a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *
|
|
- Hugo Burns
- 5 years ago
- Views:
Transcription
1 Supplemental Figure 1 Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes a b c d e [ C 3 ]Pyruvate [ C 3 ]Malate [ C 3 ]Aspartate [ C 3 ]Citrate [ C 2 ] -Ketoglutarate f g h [ C 2 ]Glutamate [ C 2 ]Glycerol-P [ C 3 ]Hexose-P Supplemental figure 1. Metabolic flux with [U- C]Lactate - [ 12 C]Glutamine in primary hepatocytes (a-h) Primary isolated hepatocytes were treated with with [U- C]Lactate - [ 12 C]Glutamine and either PBS (NT) or glucagon and (a) [ C 3 ]Pyruvate, (b) [ C 3 ]malate, (c) [ C 3 ]aspartate, (d) [ C3]citrate, (e) [ C2 3 ] ketoglutarate, (f) [ C 2 ]glutamate, (g) [ C 2 ]glycerol-phosphate, and (h) [ C 3 ]hexose-phosphate. Top plots are kinetic timecourses following addition of glucagon. Bottom plots show the isotopomer distribution at the 20 minute time point.
2 Supplemental Figure 2 Metabolic flux with [ 12 C]Lactate - [U- C]Glutamine in primary hepatocytes a b c d e [ C ]Pyruvate 3 [ C ]Malate 4 [ C ]Aspartate 4 [ C ]Citrate 4 [ C ] -Ketoglutarate 5 f g h [ C ]Glutamate 5 [ C ]Glycerol-P 3 [ C ]Hexose-P 3 Supplemental figure 2. Metabolic flux with [ 12 C]Lactate - [U- C]Glutamine in primary hepatocytes (a-h) Primary isolated hepatocytes were treated with with [U- C]Lactate - [ 12 C]Glutamine and either PBS (NT) or glucagon and (a) [ C 3 ]Pyruvate, (b) [ C 4 ]malate, (c) [ C 4 ]aspartate, (d) [ C 4 ]citrate, (e) [ C 5 ] ketoglutarate, (f) [ C 5 ]glutamate, (g) [ C 3 ]glycerol-phosphate, and (h) [ C 3 ]hexose-phosphate. Top plots are kinetic timecourses following addition of glucagon. Bottom plots show the isotopomer distribution at the 20 minute time point.
3 Supplemental Figure 3 Supplemental figure 3. Modeling results from metabolic flux studies based on experiments presented in figure 1 and supplemental figures 1-2. Flux map with best fit flux values for untreated and glucagon stimulated fluxes.
4 Supplemental Figure 4 Intracellular glutamine in primary hepatocytes treated with glucagon a Glutamine b Glutamine Supplemental figure 4. Intracellular glutamine in primary hepatocytes treated with glucagon or PBS vehicle. Primary hepatocytes were incubated with (a) lactate or (b) lactate and [ C 6 ]glutamine and the intracellular glutamine was measured by mass spectrometry.
5 Supplemental Figure 5 Mechanistic and signaling studies in primary mouse hepatocytes a b c d e f g h i Glucose Glucose j k l C 5 -Ketoglutarate C 5 Glutamate C 4 Malate Supplemental figure 5. Mechanistic and signaling studies in primary mouse hepatocytes. (a) a-ketoglutarate levels following treatment of primary hepatocytes with PBS (vehicle), glucagon, or db-camp and measured enzymatically. (b) Liver a-ketoglutarate levels following treatment with a bolus injection of glucagon or PBS and and measured by mass spectrometry. (c) Measurement of a-kgdh enzymatic activity in primary hepatocytes treated with PBS or glucagon. (d) Primary hepatocytes isolated from mice infected with AAV-TBG-GFP or AAV-TBG-PKA-DN were isolated and treated with PBS, glucagon, or phenylephrine for 10 minutes and the resulting protein lysates were probed by western blot for phosphorylated or total Phosphofructokinase/FBPase1(PFKFB1), phosphorylated or total Inositol 3-Phosphate Receptor (IP3R), phosphorylated or total CREB, and the PKA regulatory subunit used to inhibit PKA activity (PKA-R1a). (e-f) Primary hepatocytes were treated with PBS (NT) or glucagon in the presence or absence of the PKA inhibitor H89 and (e) glucose output or (f) a-ketoglutarate levels were measured. (g) Primary hepatocytes were isolated and the levels of intracellular calcium were measured using calcium sensitive dyes in distinct hepatocytes. (h-l) Kinetic metabolic flux studies using [ 12 C]Lactate - [U- C]Glutamine in hepatocytes treated with PBS vehicle, glucagon, or phenylephrine were performed. The isotopomer pattern in extracellular glucose was measured and represented as a (h) total amount or (l) the fraction of the total glucose pool. Intracellular metabolite labeling patterns are shown for (j) [ C 5 ]a-ketoglutarate, (k) [ C 5 ]glutamate, and (j) [ C 4 ]malate.
6 Supplemental Figure 6 Mechanistic and signaling studies in mouse liver a C 5 -Glutamate b C 4 -Malate c Supplemental figure 6. Mechanistic and signaling studies in mouse liver. (a-b) Animals infected with AAV-GFP or AAV-GLS2-sh were infused with [U- C]Glutamine and PBS vehicle or glucagon. Hepatic enrichment of (a) [ C 5 ]glutamate and (b) [ C 4 ]malate. Values are corrected for plasma enrichment of glutamine. (c) Western blot evaluation of GLS2 protein levels in livers from GLS2-KO and litter mate control animals.
7 a Supplemental Figure 7 Original Scan of Western Blots b GLS2 GLS2 100 pirβ 37 β-actin 100 IRβ pakt takt 37 GAPDH phospho-pka substrate Supplemental Figure 7. Original Scan of Western Blots A. Original Scan for figure 3a and supplemental figure 6a. B. Original Scan for supplemental figure 6d
8 Supplemental Table 1 Best fit fluxes and lower and upper bounds of modeling 95% confidence interval Basal Glucagon nmol/mg protein/min LB BEST UB LB BEST Net Glc secretion Net Pyr secretion Net FA degradation Net Glycogenolysis Net Lactate uptake Net Gln uptake Net akg Succ-CoA+CO Reverse akg Succ-CoA+CO Net Ac-CoA+OA Cit Net PEP+H2O 2PG Reverse PEP+H2O 2PG Net GAP+DHAP FBP Net 2 Fum + 2 H2O 2 Mal Net Lac Pyr Net Mal OA Net OA Mal (mitochondria) Reverse OA Mal (mitochondria) Net Mal Pyr+CO Net Pyr+CO2 OA Net Pyr Ac-CoA+CO Net PEP Pyr UB Supplemental table 1. Best fit and upper/lower bounds from modeling results from metabolic flux studies based on experiments presented in figure 1 and supplemental figures 1-2.
Supplementary Material. Contents include:
Supplementary Material Contents include: 1. Supplementary Figures (p. 2-7) 2. Supplementary Figure Legends (p. 8-9) 3. Supplementary Tables (p. 10-12) 4. Supplementary Table Legends (p. 13) 1 Wellen_FigS1
More informationdoi: /nature10642
doi:10.1038/nature10642 Supplementary Fig. 1. Citric acid cycle (CAC) metabolism in WT 143B and CYTB 143B cells. a, Proliferation of WT 143B and CYTB 143B cells. Doubling times were 28±1 and 33±2 hrs for
More informationControl vs. HFD-lipid
Animals Control vs. T1D vs. T1D-leptin and Hyperinsulinemic-diabetic vs. hyperinsulinemic-diabetic-leptin STZ ± nicotinamide injection Leptin or saline 6 8 1 12 2 4 6 8 1 12 2 4 6 8 1 12 Control vs. HFD-lipid
More informationPyruvate Alanine 0.15 *** ** ***
SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure
More informationIntegration of Metabolism
Integration of Metabolism Metabolism is a continuous process. Thousands of reactions occur simultaneously in order to maintain homeostasis. It ensures a supply of fuel, to tissues at all times, in fed
More informationHow do we retain emphasis on function?
Systems Biology Systems biology studies biological systems by systematically perturbing them (biologically, genetically, or chemically); monitoring the gene, protein, and informational pathway responses;
More informationLast updated Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes
Last updated 2011-03-02 Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes Media Formulations A. Media for glycogen synthesis: Culture medium base: DMEM-Low (Mediatech/Cellgro
More informationPrinciples and Practice of Mass Isotopomeric MultiOrdinate Spectral Analysis (MIMOSA) to Assess Metabolic Flux"
Principles and Practice of Mass Isotopomeric MultiOrdinate Spectral Analysis (MIMOSA) to Assess Metabolic Flux" Richard G. Kibbey M.D., Ph.D. Associate Professor Departments of Internal Medicine and Cellular
More informationRevision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
More informationGlycolysis Part 2. BCH 340 lecture 4
Glycolysis Part 2 BCH 340 lecture 4 Regulation of Glycolysis There are three steps in glycolysis that have enzymes which regulate the flux of glycolysis These enzymes catalyzes irreversible reactions of
More informationRegulation of Glucose Metabolism by Intracellular Compounds
Regulation of Metabolism by Intracellular ompounds Hexokinase ( ) -6- H ribose-5- or fructose-6- -6-phosphate () ( ) H -6-phosphate GI GM UD-glucose pyrophosphorylase 1-phosphate UD- hosphorylase synthase
More information(de novo synthesis of glucose)
Gluconeogenesis (de novo synthesis of glucose) Gluconeogenesis Gluconeogenesis is the biosynthesis of new glucose. The main purpose of gluconeogenesis is to maintain the constant blood Glc concentration.
More information5.0 HORMONAL CONTROL OF CARBOHYDRATE METABOLISM
5.0 HORMONAL CONTROL OF CARBOHYDRATE METABOLISM Introduction: Variety of hormones and other molecules regulate the carbohydrates metabolism. Some of these have already been cited in previous sections.
More informationNovel stable isotope methods to assess metabolic fluxes using microscale samples
Novel stable isotope methods to assess metabolic fluxes using microscale samples Jamey D. Young Associate Professor and Chancellor s Faculty Fellow Chemical and Biomolecular Engineering Molecular Physiology
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationInformation transmission
1-3-3 Case studies in Systems Biology Goutham Vemuri goutham@chalmers.se Information transmission Fluxome Metabolome flux 1 flux flux 3 Proteome metabolite1 metabolite metabolite3 protein 1 protein protein
More informationSascha Bulik, Hermann-Georg Holzhütter * and Nikolaus Berndt
Bulik et al. BMC Biology (21) 14:15 DOI 1.118/s12915-1-237- RESEARCH ARTICLE Open Access The relative importance of kinetic mechanisms and variable enzyme abundances for the regulation of hepatic glucose
More informationGlycolysis. Intracellular location Rate limiting steps
Glycolysis Definition Fx Fate Site Intracellular location Rate limiting steps Regulation Consume ATP Subs level phosphoryla tion Key reactions control points Nb Oxidation of glucose to give pyruvate (
More informationCitric acid cycle and respiratory chain. Pavla Balínová
Citric acid cycle and respiratory chain Pavla Balínová Mitochondria Structure of mitochondria: Outer membrane Inner membrane (folded) Matrix space (mtdna, ribosomes, enzymes of CAC, β-oxidation of FA,
More information0.40. Biochemistry of Carbohydrates
0.40 Biochemistry of Carbohydrates Biochemistry of Carbohydrates ATP ADP Glycolysis The Breakdown of Glucose Primary Energy Source of Cells Central Metabolic Pathway All Reactions Occur in Cytoplasm Two
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationPathway overview. Glucose + 2NAD + + 2ADP +2Pi 2NADH + 2pyruvate + 2ATP + 2H 2 O + 4H +
Glycolysis Glycolysis The conversion of glucose to pyruvate to yield 2ATP molecules 10 enzymatic steps Chemical interconversion steps Mechanisms of enzyme conversion and intermediates Energetics of conversions
More informationMoh Tarek. Razi Kittaneh. Jaqen H ghar
14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple
More informationA Design Automation Framework for Computational Bioenergetics in Biological Networks
This journal is The Royal Society of Chemistry 3 A Design Automation Framework for Computational Bioenergetics in Biological Networks Claudio Angione, a Jole Costanza, b Giovanni Carapezza, a Pietro Lió
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationMetformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state
Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,
More informationSupplemental Information. Cytosolic Aspartate Availability Determines. Cell Survival When Glutamine Is Limiting
Cell Metabolism, Volume 28 Supplemental Information Cytosolic artate Availability Determines Cell Survival When tamine Is Limiting H. Furkan Alkan, Katharina E. Walter, Alba Luengo, Corina T. Madreiter-
More informationDr. Mohnen s notes on GLUCONEOGENESIS
Dr. Mohnen s notes on GLUCONEOGENESIS Note: Even though we did not get through all of these slides during lecture, I advise you to look them all through because they will be helpful to you as you learn
More informationCARBOHYDRATE METABOLISM
Note (Study Glycolysis, fermentation and their regulation, Gluconeogenesis and glycogenolysis, Metabolism of galactose, TCA cycle and Amphibolic role of the cycle, and Glyoxalic acid cycle, HMP shunt in
More informationEnergy metabolism - the overview
Energy metabolism - the overview Josef Fontana EC - 40 Overview of the lecture Important terms of the energy metabolism The overview of the energy metabolism The main pathways of the energy metabolism
More informationglucose glucose 6-phospho fructose 6-phosphate fructose 1,6-bisphosphate glyceraldehyde 3-phosphate 1,3-bisphosphoglycerate 3-phosphoglycerate
Cells glucose glucose glucose 6-phospho glycogen pentose phosphate T 1-phosphate 6-phosphate gluconate CC T CC+PD-1 pathway Isobar: fructose 1,6-diphosphate; glucose 1,6-diphosphate DHAP lactate fructose
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationglpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda
PvuI 2.0 k PvuI PvuI Rv1101c Rv1100 glpx fum 4.4 k PvuI PvuI ΔglpX Rv1101c Rv1100 HygR fum ΔglpX 5 k 4 k 3 k c 75 kda 50 kda 37 kda GLPX Δ Δ/C GLPX 2 k 1.5 k 25 kda 20 kda PRCB 1 k 0.5 k Supplementary
More informationTricarboxylic Acid Cycle. TCA Cycle; Krebs Cycle; Citric Acid Cycle
Tricarboxylic Acid ycle TA ycle; Krebs ycle; itric Acid ycle The Bridging Step: Pyruvate D hase O H 3 - - pyruvate O O - NAD + oash O 2 NADH O H 3 - - S - oa acetyl oa Pyruvate D hase omplex Multienzyme
More informationPRINT your Name Student (FAMILY, first name) Midterm 7:00 P.M.
PRINT your Name Student No. (FAMILY, first name) BIOCHEMISTRY 311A VERSION 1 (ONE) Midterm 7:00 P.M. Examiners: Dr. R. E. MacKenzie (69%) Dr. A. Storer (18%) Dr. W. Mushynski (13%) READ THE QUESTIONS CAREFULLY!!
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTRY INFORMTION doi:10.1038/nature11808 NT Phen Met ICR Oligo FCCP pmpk tmpk Supplemental figure 1. -. Primary hepatocytes were treated with 250 um Phenformin, 1 mm Metformin 250 um ICR, 100 nm
More informationLecture 29: Membrane Transport and metabolism
Chem*3560 Lecture 29: Membrane Transport and metabolism Insulin controls glucose uptake Adipose tissue and muscles contain a passive glucose transporter GluT4 which takes up glucose from blood. (This is
More informationKrebs cycle Energy Petr Tůma Eva Samcová
Krebs cycle Energy - 215 Petr Tůma Eva Samcová Overview of Citric Acid Cycle Key Concepts The citric acid cycle (Krebs cycle) is a multistep catalytic process that converts acetyl groups derived from carbohydrates,
More informationWelcome to Class 14! Class 14: Outline and Objectives. Overview of amino acid catabolism! Introductory Biochemistry!
Welcome to Class 14 Introductory Biochemistry Class 14: Outline and Objectives Amino Acid Catabolism Fates of amino groups transamination urea cycle Fates of carbon skeletons important cofactors metabolic
More informationNew tools bring greater understanding to cellular metabolism research
New tools bring greater understanding to cellular metabolism research Mourad Ferhat, Ph.D, 7 Juin 2017 FDSS Users Meeting, Hamamatsu mourad.ferhat@promega.com Today s talk : focus on new cell-based assays
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationChapter 15 Homework Assignment
Chapter 15 Homework Assignment The following problems will be due once we finish the chapter: 3, 5, 6, 8, 9 Chapter 15 1 Regulation of Metabolic Pathways Dynamic Steady State Fuels, such as glucose, enter
More informationLink download full of Test Bank for Fundamentals of Biochemistry 4th Edition by Voet
Link download full of Test Bank for Fundamentals of Biochemistry 4th Edition by Voet http://testbankair.com/download/test-bank-for-fundamentals-ofbiochemistry-4th-edition-by-voet/ Chapter 16: Glycogen
More informationRelative Rates. SUM159 CB- 839-Resistant *** n.s Intracellular % Labeled by U- 13 C-Asn 0.
A Relative Growth Rates 1.2 1.8.6.4.2 B Relative Rates 1.6 1.4 1.2 1.8.6.4.2 LPS2 Parental LPS2 Q-Independent SUM159 Parental SUM159 CB-839-Resistant LPS2 Parental LPS2 Q- Independent SUM159 Parental SUM159
More informationLecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross
Lecture 5: Cell Metabolism Biology 219 Dr. Adam Ross Cellular Respiration Set of reactions that take place during the conversion of nutrients into ATP Intricate regulatory relationship between several
More informationI tried to put as many questions as possible, but unfortunately only answers were found without the questions.
I tried to put as many questions as possible, but unfortunately only answers were found without the questions. These are some questions from doctor2015 med exam : 1. One of them isn t acute phase protein
More informationI tried to put as many questions as possible, but unfortunately only answers were found without the questions.
I tried to put as many questions as possible, but unfortunately only answers were found without the questions. These are some questions from doctor2015 med exam : 1. One of them isn t acute phase protein
More informationGlycolysis. Degradation of Glucose to yield pyruvate
Glycolysis Degradation of Glucose to yield pyruvate After this Lecture you will be able to answer: For each step of glycolysis: How does it occur? Why does it occur? Is it Regulated? How? What are the
More informationEnergy storage in cells
Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen
More informationName: Chem 351 Exam 3
Multiple hoice: Pick the BEST answer and write it in the box at the end of the section. 1) The TA (Krebs) ycle depends on oxygen availability, though it does not directly use it. How can you best explain
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationGlucose is the only source of energy in red blood cells. Under starvation conditions ketone bodies become a source of energy for the brain
Glycolysis 4 / The Text :- Some Points About Glucose Glucose is very soluble source of quick and ready energy. It is a relatively stable and easily transported. In mammals, the brain uses only glucose
More informationThe citric acid cycle Sitruunahappokierto Citronsyracykeln
The citric acid cycle Sitruunahappokierto Citronsyracykeln Ove Eriksson BLL/Biokemia ove.eriksson@helsinki.fi Metabolome: The complete set of small-molecule metabolites to be found in a cell or an organism.
More informationGlycolysis. Color index: Doctors slides Notes and explanations Extra information Highlights. Biochemistry Team 437
Glycolysis Color index: Doctors slides Notes and explanations Extra information Highlights Biochemistry Team 437 ﺑ ﺳ م ﷲ اﻟرﺣﻣن اﻟرﺣﯾم Objectives: Recognize glycolysis as the major oxidative pathway of
More informationGlycogen Metabolism. BCH 340 lecture 9
Glycogen Metabolism BC 340 lecture 9 Structure of glycogen Glycogen is homopolysaccharide formed of branched D-glucose units The primary glycosidic bond is 1-4-linkage Each branch is made of 6-12 glucose
More informationMidterm 2 Results. Standard Deviation:
Midterm 2 Results High: Low: Mean: Standard Deviation: 97.5% 16% 58% 16.3 Lecture 17 Amino Acid Metabolism Urea Cycle N and S assimilation Last cofactors: THF and SAM Dietary (Exogenous) Proteins Hydrolyzed
More informationPage 2 (out of 16) Page 3 (out of 12) Page 4 (out of 12) Page 5 (out of 16) Page 6 (out of 16) Page 7 (out of 13) Page 8 (out of 13)
Fa14%BIBC102%final,%page% 1%! Hello Non-Minion Metabolites! This test will be collected for grading. The graded exams will be available for pickup sometime next week. Stay tuned. The key will be posted
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More informationIII. 6. Test. Respiració cel lular
III. 6. Test. Respiració cel lular Chapter Questions 1) What is the term for metabolic pathways that release stored energy by breaking down complex molecules? A) anabolic pathways B) catabolic pathways
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
More informationMetabolism of amino acids. Vladimíra Kvasnicová
Metabolism of amino acids Vladimíra Kvasnicová Classification of proteinogenic AAs -metabolic point of view 1) biosynthesis in a human body nonessential (are synthesized) essential (must be present in
More informationAMINO ACID METABOLISM. Sri Widia A Jusman Dept. of Biochemistry & Molecular Biology FMUI
AMINO ACID METABOLISM Sri Widia A Jusman Dept. of Biochemistry & Molecular Biology FMUI Amino acids derived from dietary protein absorbed from intestine through blood taken up by tissues used for biosynthesis
More informationIntegration & Hormone Regulation
Integration Branchpoints in metabolism where metabolites can go several directions 1. Glucose 6-phosphate Energy needed (low energy charge): glycolysis Low blood sugar: high [glucagon], low [insulin] glycogen
More informationCell Metabolism Assays. for OMICS. Research
Gene-Protein-metabolism links Cell Metabolism Assays for OMICS Research STANDARD Parameters of Functional METABOLIsm Genomics Cells use gene expression to synthesize proteins and other products that are
More informationRegulation. 1. Short term control 8-1
Regulation Several aspects of regulation have been alluded to or described in detail as we have progressed through the various sections of the course. These include: (a) compartmentation: This was not
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationFig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
More informationIntegrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
More informationThis is an example outline of 3 lectures in BSC (Thanks to Dr. Ellington for sharing this information.)
This is an example outline of 3 lectures in BSC 2010. (Thanks to Dr. Ellington for sharing this information.) Topic 10: CELLULAR RESPIRATION (lectures 14-16) OBJECTIVES: 1. Know the basic reactions that
More information[U- 13 C5] glutamine. Glutamate. Acetyl-coA. Citrate. Citrate. Malate. Malate. Isocitrate OXIDATIVE METABOLISM. Oxaloacetate CO2.
Supplementary Figures a. Relative mrna levels Supplementary Figure 1 (Christofk) 3.0 2.5 2.0 1.5 1.0 0.5 0.0 LAT1 Fumarate Succinate Palmitate Acetyl-coA Oxaloacetate OXIDATIVE METABOLISM α-ketoglutarate
More information1. This question gives you experience tracking a labeled atom through the catabolic pathways we have studied so far.
Chemistry 5.07 Problem Set 7 Answers Problem 1 1. This question gives you experience tracking a labeled atom through the catabolic pathways we have studied so far. a. Carbon dioxide is lost in the pyruvate
More informationSupplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
More informationCarbohydrate. Metabolism
Carbohydrate Metabolism Dietary carbohydrates (starch, glycogen, sucrose, lactose Mouth salivary amylase Summary of Carbohydrate Utilization Utilization for energy (glycolysis) ligosaccharides and disaccharides
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationnumber Done by Corrected by Doctor Nayef Karadsheh
number 13 Done by Asma Karameh Corrected by Saad hayek Doctor Nayef Karadsheh Gluconeogenesis This lecture covers gluconeogenesis with aspects of: 1) Introduction to glucose distribution through tissues.
More informationMetabolic requirements for cancer cell proliferation
Keibler et al. Cancer & Metabolism (2016) 4:16 DOI 10.1186/s40170-016-0156-6 RESEARCH Open Access Metabolic requirements for cancer cell proliferation Mark A. Keibler 1, Thomas M. Wasylenko 1,3, Joanne
More informationFate of glucose in living systems. Glycolysis: Derived from Greek words; Glucose + 6O 2 = 6CO 2 + 6H 2 O δg o = kj/mol
Glycolysis: Derived from Greek words; Glykys = Sweet, Lysis = splitting During this process one molecule of glucose (6 carbon molecule) is degraded into two molecules of pyruvate (three carbon molecule).
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Information
Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationMidterm 2. Low: 14 Mean: 61.3 High: 98. Standard Deviation: 17.7
Midterm 2 Low: 14 Mean: 61.3 High: 98 Standard Deviation: 17.7 Lecture 17 Amino Acid Metabolism Review of Urea Cycle N and S assimilation Last cofactors: THF and SAM Synthesis of few amino acids Dietary
More information-ketoglutarate coordinates carbon and nitrogen utilization via Enzyme I inhibition
-ketoglutarate coordinates carbon and nitrogen utilization via Enzyme I inhibition Christopher D Doucette, David J Schwab, Ned S Wingreen, and Joshua D Rabinowitz Supplementary Results 1. Supplementary
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationThe elements of G protein-coupled receptor systems
The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch
More information4. Which step shows a split of one molecule into two smaller molecules? a. 2. d. 5
1. Which of the following statements about NAD + is false? a. NAD + is reduced to NADH during both glycolysis and the citric acid cycle. b. NAD + has more chemical energy than NADH. c. NAD + is reduced
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationDr. DerVartanian is ill and will likely not be able to give lectures this week.
Dr. DerVartanian is ill and will likely not be able to give lectures this week. Today s slides will be put on-line today, and are designed to introduce you to glycolysis. You should use these slides, along
More informationneurotransmitter cycling in humans
Special Issue Review Article Received: 10 December 2010, Revised: 9 June 2011, Accepted: 14 June 2011, Published online in Wiley Online Library: 2011 (wileyonlinelibrary.com) DOI: 10.1002/nbm.1772 13 C
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationThe Citric acid cycle. The Citric Acid Cycle II 11/17/2009. Overview. Pyruvate dehydrogenase
The itric acid cycle The itric Acid ycle II 11/17/2009 It is called the Krebs cycle or the tricarboxylic and is the hub of the metabolic system. It accounts for the majority of carbohydrate, fatty acid
More informationII. HETEROGENEITY OF METABOLITE LABELING PATTERN
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 283, NO. 32, pp. 21988 21996, August 8, 2008 2008 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Metabolomic and Mass
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More information18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin
18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function
More informationAbout OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationUniversity of Palestine. Final Exam 2016/2017 Total Grade:
Part 1 : Multiple Choice Questions (MCQs) 1)Which of the following statements about Michaelis-Menten kinetics is correct? a)k m, the Michaelis constant, is defined as the concentration of substrate required
More informationTIGAR's promiscuity Bolaños, Juan P.
TIGAR's promiscuity Bolaños, Juan P. TIGAR [TP53 (tumour protein 53)-induced glycolysis and apoptosis regulator] is an important survival factor for cancer cells. The enzymatic activity supported by sequence
More information