Sestrin2-mediated signaling in autophagy induction and oxidative metabolism
|
|
- Cori Glenn
- 5 years ago
- Views:
Transcription
1 Sestrin2-mediated signaling in autophagy induction and oxidative metabolism May 16, 2017 Graduate Course 2214/BioC 998 SEUNG-HYUN RO Redox Biology Center University of Nebraska - Lincoln 1
2 Part I : ULK1-Sestrin2 signaling in autophagy induction Part II : Sestrin2 regulation of oxidative metabolism 2
3 Yoshinori Ohsumi Nobel Prize winner in Physiology or Medicine - Dr. Ohsumi's work provided the basis for understanding autophagy, or how cells degrade and recycle their molecular trash I don t feel comfortable competing with many people, and instead I find it more enjoyable doing something nobody else is doing. In a way, that s what science is all about, and the joy of finding something inspires me. Dr. Yoshinori Ohsumi from Tokyo Institute of Technology 3
4 Christian de Duve - Rockfeller University, Nobel Prize (1974) 1955 Discovery of Lysosome by EM analysis 1962 Invented scientific name, Autophagy Auto (Self) Phagy (Eating) Lysosome vacuole in yeast 4
5 Autophagy Catabolic process induced by starvation, whereby cells digest their own constituents as a mechanism of cell survival or cell death 5
6 Physiological functions of Autophagy Defense mechanism for starvation and metabolic stress Cellular energy homeostasis control Cell survival, growth and differentiation Defense mechanism for diseases and aging Levine et al, Cell, 2008 Nobelförsamlingen at Karoliska,
7 7
8 Mitophagy 1. LC3 associated (Ubiquitinindependent) mitochondrial autophagy 2. Pink1/Parkin associated mitophagy Nix (Bnip3 like protein) Bnip3 (BCL2 interacting protein 3) FUNDC1 (Fun14 domain containing protein1) Pink1 (PTEN induced putative kinase 1) Parkin (E3 ubiquitin protein ligase) Saito et al, Cir Res,
9 Lipophagy occurs in 3T3-L1 adipocyte in response to starvation +Serum -Serum (2h) - lysotracker + lysotracker Green-Lipid Blue-DAPI 9
10 Autophagic vacuoles - Electron microscopy in HeLa cancer cells 10 mm Dr. Richard Kessin lab at Columbia U. Hosokawa et al. (2009) MBC, from Noboru Mizushima lab 10
11 Human diseases associated with defective autophagy Morel et al, Annu Rev Pharmacol Toxicol,
12 Autophagy and mitophagy signaling www. cellsignal.com 12
13 Autophagy signaling Beth Levine, UT Southwestern 13
14 Autophagy proteins required for autophagosome formation Choi et al, N Engl J Med,
15 Autophagy has conserved pathways among eukaryotes (yeast to animal to plant) (Arabidopsis Thaliana) Yoshinori Ohsumi 15
16 mtor suppresses autophagy under nutrient rich conditions 16
17 Autophagy induction by rapamycin in cancer cells -rapamycin +rapamycin Immunostaining of endogenous LC3 in autophagosomes (HeLa cells) 17
18 The ULK-Atg13 complexes mediate mtor signaling to the autophagy machinery S757 Jung et. al. MBC,
19 The ULK is an autophagy initiation kinase that is conserved in metazoan (Positive regulator of Hedgehog pathway) (Neural stem cell regulation) Jung et. al. FEBS letter,
20 ULK kinase is a molecular sensor in autophagy/mitophagy induction by integrating AMPK and mtor pathway - ULK1 plays critical role in autophagic clearance of mitochondria in reticulocytes (Kundu et al, Blood, 2008) - AMPK phosphorylates Ser317 and Ser 777 of ULK1 to activate autophagy in glucose starvation (Kim et al, Nature Cell Biol, 2011) - AMPK phosphorylate Ser555 of ULK1 to induce mitophagy (Egan et al, Science, 2011) S317, S777 S555 S757 Egan et al, Science,
21 ULK kinase translocate into mitochondria to induce mitophagy upon stress - S555 phosphorylation of ULK1 by AMPK kinase is critical for translocation of ULK1 into mitochondria and mitophagy induction upon hypoxia (Tian et al, FEBS Letters, 2015) - ULK1 translocate into mitochondria upon hypoxia or FCCP mito stress and phosphorylate mitophagy receptor Fundc1 at S17 to induce mitophagy process (Wu et al, EMBO Rep, 2014) 21
22 Sestrin : Stress-inducible protein family A hsesn1 hsesn2 hsesn3 msesn1 msesn2 msesn3 dsesn csesn B h/msesn2 C h/msesn1 h/msesn3 dsesn csesn e.g. Cumene Hydroperoxide Kim, An and Ro et al, Nature Commun,
23 Sestrins : Stress-inducible proteins Transcriptionally induced by hypoxia, genotoxic stress or oxidative stress (Budanov et al, Oncogene 2002) Sestrin1/2 prevent oxidative damage by activating Nrf2/Keap1 pathway (Bae et al, Cell Metab. 2013) Sesn3 can activate Akt via mtorc2 to regulate hepatic insulin sensitivity and glucose metabolism (Tao et al, Diabetes 2015) Sestrins interact with GATOR2 and negatively regulate mtorc1 in amino acid sensing pathway (Chantranupong et al, Cell Rep. 2015) - GATOR2 complex (WDR24, WDR59, Mios, Sec13 and Seh1L) - GATOR1 complex (DEPDC5, Nprl2 and Nprl3) Parmigiani et al, Int Rev Cell Mol Biol,
24 Sestrins : Stress-inducible proteins Sestrin induces autophagy by activating AMPK and inhibiting mtorc1 in Drosophila and mammals (Lee et al, Science, 2010, Lee et al, Cell Metabolism, 2012) Ho et al, Trends Biochem Sci,
25 ULK1 phosphorylates p62 at S403 and Sestrin2 promotes ULK1 mediated p62 phosphorylation Ro et al, FEBS J,
26 ULK1 phosphorylates Sestrin2 and inhibit mtorc1 through enhancing Sestrin2-GATOR2 binding Kimball et al, Cell Signal,
27 GFP-LC3 transgenic mouse [B6, D2-Tg(CAG-GFP/LC3)53Nmi] Is a useful tool for autophagy research Tg: GFP-LC3 mouse Live imaging of autophagosome in pancreatic tissues of GFP-LC3 mouse RIKEN BRC Experimental Animal Division Kuma et al, Nature 2004 Cao et al, PLoS ONE
28 Sesn2 induces autophagosome formation and increases mitophagy activity Sesn2 +/+ GFP-LC3 mice Sesn2 -/- GFP-LC3 mice Kim et al, Autophagy,
29 Adipose tissue - energy reservoir & metabolic homeostasis control (Stopping of blood flow) Modified from Trayhurn, Acta Physiol Scand.,
30 Inhibition of mammalian target of rapamycin (mtor) Induces autophagy in differentiated adipocytes -rapamycin +rapamycin Immunostaining of LC3, an autophagosomal marker 30
31 ULK1/2 are important for basal and rapamycininduced autophagy in 3T3-L1 adipocytes Ro et al, Autophagy,
32 ULK1/2 are important for basal and rapamycininduced autophagy in 3T3-L1 adipocytes Ro et al, Autophagy,
33 ULK1-Sestrin2 signaling in adipose autophagy and metabolism 33
34 - Autophagy signaling Summary : Part I 1. Autophagy (Self-eating) is induced by stress and requires 18 Atg proteins for autophagosome formation 2. mtorc1 suppresses autophagy by phosphorylating ULK1- Atg13-Fip200 complex under nutrient rich conditions 3. AMPK induce autophagy/mitophagy by inhibiting mtorc1 and activating ULK1 autophagy kinase 4. Sestrins can directly activate AMPK and suppress mtor through GATOR complexes 5. Sestrin2 promotes ULK1 mediated p62 phosphorylation at Ser ULK1-Sestrin2 induce autophagy in adipose tissue and consequently contribute on insulin/glucose and fat metabolism 34
35 Part I : ULK1-Sestrin2 signaling in autophagy induction Part II : Sestrin2 regulation of oxidative metabolism 35
36 Sestrins regulate Oxidative Metabolism Sestrins mtorc1 ULK1/2 Atg13 AMPK PGC1 Keap1 Nrf2 Prx Autophagy Mitochondria Contents ROS Balance of Oxidative Metabolism 36
37 Sestrins may play a role in the regeneration of overoxidized forms of Prxs Obesity Inflammation UV Radiation Chemicals O 2 SOD O 2 H 2 O 2 Fenton react. (Fe, Cu) Haber-Weiss react. Mitochondria OH ROS Scavengers Glutathione Lipoic acid Tocopherols Ascorbic acid GPx Prx H 2 O Prx-SH Prx S S Prx I regeneration ROS Prx-SOH excess H 2 O 2 Srx Sestrins Sestrins: ATP- dependent cysteine sulfinyl reductase Prx-SO 2 H Cell injury (Lipids, DNA, Proteins) Still controversial Woo et al, Antioxid Redox Signal 2009 (Sue Goo Rhee group) Sestrins are involved in the regulation of redox balance in breast and colon cancer cells, fibroblasts and macrophages Budanov et al, Science,
38 Sestrin2 has an alkylhydroperoxide reductase activity through cysteine No alkylhydroperoxidase activity despite structure similarity A B (alkylhydroperoxidase) Ferrous oxidation xylenol orange (FOX) assay (AhpD: M. tuberculosis alkylhydroperoxidase) C Cumene hydroperoxide hsesn2-c125 Kim, An and Ro et al, Nature Commun,
39 LD size (mm) LD size (mm) PG PG-Sn2 PG PG-Sn2 PG PG-Sn2 PG PG-Sn2 PG PG-Sn2 Transgenic Sestrin2 expression increases fat accumulation in BAT A C57BL/6 B Liver Muscle BAT ewat swat tet-sesn2 Pparg-tTA (PG) Pparg-tTA/ tet-sesn2 (PG-Sn2) hsesn2 Actin Adipose Tissue (AT) Non-AT Pparg (active) tta tta Sesn2 tet (active) Sesn2 tta Pparg (inactive) Sesn2 tet (inactive) No significant change in GTT or ITT under HFD Slight improvement in GTT under LFD C PG PG-Sn BAT *** *** ewat LFD Sestrin2 reduces lipogenic gene expression and increases mitochondrial contents in BAT HFD Ro et al, PNAS,
40 1 o -ISA: CM-H 2 DCFDA CM-DCF intensity GFP Ucp1 mrna expression Sestrin2 inhibits Ucp1 expression by suppressing ROS in primary brown adipocytes A 1 o -ISA: Protein Sn2 WT Sn2 CS B Sesn2 Pparg Ucp1 Actin - Sn2 CS : Redox- deficient C125S mutant C Con Sesn2 WT D *** 1 o -ISA ns GFP Sn2 WT Sn2 CS 1 o -ISA *** *** *** Sesn2 CS NAC Con Sn2 WT Sn2 CS NAC Ro et al, PNAS,
41 UCP1 induced by cold and adrenergic receptor activation triggers heat generation in mitochondria Forskolin (FSK) Isoproterenol (ISO) 41
42 Ucp2 mrna p-p38/p38 Ucp1 mrna PG PG-Sn2 PG Ucp1/Actin PG-Sn2 Sestrin2 inhibits Ucp1 expression by suppressing ROS and p38 Sestrin2 E LFD-BAT: mrna PG PG-Sn2 ** * RT Cold F Ucp1 Actin Sesn2 p-p38 p38 LFD-BAT: Protein RT Cold G LFD-BAT: Protein PG RT * * PG-Sn2 ns ns Cold ROS p38 UCP1 Ro et al, PNAS,
43 Antioxidants suppress Ucp1 expression - BHA : butylated hydroxyanisole - NAC : N-acetylcysteine - SB : p38 MAPK inhibitor Antioxidants ROS p38 UCP1 Ro et al, PNAS,
44 Sestrin2 inhibits Ucp1 expression through suppressing ROS in BAT thermogenesis 44
45 Summary : Part II -Oxidative metabolism 1. Sestrins are involved in the regeneration of Prxs 2. Sestrin2 is an alkylhydroperoxidase forming sulfenylation intermediate of Cys125 when induced by cumene hydroperoxides 3. Sestrin2 Tg mice developed the whitening of BAT due to decreased UCP1 although with increased mitochondria contents 4. Sestrin2 as well as antioxidants inhibits UCP1 expression through suppressing ROS in BAT 5. ROS plays critical role in UCP1 expression and thermogenesis 6. Maintaining physiological level of Sestrin2 and ROS is important for adipocyte metabolism 45
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationHypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
More informationThe Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
More information6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
More informationCell Death & Renewal (part 2)
17 Cell Death & Renewal (part 2) Programmed Cell Death A major signaling pathway that promotes cell survival is initiated by the enzyme PI 3-kinase, which phosphorylates PIP2 to form PIP3, which activates
More informationA particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
More informationConvergent and Divergent Mechanisms in Aging and Cancer
Convergent and Divergent Mechanisms in Aging and Cancer Mariana S. De Lorenzo, PhD Department of Cell Biology & Molecular Medicine delorems@umdnj.edu LEARNING OBJECTIVES 1. To identify convergent and divergent
More informationAutophagy in Insulin Resistance. Abstract. Introduction. Takeshi Yoshizaki. KEY WORDS: Autophagy, insulin resistance, aging, inflammation
Received: Oct. 10, 2012 Accepted: Oct. 17, 2012 Published online: Oct. 31, 2012 Review Article Autophagy in Insulin Resistance Takeshi Yoshizaki Department of Medicine, Shiga University of Medical Science
More informationNiemann-Pick type C2 deficiency impairs autophagylysosomal activity, mitochondrial function, and TLR signaling in adipocytes
Niemann-Pick type C2 deficiency impairs autophagylysosomal activity, mitochondrial function, and TLR signaling in adipocytes Hong Guo,* Ming Zhao,* Xiaoxue Qiu,* Jessica A. Deis,* Haiyan Huang, Qi-Qun
More informationRedox regulated transcription factors
Redox regulated transcription factors, MD PhD Division of Biochemistry Medical Biochemistry and Biophysics Karolinska Institutet Stockholm, Sweden Elias.Arner@ki.se Redox regulation A process of regulated
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationRapid parallel measurements of macroautophagy and mitophagy in
Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationSUPPLEMENTARY INFORMATION In format provided by JAATTELA (NOVEMBER 2005)
Box S1: Methods for studying lysosomal function and integrity Volume and distribution of the acidic compartment. Acridine orange is a metachromatic fluorochrome and a weak base that accumulates in the
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationGlutathione / Thioredoxin Nrf2 & Hyperoxia
Glutathione / Thioredoxin Nrf2 & Hyperoxia Trent E. Tipple, MD Principal Investigator, Center for Perinatal Research The Research Institute at Nationwide Children s Hospital Assistant Professor of Pediatrics,
More informationDISTINCT FUNCTIONS OF AUTOPHAGY KINASES ULK1 AND ULK2 IN ADIPOGENESIS AND ADIPOCYTE METABOLISM A DISSERTATION
DISTINCT FUNCTIONS OF AUTOPHAGY KINASES ULK1 AND ULK2 IN ADIPOGENESIS AND ADIPOCYTE METABOLISM A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY SEUNG-HYUN
More informationPrediction of invasiveness of hepatic tumor cells
Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationDefects in mitophagy promote redox-driven metabolic syndrome in the absence of TP53INP1
Defects in mitophagy promote redox-driven metabolic syndrome in the absence of TP53INP1 Marion Seillier, Laurent Pouyet, Prudence N'Guessan, Marie Nollet, Florence Capo, Fabienne Guillaumond, Laure Peyta,
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationSelective Mitophagy in budding yeast, a mitochondrial self-eating quality control
European Journal of Biophysics 2014; 2(5): 49-60 Published online November 10, 2014 (http://www.sciencepublishinggroup.com/j/ejb) doi: 10.11648/j.ejb.20140205.11 ISSN: 2329-1745 (Print); ISSN: 2329-1737
More informationMacroautophagy and Cell Responses Related to Mitochondrial Dysfunction, Lipid Metabolism and Unconventional Secretion of Proteins
Cells 2012, 1, 168-203; doi:10.3390/cells1020168 Review OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Macroautophagy and Cell Responses Related to Mitochondrial Dysfunction, Lipid Metabolism
More informationREVIEWS. Targeting autophagy in obesity: from pathophysiology to management
REVIEWS Targeting autophagy in obesity: from pathophysiology to management Yingmei Zhang 1,2 *, James R. Sowers 3 and Jun Ren 1,2 * Abstract Obesity poses a severe threat to human health, including the
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationDefects in GABA metabolism affect selective autophagy pathways and are alleviated by mtor inhibition
Research Article Defects in GABA metabolism affect selective autophagy pathways and are alleviated by mtor inhibition Ronak Lakhani 1, Kara R Vogel 2, Andreas Till 1,3, Jingjing Liu 1,3, Sarah F Burnett
More informationBEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
More informationLack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
More informationROS as targets for therapeutic intervention of diabetic nephropathy
36 th Autumn Congress of Korean Diabetes Association September 16-17, 2010, BEXCO, Busan, Korea ROS as targets for therapeutic intervention of diabetic nephropathy Hunjoo Ha Department of Bioinspired Science
More informationReactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh
Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationSupplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.
Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. a. Schematic of the V-ATPase proton pump macro-complex structure. The V1 complex is composed of
More informationMangifera indica activates key metabolic master switch enzymes The innovation for well-aging
Mangifera indica activates key metabolic master switch enzymes The innovation for well-aging Dr. S. Buchwald-Werner 6. May 2015 Vitafoods Europe Conference Healthy Aging Session Consumer demand for healthy-aging
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationExpanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
More informationIntolerance in Heart Failure
Novel Targets to Attack Exercise Intolerance in Heart Failure - Skeletal Muscle - Volker Adams, PhD ESC, Paris 3. Aug. 211 UNIVERSITÄT LEIPZIG H E R Z Z E N T R U M Nothing to disclose Myers et al. NEJM
More informationNew Drug Development for Hepatic Insulin Resistance
New Drug Development for Hepatic Insulin Resistance Innovative Drug Research Center for Metabolic and Inflammatory Disease College of Pharmacy Sang Geon Kim AMPK as an energy sensor, (A novel drug target
More informationAssessing Autophagy with the guava easycyte Benchtop Flow Cytometer
Application Note Assessing Autophagy with the guava easycyte Benchtop Flow Cytometer Mark Santos, Kevin Su, Luke Armstrong, Angelica Olcott, Jason Whalley, and Matthew Hsu EMD Millipore Introduction Autophagy
More informationNonapoptotic Cell Death Pathways
C H A P T E R 8 Nonapoptotic Cell Death Pathways DIFFERENT WAYS TO DIE So far, we have mostly focused on apoptosis, also known as type I cell death. 1 Along the way, we touched on other forms of cell death,
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationH 2 S: Synthesis and functions
H 2 S: Synthesis and functions 1 Signaling gas molecules: O 2, NO and CO Then, H 2 S - Fourth singling gas molecule after O 2, NO and CO 2 Nothing Rotten About Hydrogen Sulfide s Medical Promise Science
More informationHigh Content Imaging : Meaningful pictures for relevant results in dermocosmetology
High Content Imaging : Meaningful pictures for relevant results in dermocosmetology We deliver High Content screening services with exhaustive, high quality and robust phenotypic data. Nathalie MAUBON,
More informationthematic review series
thematic review series Thematic Review Series: Lipotoxicity: Many Roads to Cell Dysfunction and Cell Death Lipids, lysosomes, and autophagy Bharat Jaishy 1 and E. Dale Abel 2 Fraternal Order of Eagles
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationCell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
More informationDETOSKIN TM. Your ultimate ally to reach skin s excellence ANTI-AGING
Your ultimate ally to reach skin s excellence ANTI-AGING Your ultimate ally to reach skin s excellence This is a story about the Peony, the queen of flowers, so beautiful with its bright colours and delightful
More informationNFκB What is it and What s the deal with radicals?
The Virtual Free Radical School NFκB What is it and What s the deal with radicals? Emily Ho, Ph.D Linus Pauling Institute Scientist Department of Nutrition and Food Management Oregon State University 117
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2001 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2001) offered
More informationBiological Chemistry of Hydrogen Peroxide
Biological Chemistry of Hydrogen Peroxide Christine Winterbourn Department of Pathology University of Otago, Christchurch New Zealand Hydrogen Peroxide Intermediate in reduction of oxygen to water A major
More informationMammalian mitophagy from in vitro molecules to in vivo models
STATE-OF-THE-ART REVIEW Mammalian mitophagy from in vitro molecules to in vivo models Catherine E. Rodger, Thomas G. McWilliams and Ian G. Ganley MRC Protein Phosphorylation and Ubiquitylation Unit, School
More informationINFLUENCE OF MELATONIN ON ARSENIC MEDIATED PANCREATIC DAMAGE IN SWISS ALBINO MICE
INFLUENCE OF MELATONIN ON ARSENIC MEDIATED PANCREATIC DAMAGE IN SWISS ALBINO MICE DIMPLE DAMORE Bhavan s Sheth R.A.College of Science, Gujarat University, Ahmedabad, Gujarat, India INTRODUCTION Arsenic
More informationp62/sqstm1: The molecule that links autophagy to the Keap1-Nrf2 system
p62/sqstm1: The molecule that links autophagy to the Keap1-Nrf2 system Dr. Masaaki Komatsu Dr. Yoshinobu Ichimura Department of Biochemistry, Niigata University Graduate School of Medical and Dental Sciences
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2005 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2005) offered
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature22314 Supplementary Discussion In mammals, BCAAs are essential amino acids that must be supplied from food. These dietary BCAAs are subsequently used for protein synthesis or are catabolized
More informationCellular functions of protein degradation
Protein Degradation Cellular functions of protein degradation 1. Elimination of misfolded and damaged proteins: Environmental toxins, translation errors and genetic mutations can damage proteins. Misfolded
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationEnergy Sensing and Metabolism in Cancer
Energy Sensing and Metabolism in Cancer Boyi Gan MD Anderson Cancer Center The distinguishing features of living organisms 1. A high degree of chemical complexity and microscopic organization. 2. Systems
More informationProfessor Christopher Proud
South Australian Health and Medical Research Institute Professor Christopher Proud Cell Signalling & Gene Regulation Professor Christopher G. Proud Nutrition and Metabolism Theme Leader South Australian
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationMitochondria are essential to cellular metabolism and physiology,
SERIES Review Article https://doi.org/10.1038/s41556-018-0176-2 SERIES Review Article https://doi.org/10.1038/s41556-018-0176-2 Mechanisms of mitophagy in cellular homeostasis, physiology and pathology
More informationStressin Sestrins take an aging fight
Stressin Sestrins take an aging fight Andrei V. Budanov 1, Jun Hee Lee 1, Michael Karin 1 * Keywords: aging; p53; redox; Sestrin; target of rapamycin DOI 10.1002/emmm.201000097 Received June 24, 2010 /
More informationSupporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
More informationTITLE: The Importance of Autophagy in Breast Cancer Development and Treatment
AD Award Number: W81XWH-06-1-0557 TITLE: The Importance of Autophagy in Breast Cancer Development and Treatment PRINCIPAL INVESTIGATOR: Jin-Ming Yang, Ph.D. CONTRACTING ORGANIZATION: University of Medicine
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationE3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationChapter 2 History of Autophagy After 1963
Chapter 2 History of Autophagy After 1963 Abstract This chapter gives a historical perspective of the landmark studies that have allowed the autophagy field to progress to its current status. It begins
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationAbstracts and affiliations
Dopamine Discovery Day August 30, 2012 Rikshospitalet Store auditorium, Oslo, Norway Organized by Linda H. Bergersen & Vidar Gundersen Institute of Basic Medical Sciences & Centre for Molecular Biology
More informationChapter 14. Energy conversion: Energy & Behavior
Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making
More informationRegulation of Metabolism
Regulation of Metabolism Pratt and Cornely Chapter 19 Regulation by Compartmentalization Form of reciprocal regulation Degradation vs biosynthesis Requires transporters 1 Specialization of organs Fuel
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationAlpha Lipoic Acid Snapshot Monograph
vitamins minerals nutrients Alpha Lipoic Acid Snapshot Monograph Alpha lipoic Acid Most Frequent Reported Uses: - Antioxidant - Peripheral neuropathy - Improves insulin signaling and regulation of appetite
More informationLife Sciences METABOLISM. Transform Your Metabolic Research
METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,
More informationSupplementary Material. Contents include:
Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1
More informationInducing mitophagy in diabetic platelets protects against severe oxidative stress
Research Article Inducing mitophagy in diabetic platelets protects against severe oxidative stress Seung Hee Lee 1, Jing Du 1, Jeremiah Stitham 1, Gourg Atteya 1, Suho Lee 2, Yaozu Xiang 1, Dandan Wang
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationAutophagy-related Products Catalogue
Research Use Only Autophagy-related Products Catalogue Antigen presentation Virus infection Cancer Bacterial infection Cell death Starvation-adaptation Neurodegenerative disease Autophagy was first discovered
More informationPETER L. LUTZ. Red-eared slider Trachemys scripta elegans
www.carleton.ca/~kbstorey PETER L. LUTZ Red-eared slider Trachemys scripta elegans Lutz PL, Storey KB. 1997. Handbook of Physiology (Dantzler WH, ed) Oxford Univ. Press, Vol. 2, pp. 1479-1522. 1 Relative
More informationProtection from osteoarthritis: targeting mtor and autophagy
Dr. Yue Zhang Protection from osteoarthritis: targeting mtor and autophagy Cartilage scientist, Division of Genetics and Development, The Toronto Western Research Institute, Toronto Western Hospital, University
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationAUTOPHAGY AND MITOPHAGY INTERPLAY IN MELANOMA PROGRESSION
AUTOPHAGY AND MITOPHAGY INTERPLAY IN MELANOMA PROGRESSION Hannelore Maes and Patrizia Agostinis Laboratory of Cell Death and Therapy, Department Cellular and Molecular Medicine, KU Leuven, Leuven, B-3000,
More informationThe Role of Parkin and Mitophagy in Acetaminophen and Alcohol-induced Liver Injuries. Jessica A. Williams
The Role of Parkin and Mitophagy in Acetaminophen and Alcohol-induced Liver Injuries By Jessica A. Williams Submitted to the graduate degree program in Pharmacology, Toxicology, and Therapeutics and the
More informationState of the art ingredients fast friendly service
ALPHA-LIPOIC ACID An Efficient Antioxidant α-lipoic acid also known as thioctic acid, plays an important role in metabolic processes. It functions as a co-factor for a number of key enzymes that help in
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationnumber Done by Corrected by Doctor
number 19 Done by حسام ابو عوض Corrected by وسيم ابو عبيدة Doctor د.نايف 1 P a g e GAGs and Glycoproteins: GAGs: long, unbranched heteropolysaccharides, made from زunits repeating disaccharide [Acidic
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More information2/14/2013. The Pathogenesis of Parkinson s Disease. February, inherited forms of PD. Autosomal Recessive Parkinson s Disease
inherited forms of PD The Pathogenesis of Parkinson s Disease February, 2013 PARK1 dominant α-synuclein presynaptic protein PARK2 recessive parkin E3 ubiquitin ligase PARK3 dominant 2p13? PARK4 dominant
More information