNβ Reltive Expression C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V IFNλ1 PKR Mx C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V C I V I+V Control Inhiitor Virus Inhiitor/Virus Figure 9 Reltive expression of vrious virl nd host trnscripts in infected NPTr cells in presence of JAK Inhiitor I. The reltive expression of vrious virl nd host trnscripts ws mesured in neworn porcine trche (NPTr) cells infected with H3N2 SIV in presence of JAK Inhiitor I t different time points (1 h, 3 h, 8 h, nd 24 h). The control groups were cultured either in the presence of.1% DMSO (C, green) or in the presence of inhiitor (I, lue). Infected cells were either untreted (V, red) or inhiitor-treted (I + V, ornge). Comprisons were mde using one wy ANOVA test nd Tukey s post-test (n = 5, men ± SEM). Differences were considered significnt when P <.5 (*), P <.1 (**) or P <.1 (). precision cut lung slices (PCLS) for their innte immune response to strin A/Swine/Bissendorf/IDT1864/ 23 (H3N2). Then, we ssessed severl signling pthwys nd their reltion to the innte immune response oserved in the NPTr cells. Virl repliction ws higher in NPTr cells thn in PCLS nd PAMs. This is in greement with the current knowledge of influenz pthogenesis. Indeed, it is well known tht the min trget of the virus is epithelil cells [12,15] nd NPTr is cell line consisting of trchel epithelil cells [18]. This ws lso confirmed y the immune-stining of the PCLS, where mny cilited epithelil cells were oserved in the ssocited ronchi. In the three systems used in this study, strong nd progressive innte immune response ws triggered y the virus. The response in NPTr cells nd PCLS ws very similr except for trend towrd TLR induction in the ltter. This could e explined y the presence of vrious cell types such s mcrophges nd/or dendritic cells in this tissue [6,14]. Moreover, oserved discrepncies etween NPTr cells nd PCLS my lso e relted to the less controlled percentge of cells infected in the PCLS (MOI cnnot e determined) nd to the potentil resistnce of significnt proportion of the vrious cell types to SIV infection. Our study further demonstrted the vlue of using PCLS in the study of pig/siv interctions. RIG-I trnscription ws induced y the virus in NPTr cells, PAMs, nd PCLS while TLR3, TLR7 s well s TLR8 trnscription were significntly induced only in PAMs. This result ws little it surprising since it hs een oserved recently tht irwy epithelil cells mostly use surfce nd endosoml TLR3 to detect influenz virus nd to initite IFN production [44]. Following recognition of the virus, interferon responses were triggered. In NPTr cells nd PCLS we oserved mostly IFNβ nd IFNλ1 trnscript expression in response to the virus while in PAMs, IFN type III ws not significntly induced. Regrding the expression of IFNα trnscripts,
15 Delgdo-Orteg et l. Veterinry Reserch 214, 45:42 Pge 15 of 18 no significnt differences etween infected nd noninfected cells/tissues were oserved. This result is surprising s IFNα trnscripts were previously detected in PAMs infected y nother strin of SIV [45]. In tht study IFNα mrna ws detected erlier thn IFNβ mrna. The use of qpcr primers trgeting IFNα 1-17 my hve msked differences in the expression of trnscripts ssocited to specific IFNα gene. It is known tht significnt vritions in the expression of the vrious IFNα trnscripts upon infection cn e oserved [46]. Recently, it hs een demonstrted tht type III IFN is the predominnt IFN produced y the irwy epithelium [44]. Our dt showed the incresed production of mrnas encoding oth type I nd type III IFNs in epithelil cells. The sence of type III IFN induction in PAMs supports the ide of predominnt role of type III IFN in specific cell type such s epithelil cells s suggested y Ionnidis et l. [44]. In response to IFN, ISG (Mx1, Mx2, OAS1, PKR) trnscripts were identified in the three systems. This oservtion ws prticulrly cler with the NPTr cells proly ecuse of their nture (epithelil versus lveolr mcrophges) nd their high purity in comprison to primry epithelil cells locted in the slices. These two fetures lso proly ccount for the quicker nd higher response oserved in NPTr cells when compred to PAMs nd PCLs. Becuse of their role in the regultion of immune response [47,48] nd in influenz pthogenesis [49], we looked t the expression of SOCS trnscripts in response to SIV in the three systems. Twenty-four hpi SOCS1 trnscripts were up-regulted in the three systems. This oservtion confirmed our previous study postulting the inducile nture of SOCS1 in porcine lungs [33]. Insted of SOCS1, role for SOCS3 hs een recently identified in pigs [5]. The uthors showed tht the lower susceptiility of pigs to contemporry Eursin highly pthogenic vin influenz (HPAI) H5N1 virus infection is linked to SOCS3 induction. Under their conditions, swine epithelil cells were expressing SOCS3 proteins in response to oth humn H1N1 virus nd HPAI H5N1 virus [5]. In nother study, it ws demonstrted tht influenz A virus induced NF-κB dependent SOCS3 gene expression in humn epithelil cells, suppressing type I IFN response through the JAK/STAT pthwy [51]. In our conditions, SOCS3 ws never significntly induced in response to H3N2 SIV. It remins to e shown whether these differences re due to different experimentl prmeters (e.g. virus strin nd timing of mesurements) or potentil discrepncies etween RNA levels nd protein expression. In NPTr cells, the Akt signling pthwy ws not significntly induced, while we did oserve the triggering of MAPK (ERK1/2 nd p38) nd JAK/STAT pthwys. The sence of Akt ctivtion ws unexpected, since this signling pthwy ws shown to e ctivted y influenz A virus, proly fvoring virl repliction [32,52]. However, we ssessed different pthwy ctivtions erly in the infection process, nd the protocol used in our study did not llow for the oservtion of Akt ctivtion. The ctivtion of JAK/STAT pthwy hs een reported in other species [13]. This pthwy controls type I IFN response. JAK/STAT signling induced formtion of trimeric trnscription fctor ISGF3, consisting of STAT1, STAT2, nd interferon regultory fctor 9 (IRF-9), which regultes the expression of severl ISGs [13]. Four MAPK cscdes hve een descried including two isoforms of the ERK1/2, the Jun-terminl kinse (JNK), p38, nd ERK5 [52,53]. The signling pthwys convert extr- nd intrcellulr signls into cellulr responses, regulting cell ctivtion, differentition, immune responses, nd prolifertion [52,53]. In our study we ssessed the ctivtion of ERK1/2 nd p38, nd ctivtion of oth cscdes ws oserved. p38 predominntly responds to stress conditions nd pro-inflmmtory cytokines, wheres ERK1/2 senses mitogenic stimuli [52,53]. MAPK signling pthwys nd their role in the regultion of innte response nd virl repliction hve not een well studied in porcine cells infected y influenz virus. However, recent study showed roust ctivtion of ERK1/2 in influenz virus-infected swine mcrophges [54] nd demonstrted tht the induction of RIG-I nd MDA-5 depends on the ctivtion of ERK1/2 nd JNK in these cells. Interestingly nd similr to our findings, these uthors did not oserve ny IL-1β induction in response to the tested influenz virus [54]. Unlike IL-1β expression, TNFα ws clerly induced erly t 3 hpi. We lso investigted to wht extent inhiitors of the different pthwys could impct SOCS1 trnscription. Only JAK/STAT pthwy inhiition ws ccompnied y significnt decrese in the expression of SOCS1 trnscripts. This oservtion confirms the strong ssocition of SOCS (prticulrly CISH, SOCS1, nd SOCS3) with the JAK/STAT pthwy. Nevertheless, in our conditions the ssocition ws only cler for SOCS1 nd not for the two other SOCS fmily memers. To further ssess the impct of JAK/STAT pthwy inhiition, we then looked t the expression of trnscripts ccounting for virl repliction, virl recognition nd interferon response. The tretment with JAK Inhiitor I ws ccompnied y significnt decrese in virl repliction (s ssessed y quntifiction of M-vRNA) nd y diminished expression of RIG-I, IFNβ, IFNλ1, PKR, nd Mx1 trnscripts 24 h post-infection. The decrese in virl repliction remins unexplined, lthough it could e linked to the presence of more IFN in the culture superntnt consecutive to n inhiition of SOCS1. However, the lower level of expression of IFN trnscripts rgues ginst this hypothesis. In nother set of experiments using nother
EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationINFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA
Pthology nd Hygiene INFLUENCE OF DIFFERENT STRAINS AND WAYS OF INOCULATION ON THE RABBIT S RESPONSE TO EXPERIMENTAL INFECTION WITH PASTEURELLA MULTOCIDA Kulcsár G. 1, Fáián K. 1 *, Brn T. 1, Virág Gy.
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationDR. MARC PAGÈS Project Manager R&D Biologicals - Coccidia Projects, HIPRA
DR. MARC PAGÈS Project Mnger R&D Biologicls - Coccidi Projects, HIPRA Dr. Mrc Pgès Bosch otined Microiology nd Genetics degree t the University of Brcelon in 1998. He otined his PhD working on the synptoneml
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationMeat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationComparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages
Murk et l. Respirtory Reserch (2018) 19:126 https://doi.org/10.1186/s12931-018-0825-9 RESEARCH Comprison of pro- nd nti-inflmmtory responses in pired humn primry irwy epithelil cells nd lveolr mcrophges
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationEFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE
Swine Dy 21 EFFECTS OF INGREDIENT AND WHOLE DIET IRRADIATION ON NURSERY PIG PERFORMANCE J. M. DeRouchey, M. D. Tokch, J. L. Nelssen, R. D. Goodbnd, S. S. Dritz 1, J. C. Woodworth, M. J. Webster, B. W.
More informationChapter 5: The peripheral nervous system Learning activity suggested answers
Chpter 5: The peripherl nervous system Lerning ctivity suggested nswers Lerning Activity 5.1 (p. 222) 1 Briefly descrie the two min functions of the somtic nervous system. Description should refer to:
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationEffect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
More informationNot for Citation or Publication Without Consent of the Author
Not for Cittion or Puliction Without Consent of the Author AN AUTOMATED SEX PHEROMONE TRAP FOR MONITORING ADULT CM AND OFM AND THE INFLUENCE OF TRAP COLOR ON MOTH AND NON-TARGET CAPTURES Brin L. Lehmn
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
More informationThe Dynamics of Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus
Chpter 2 The Dynmics of Vricell-Zoster Virus Epithelil Kertitis in Herpes Zoster Ophthlmicus The morphology of n individul VZV lesion reflects sequence of events triggered y the virus impct on cornel epithelil
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationNdfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells
Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher
More informationCharacterization of homologous and heterologous adaptive immune responses in porcine reproductive and respiratory syndrome virus infection
Díz et l. Veterinry Reserch 212, 43:3 http://www.veterinryreserch.org/content/43/1/3 VETERINARY RESEARCH RESEARCH Open Access Chrcteriztion of homologous nd heterologous dptive immune responses in porcine
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationWSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
More informationSupporting Information. In Situ Supramolecular Assembly and Modular Modification of Hyaluronic Acid Hydrogels for 3D Cellular Engineering
Supporting Informtion In Situ Suprmoleculr Assemly nd Modulr Modifiction of Hyluronic Acid Hydrogels for 3D Cellulr Engineering Kyeng Min Prk,, Jeong-A Yng,, Hyunte Jung, c Junseok Yeom, Ji Sun Prk, d
More informationInput from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationElectronic Supplementary Information for:
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 214 Electronic Supplementry Informtion for: Gold nnoprticles functionlized with cresyl violet nd porphyrin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationAgilent G6825AA MassHunter Pathways to PCDL Software Quick Start Guide
Agilent G6825AA MssHunter Pthwys to PCDL Softwre Quick Strt Guide Wht is Agilent Pthwys to PCDL? Fetures of Pthwys to PCDL Agilent MssHunter Pthwys to PCDL converter is stnd-lone softwre designed to fcilitte
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationInvasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationEffect of linear and random non-linear programming on environmental pollution caused by broiler production
Journl of Novel Applied Sciences Aville online t www.jnsci.org 24 JNAS Journl-24-3-/43-434 ISSN 2322-549 24 JNAS Effect of liner nd rndom non-liner progrmming on environmentl pollution cused y roiler production
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationSYNOPSIS Final Abbreviated Clinical Study Report for Study CA ABBREVIATED REPORT
Finl Arevited Clinicl Study Report Nme of Sponsor/Compny: Bristol-Myers Squi Ipilimum Individul Study Tle Referring to the Dossier (For Ntionl Authority Use Only) Nme of Finished Product: Yervoy Nme of
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationGene expression phenotypic models that predict the activity of oncogenic pathways
3 Nture Pulishing Group http://www.nture.com/nturegenetics Gene expression phenotypic models tht predict the ctivity of oncogenic pthwys Erich Hung,, Seiichi Ishid,7, Jennifer Pittmn,3, Holly Dressmn,,4,
More informationMecadox. Improves pig performance in a wide range of health and growing conditions. (Carbadox) Talk With a Phibro Expert:
SWINE (Crbdox) Improves pig performnce in wide rnge of helth nd growing conditions The Advntge Over the yers, medicted feed dditive hs proven to be cost-effective mngement tool for improving pig performnce
More informationUSE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS
Swine Dy 1996 USE OF SORGHUM-BASED DISTILLERS GRAINS IN DIETS FOR NURSERY AND FINISHING PIGS B. W. Senne, J. D. Hncock, I. Mvromichlis, S. L. Johnston, P. S. Sorrell, I. H. Kim, nd R. H. Hines Summry Two
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationDNA released from dying host cells mediates aluminum adjuvant activity
DNA relesed from dying host cells medites luminum djuvnt ctivity Thoms Mrichl 1, Keiichi Oht 2, Denis Bedoret 1, Clire Mesnil 1, Ctherine Stel 1, Kouji Koiym 2,3, Pierre Lekeux 1, Cevyir Con 2, Shizuo
More informationRSV-specific airway resident memory CD8 þ T cells and differential disease severity after experimental human infection
Received Oct 15 Accepted 1 Nov 15 Pulished 1 Dec 15 DOI: 1.138/ncomms1 OPEN RSV-specific irwy resident memory CD8 þ T cells nd differentil disese severity fter experimentl humn infection Agnieszk Jozwik
More informationENERGY CONTENT OF BARLEY
ENERGY CONTENT OF BARLEY VARIATION IN THE DIETARY ENERGY CONTENT OF BARLEY Shwn Firbirn, John Ptience, Hnk Clssen nd Ruurd Zijlstr SUMMARY Formultion of commercil pig diets requires n incresing degree
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationPolymer-Coated Metal-Oxide Nanoparticles Inhibit IgE Receptor Binding, Cellular Signaling, and Degranulation in a Mast Cell-like Cell Line
www.mterilsviews.com Polymer-Coted Metl-Oxide Nnoprticles Inhiit IgE Receptor inding, Cellulr Signling, nd Degrnultion in Mst Cell-like Cell Line Vn. Orteg, Jmes D. Ede, Dvid oyle, Jmes L. Stfford, nd
More informationBioactive milk components to secure growth and gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM
Bioctive milk components to secure growth nd gut development in preterm pigs ESTER ARÉVALO SUREDA PIGUTNET FA1401 STSM STSM Pigutnet FA1401 STSM 03/Septemer 30/Novemer/2017 (3 months) Host: Home: Thoms
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationIGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
More informationGoal: Evaluate plant health effects while suppressing dollar spot and brown patch
Newer Fungicide Products Alone nd In Rottion on Chicgo Golf Green Reserchers: Chicgo District Golf Assoc. Derek Settle, Tim Sibicky, nd Nick DeVries Gol: Evlute plnt helth effects while suppressing dollr
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationMERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
More informationIL-18 induction of IgE: dependence on CD4 + T cells, IL-4 and STAT6
ARTICLES IL-18 induction of IgE: dependence on CD4 + T cells, IL-4 nd STAT6 Tomohiro Yoshimoto 1,2,7, Hitoshi Mizutni 3, Hiroko Tsutsui 1, Nncy Noen-Truth 6, Kei-ichi Ymnk 3, Minoru Tnk 4, Shinzo Izumi
More informationEVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
More informationA FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND POLOXAMER 407 ON THE SOLUBILITY AND DISSOLUTION RATE OF PIROXICAM
IJRPC 20, (3) Chowdry et l. ISSN: 223 278 INTERNATIONAL JOURNAL OF RESEARCH IN PHARMACY AND CHEMISTRY Aville online t www.ijrpc.com Reserch Article A FACTORIAL STUDY ON THE EFFECTS OF β CYCLODEXTRIN AND
More informationExpression of functional NK 1 receptors in human alveolar macrophages: superoxide anion production, cytokine release and involvement of NF-jB pathway
British Journl of Phrmcology (25) 45, 385 396 & 25 Nture Pulishing Group All rights reserved 7 88/5 $3. www.nture.com/jp Expression of functionl NK receptors in humn lveolr mcrophges: superoxide nion production,
More informationComparative analysis of early immune responses induced by two strains of Newcastle disease virus in chickens
Received: 22 April 2018 Revised: 28 June 2018 Accepted: 3 July 2018 DOI: 10.1002/mo3.701 ORIGINAL ARTICLE Comprtive nlysis of erly immune responses induced y two strins of Newcstle disese virus in chickens
More informationConsumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationXII. HIV/AIDS. Knowledge about HIV Transmission and Misconceptions about HIV
XII. HIV/AIDS Knowledge bout HIV Trnsmission nd Misconceptions bout HIV One of the most importnt prerequisites for reducing the rte of HIV infection is ccurte knowledge of how HIV is trnsmitted nd strtegies
More informationA rt i c l e s. a Events (% of max)
Continuous requirement for the TCR in regultory T cell function Andrew G Levine 1,, Aron Arvey 1,,4, Wei Jin 1,,4 & Alexnder Y Rudensky 1 3 14 Nture Americ, Inc. All rights reserved. Foxp3 + regultory
More informationI n the immune response against viruses like influenza, NK cells play an important role1. NK cells express both
OPEN SUBJECT AREAS: INFECTION MUCOSAL IMMUNOLOGY NK CELLS INFLUENZA VIRUS Differentil lung NK cell responses in vin influenz virus infected chickens correlte with pthogenicity Christine A. Jnsen 1, Eveline
More information