Livestock Science 140 (2011) Contents lists available at ScienceDirect. Livestock Science. journal homepage:

Transcription

1 Livestock Science 140 (2011) Contents lists ville t ScienceDirect Livestock Science journl homepge: Effects of dietry protein/crohydrte rtio on ft deposition nd gene expression of peroxisome prolifertor ctivted receptor γ nd hert ftty cid-inding protein of finishing pigs Xiuln Guo,, Renyong Tng,, Wei Wng, Dyu Liu, Kngning Wng, Institute of Animl Nutrition, Sichun Agriculturl University, Yn, Sichun, , Chin Sichun Key Lortory of Met Processing, Chengdu University, Chengdu, Sichun, , Chin rticle info strct Article history: Received 13 My 2010 Received in revised form 1 Ferury 2011 Accepted 23 Ferury 2011 Keywords: Protein/crohydrte rtio Intrmusculr ft Pigs Peroxisome prolifertor ctivted receptor γ Hert ftty cid-inding protein The present study ws conducted to investigte the effect of dietry protein/crohydrte (CH 2 O) rtio on ft deposition nd expression of peroxisome prolifertor ctivted receptor γ (PPARγ) nd hert ftty cid-inding protein (H-FABP) genes in muscle nd sucutneous dipose tissue in pigs. Twenty pigs (73.9±1.2 kg BW) were used in single fctoril experiment, nd llocted y BW nd ultrsound ckft thickness to the two tretments: low protein/ch 2 O rtio (LP; 11.2% CP nd 68.2% CH 2 O for phse I, nd 10.1% CP nd 69.3% CH 2 O for phse II) diet, or high protein/ch 2 O rtio (HP; 22.7% CP nd 58.3% CH 2 O) diet. Pigs were housed individully in pens, nd hd d liitum ccess to feed nd wter. After 80-d feeding, 6 pigs from ech tretment were selected nd slughtered. Dietry protein/ch 2 O rtio hd no effect on growth performnce; however, the intrmusculr ft (IMF) in longissimus muscle (LM) ws incresed (P 0.01) when the LP diet ws fed. Correspondingly, Wrner Brtzler sheer force of LM in the LP pigs ws lower (P 0.05) thn the HP pigs. The LP incresed mrna levels of PPARγ (P0.05) nd H-FABP (P=0.09) in LM ut not in sucutneous ft, lthough the difference of H-FABP gene expression in LM ws not sttisticlly significnt. The mrna undnce of PPARγ in muscle correlted positively with IMF content (P0.05). The results indicted tht n increse in IMF ut not sucutneous ft in pigs fed the LP diet is relted to tissue-specific ctivtion of PPARγ nd H-FABP mrna expression, especilly the PPARγ gene Elsevier B.V. All rights reserved. 1. Introduction Pork qulity is one of the most importnt fctors influencing the cceptility of pig met. However, pork qulity hs een decresing s result of genetic selection for higher len met content nd reduced ckft thickness, nd the incresing trend towrds the production of lener met hs resulted not only in decrese of sucutneous ft, ut lso of intrmusculr ft (IMF). Studies hve shown tht IMF content is relted to the tenderness, juiciness nd sensory qulity of pork (Blnchrd et l., 1999; vn Brneveld, 2003; Wood et l., 2004), nd is one of the most importnt trits tht cn influence eting qulity Corresponding uthor. Tel.: ; fx: E-mil ddress: wknsicu@yhoo.com.cn (K. Wng). chrcteristics. Thus, producing pork with higher mount of IMF without n increse in sucutneous ft is of importnce to the pig industry. Severl studies hve shown tht IMF content cn e incresed, without incresing sucutneous ft deposition, y the feeding of low protein diets in the growing or finishing phse (Gondret nd Leret, 2002; Teye et l., 2006; Wood et l., 2004). Although it is cler from these studies tht dietry protein is n importnt fctor, reducing protein in diets is ccompnied y other dietry component chnges, such s n increse in crohydrte (CH 2 O) frction (Gondret nd Leret, 2002), nd little ttention hs een pid to the role of the dietry CH 2 O content nd protein/ch 2 O rtio in the deposition of IMF. The moleculr mechnisms, underlying the effects of low protein diets or other components on IMF content, remin /$ see front mtter 2011 Elsevier B.V. All rights reserved. doi: /j.livsci

2 112 X. Guo et l. / Livestock Science 140 (2011) lrgely unknown. Expression of lipogenic genes in muscle my e ssocited with IMF content. Peroxisome prolifertor ctivted receptor γ (PPARγ), is DNA-inding trnscription fctor, nd hs een implicted in ft metolism nd deposition through regultion of expression of vrious genes (Brun nd Spiegelmn, 1997; Tontonoz et l., 1995). Differences in PPARγ expression etween IMF nd sucutneous ft my result in differences in ft deposition etween the two ft loctions (Medus et l., 2002; Vlmsed et l., 1999). In ddition, hert ftty cid-inding protein (H-FABP), PPARresponsive gene, hs een ssocited with IMF content in pigs (Gerens et l., 1998, 1999). The H-FABP is widely distriuted, with the gretest expression in the hert nd skeletl muscle (Heuckeroth et l., 1987; Li et l., 2007). Hert ftty cidinding protein mrna ws induced during dipogenic differentition of stroml-vsculr cells, especilly in skeletl muscle (Li et l., 2007). Therefore, H-FABP my ply n importnt role in the development of intrmusculr dipocytes. The im of this study ws to investigte the effects of dietry protein/ch 2 O rtio on IMF content, growth performnce, the expression of PPARγ nd H-FABP genes in pig muscle nd sucutneous dipose tissue, nd the reltionships etween PPARγ nd H-FABP expression nd levels of intrmusculr nd sucutneous dipose tissue lipids. 2. Mterils nd methods 2.1. Animl nd dietry tretments The experimentl protocols used in the present study were pproved y the Sichun Agriculturl University Institutionl Animl Cre nd Use Committee. Twenty Duroc Lrge White Yorkshire (DLY) pigs were used in single fctoril experiment, nd llocted y BW (73.9±1.2 kg) nd ultrsound ckft thickness (1.1±0.1 cm) to the two dietry tretments: low protein/ch 2 O rtio (LP) diet, or high protein/ch 2 Ortio(HP) diet. Pigs were housed individully in pens ( m) nd hd d liitum ccess to feed nd wter (vi nipple) t the reserch sttion of Sichun Agriculturl University. The experiment lsted 80 d, including two phses (40 d/phse). The LP diet supplied 2.3 Mcl of NE/kg, nd contined 11.2% CP nd 68.2% CH 2 Ofor phse I, nd 10.1% CP nd 69.3% CH 2 OforphseII(Tle 1). The synthetic mino cids were supplemented to the LP diet in order to pproximtely meet the NRC (1998) requirements, nd the digestile lysine content ws 0.57 nd 0.46% for the phse I nd II, respectively. The HP diet supplied 22.7% CP, 58.3% CH 2 Ond2.2 Mcl of NE/kg in two phses. The feed intke of ech pen ws recorded t 7-d intervls nd the pig weights were recorded t 28-d intervls during the experiment. Furthermore, ultrsound ckft thickness t 10th-ri ws recorded on d 0 nd 60 of the experiment (Model SSD-500 V, Alok Co., Ltd., Tokyo, Jpn) Crcss dt collection After the feeding experiment, 6 pigs (close to verge BW) from ech dietry tretment were selected nd slughtered. The hot crcss weights were recorded efore chilling. Midline ft depth opposite the first ri, lst ri, nd lst lumr verter ws mesured, nd loins etween the 10th nd 11th ris were trced onto cette ppers to mesure longissimus muscle (LM) re using compensting plnimeter. Tle 1 Composition nd nutrient content of experimentl diets, s-fed sis. LP tretment 2.3. Met qulity dt collection HP tretment Phse I Phse II All experiment Ingredient, % Corn Soyen mel Clcium cronte Diclcium phosphte Sodium chloride L-Lysine L-Threonine 0.03 Minerl premix Vitmin premix Choline chloride Clculted composition, % DM CP CH 2 O c Digestile Lys Digestile Met Digestile Met+Cys Digestile Thr Digestile Trp C Aville P DE, Mcl/ kg NE, Mcl/ kg c High protein/ch 2 O rtio. CH 2 O content ws clculted through eqution: CH 2 O =100% Wter% CP% EE% Ash%. The one-in loin ws removed from the left side of ech crcss nd trnsported to the Met Science Lortory t the Sichun Agriculturl University for further evlution. Two chops (2.5 cm thick) were cut from the LM immeditely posterior to the lst ri. The first chop ws weighed, plced in Whirlpk g, suspended in 4 C cooler for 24 h, nd then reweighed nd stored t 20 C for determintion of Wrner Brtzler sher force (WBSF). The chop drip loss ws clculted sed on weight loss nd expressed s percentge. The second chop ws used for mesurement of color, mrling nd ph t 24 h postmortem. Color ws determined, fter looming for 30 min, ojectively y mesurement of L*, *, nd * vlues using Minolt Chrommeter CR-300 (Minolt, Osk, Jpn). The mrling of LM ws evluted sujectively y three persons ccording to the NPPC (1991) stndrds. The ph of LM ws determined t 24 h fter slughter using n utomted ph proe (ph-star, SFK-Technology, Denmrk). Intrmusculr ft ws mesured ccording to Folch et l. (1957), using 10-g smple of the LM, nd expressed s percentge of fresh tissue. The WBSF of the 2.5-cm-thick LM chops ged 24 h ws determined using Texture Anlyzer (TA.XT.plus. Stle Micro Systems, UK). Longissimus muscle chops were thwed for 16 h t 4 C, nd then cooked to n internl temperture of 70 C in thermosttic wter-th with 80 C. Internl temperture ws monitored with Teflon-coted thermocouple wires (Type T, Omeg Engineering, Inc., Stmford, CT, USA) plced into the

3 X. Guo et l. / Livestock Science 140 (2011) geometric center of ech chop. After removl from the wterth, LM chops were llowed to cool to 4 C, nd then four to six 1.27-cm-dimeter cores were removed prllel to the muscle fier orienttion from ech chop. Ech core ws then shered once through the center t crosshed speed of 1 mm/s with the Texture Anlyzer. All dt were collected using Texture Expert softwre Version 1.22 (Stle Micro Systems, UK). Sher force vlues for individul cores were verged for ech smple The mrna levels of PPARγ nd H-FABP mesurement Smples of sucutneous ckft nd LM etween the 6th nd 7th ri were otined within 5 min fter slughter for RNA extrction, frozen in liquid nitrogen nd stored t 80 C. Totl RNA ws prepred from porcine LM nd sucutneous ckft using the TRIzol Regent (Invitrogen, Crlsd, CA, USA) ccording to the mnufcturer's instruction. The concentrtions of totl RNA were determined y spectrophotometer (Beckmn Coulter DU800, Bre, CA, USA). The cdna synthesis ws performed for 15 min t 37 C, nd 5 s t 85 C using the SYBR PrimeScript RT-PCR kit (TKR, Dlin, Chin) ccording to the mnufcturer's instruction. The primers sets specific for mrna of genes re listed in Tle 2. These primers were synthesized commercilly y Invitrogen (Shnghi, Chin). Rel-time quntittive PCR ws crried out with PTC-0200 Chromo4 Rel-Time Detector (Bio- Rd, Hercules, CA, USA). Ech PCR mixture, with finl volume of 20 μl, ws composed of 10 μl of SYBR PrimeScript Mix (TKR, Dlin, Chin), 100 nm of ech gene-specific primer (Tle 1), nd 2 μl cdna in ech rection. The rection protocol comprised 1 cycle of 95 C for 10 s; 40 cycles of 95 C for 5 s nd 60 C for 30 s. A melting curve nlysis ws conducted fter mplifiction. Anlyses were performed in triplicte, nd the men vlues were clculted. Dt were collected nd clculted using Opticon Monitor 3.1 (Bio- Rd, Hercules, CA, USA), nd reltive expression of the trget gene ws clculted using the formul 2 ΔΔCt (Livk nd Schmittgen, 2001), where the internl control gene ws β-ctin Sttisticl nlysis Results were expressed s men±sd. Sttisticlly significnt differences were determined y Independent-Smples t tests (SPSS Inc., Chicgo, IL, USA). The liner regression method ws used to nlyze the correltion etween the undnce of PPARγ nd H-FABP nd levels of intrmusculr nd sucutneous dipose tissue lipids. Sttisticl significnce ws set t P0.05, nd P0.10 ws s tendency. 3. Results The effects of dietry protein/ch 2 O rtio on growth performnce nd ultrsound ckft thickness re presented in Tle 3. Protein/CH 2 O rtio hd no effect on ody weight, ADFI, ADG nd G:F; however, the LP diet tretment hd trend to increse ultrsound ckft thickness fter 60-d feeding (P=0.062). The effects of dietry protein/ch 2 O rtio on crcss chrcteristics re presented in Tle 4. The crcss trits were not ffected y dietry protein/ch 2 O rtio. Met qulity results, which include drip loss, ph, loomed color, WBSF, mrling nd IMF, re presented in Tle 5. There ws no effect of dietry protein/ch 2 O rtio on drip loss, ph, color nd mrling. The IMF ws higher 88.7% (P0.01) in met from the pigs fed the LP diet thn the HP diet, nd WBSF in the LP pigs ws lower 22.3% (P0.05) thn the HP pigs. The gene expression results (Tle 6) showed the LP diet tretment incresed mrna level of PPARγ (P0.05) in LM, nd hd trend to increse H-FABP mrna level (P=0.09) of LM. However, no difference ws oserved in gene expression of H-FABP nd PPARγ in sucutneous ft. The mrna undnce of PPARγ in muscle correlted positively with the IMF content (R 2 ws 0.54, P0.05) (Fig. 1). 4. Discussion 4.1. Effect of dietry protein/ch 2 O rtio on growth performnce The growth performnce ws not ffected y dietry protein/ch 2 O rtio, lthough there is greter difference of protein level in diets ( % (LP) versus 22.7% (HP)) in the present study compred with other studies (13 18% versus %) (D Cost et l., 2004; Dorn et l., 2006; Wood et l., 2004). The results of this study re not consistent with previous reports (Chen et l., 1995; Cromwell et l., 1993; Teye et l., 2006) demonstrting tht ADG nd G:F hve een shown to decrese in response to decresing dietry CP. One possile explntion for the discrepncy in these results tht the requirement of necessry mino cids were considered in the present study, synthetic mino cids were supplemented to the LP diet nd the necessry mino cids contents pproximtely met the recommendtions of NRC (1998). Severl reports hd confirmed tht pigs fed low-cp diet supplemented with crystlline mino cids hd similr growth performnce to Tle 2 Primer sequences used for rel-time quntittive RT-PCR. Gene Primer (5-3 ) GenBnk ccession no. Anneling temperture ( C) Product size (p) H-FABP F:CTGCAGAAGTGGAATGGACAAG AJ R:GAAGGGATGGGCAGGTCAT PPARγ F:ACAGCGACCTGGCGATATTT DQ R:GCAGCTCCAAGGCTTGCA β-ctin F:TCGCACTTCATGATCGAGTTG AY R:CGACGGCCAGGTCATCAC

4 114 X. Guo et l. / Livestock Science 140 (2011) Tle 3 Effect of dietry protein/ch 2 O rtio on growth performnce nd ultrsound ckft thickness of pigs. LP tretment HP tretment P-vlue Strt weight, kg 73.60± ± Slughter weight, kg ± ± ADFI, kg/d 2.73± ± ADG, kg/d 0.752± ± G:F 0.276± ± Ultrsound ckft thickness (10th-ri), cm d ± ± d ± ± High protein/ch 2 O rtio. pigs fed high-cp diet (Kerr et l., 2003; Knowles et l., 1998; Shriver et l., 2003) Effect of dietry protein/ch 2 O rtio on ft deposition Intrmusculr ft is importnt in ssessing met qulity, nd ffects the juiciness, flvor, nd tenderness of met (Wood, 1993). Intrmusculr ft content of LM in pigs ws incresed y low protein diet tretment (Dorn et l., 2006; Gondret nd Leret, 2002; Teye et l., 2006 Wood et l., 2004). Similr to previous studies, the IMF ws significntly higher in met from the pigs fed the LP diet thn the HP diet in this study. Correspondingly, WBSF in the LP pigs ws lower thn the HP pigs (Tle 5), which is consistent with findings of De Vol et l. (1988) nd Hodgson et l. (1991) who oth reported tht higher levels of IMF cused significnt decrese in sher force. The present study indicted tht the lrge (88.2%) increse in IMF due to the LP ws ccompnied y only smll (13.0%) increse in sucutneous ft, which is consistent with the results of decresing dietry CP level (Dorn et l., 2006; Wood et l., 2004). Energetic efficiency of protein is lower thn those of strch (the energetic efficiencies of ME utiliztion were nd for strch nd protein, respectively) (vn Milgen et l., 2001), therefore, reducing protein/ch 2 O rtio incresed the mount of energy ville for ft deposition (LP diet hd 5.5% higher NE compred with HP diet). This grees with Nolet et l. (1987) nd Le Bellego et l. (2001), who reported tht pigs given the low CP diet, in ssocition with dequte AA supplementtion, hd higher Tle 5 Effect of dietry protein/ch 2 O rtio on met qulity mesurements of pigs. LP tretment HP tretment P-vlue Drip loss, % 1.70± ± Ultimte ph 5.43± ± L ± ± ± ± ± ± Wrner Brtzler sher force 4.11± ± Mrling 3.83 ± ± Intrmusculr ft, % 5.83± ± High protein/ch 2 O rtio. ft deposition without ffecting growth performnce compring with pigs fed the high CP diet. Moreover, the distriution of ft etween different ft depots might e controlled y different mechnisms nd possily y different genes (Dorn et l., 2006; Mourot et l., 1995). The ft distriution etween different depots my e reltive to vritions in the ptterns of PPARγ mrna (Medus et l., 2002), steroyl-coa desturse protein (Dorn et l., 2006), cetyl-coa croxylse, mlic enzyme nd glucose-6-phosphte dehydrogense ctivities (Mourot et l., 1995) in different ft depots Effect of dietry protein/ch 2 O rtio on gene expression of PPARγ nd H-FABP Peroxisome prolifertor ctivted receptor γ is key trnscription fctor, nd expressed primrily in dipose tissue (Vidl-Puig et l., 1997). Regultion of PPARγ would hve mjor impct on the trnscription of mny other key enzymes for dipocyte function, such s lipoprotein lipse, steroyl- CoA desturse nd ftty cid inding protein (FABP). Expression of PPARγ gene is ffected y nutrient components (Michel et l., 2000; Vidl-Puig et l., 1997). Corn-soyen mel diets contining 10% sfflower oil incresed PPARγ2 mrna expression in porcine dipose tissue (Michel et l., 2000). Expression of PPARγ2 ws found to e decresed fter low-clorie diet tht resulted in 10% weight loss (Vidl-Puig et l., 1997). Similr to the previous reports, the present reserch showed n increse of PPARγ mrna expression in pig muscle under the low protein/ch 2 O diet with high energy, nd the increse ws ccompnied y rise in IMF deposition. These results re consistent with Brun nd Spiegelmn (1997) nd Vlmsed et l. (1999), who reported tht PPARγ ctivtion Tle 4 Effect of dietry protein/ch 2 O rtio on crcss trits of pigs. LP tretment HP tretment P-vlue Hot crcss weight, kg ± ± Dressing percentge 74.20± ± Bckft depth, cm First ri 4.82± ± Lst ri 2.77± ± Lst lumr verter 3.11± ± Averge ckft 3.56± ± Longissimus muscle re, cm ± ± High protein/ch 2 O rtio. Tle 6 Effect of dietry protein/ch 2 O rtio on hert ftty cid-inding protein (H- FABP) nd peroxisome prolifertor ctivted receptor γ (PPARγ) mrna levels (clculted using 2 -ΔΔCt ) in LM nd sucutneous ft of pigs. Longissimus muscle Sucutneous ft H-FABP PPARγ H-FABP PPARγ LP tretment 35.14± ± ± ±0.41 HP tretment 26.28± ± ± ±1.22 P-vlue High protein/ch 2 O rtio.

5 X. Guo et l. / Livestock Science 140 (2011) the present study re similr to the previous results with reduced dietry CP level. These suggested tht n increse in IMF ut not sucutneous ft in pigs fed the LP diet is relted to tissue-specific ctivtion of PPARγ nd H-FABP mrna expression, especilly the PPARγ gene. Acknowledgements This work ws supported y the Ntionl Bsic Reserch Progrm of Chin under Grnt No. 2004CB References Fig. 1. Reltionship etween peroxisome prolifertor ctivted receptor γ (PPARγ) mrna expression in muscle nd intrmusculr ft (IMF) content (R 2 =0.54, P0.05, n=12). increses dipocyte differentition nd ft deposition. Moreover, there ws higher percentge of s-v stem cells nd predipocytes in IMF nd muscle tissue thn in sucutneous ft (My et l., 1994; Rmsy et l., 1989). Therefore, n increse of PPARγ expression or stimultion in muscle my enhnce IMF formtion. Medus et l. (2002) reported tht prolonged PPARγ stimultion y conjugted linoleic cid incresed the pprent IMF content. In the present study, PPARγ mrna expression in LM positively correlted with IMF content (P0.05), which suggested tht PPARγ plys sustntil role nd might e cndidte gene of IMF formtion. Ftty cid-inding proteins re intrcellulr trnsporters tht deliver ftty cids either to the sites of ft storge or to the sites of energy production, nd H-FABP gene is regrded s cndidte gene for IMF content (Gerens et l., 1998, 1999). In the present study, H-FABP mrna expression tended to increse with IMF incresing when pigs were fed the LP diet, which is in greement with Gerens et l. (2001) who found tht H-FABP mrna level ws positively relted to IMF content. Interestingly, this experiment found tht the effect of dietry protein/ch 2 O rtio on PPARγ nd H-FABP gene expression ws oserved in muscle ut not in sucutneous ft. Tissue-specific ctivtion of the expression of lipogenic enzymes y reduced protein diet in pigs ws suggested y Dorn et l. (2006), who oserved tht reduced protein diet significntly incresed steroyl-coa desturse protein expression nd ctivity in muscle ut not in sucutneous dipose tissue. A tissue-specific increse in expression of PPARγ nd H- FABP genes in muscle oserved in the present study ws ccompnied y significnt rise in IMF content which is consistent with Medus et l. (2002), who reported tht conjugted linoleic cid tretment incresed PPARγ mrna expression in muscle rther thn in sucutneous ft, nd incresed IMF deposition nd ssocited reduction in sucutneous ft deposition in pigs. 5. Conclusions The diet with low protein/ch 2 O rtio elevted IMF content with less effect on sucutneous ft deposition, nd the chnges of ft deposition response to low dietry protein/ch 2 O rtio in Blnchrd, P.J., Ellis, M., Wrkup, C.C., Hrdy, B., Chdwick, J.P., Dens, G.A., The influence of rte of len nd sucutneous ft tissue development on pork eting qulity. Anim. Sci. 68, Brun, R.P., Spiegelmn, B.M., Oesity nd the dipocyte. PPARγ nd the moleculr control of dipogenesis. J. Endocrinol. 155, Chen, H.Y., Miller, P.S., Lewis, A.J., Wolverton, C.K., Stroup, W.W., Chnges in plsm ure concentrtion cn e used to determine protein requirements of two popultions of pigs with different protein ccretion rtes. J. Anim. Sci. 73, Cromwell, G.L., Cline, T.R., Crenshw, J.D., Crenshw, T.D., Ewn, R.C., Hmilton, C.R., Lewis, A.J., Mhn, D.C., Miller, E.R., Pettigrew, J.E., et l., The dietry protein nd (or) lysine requirements of rrows nd gilts. NCR-42 Committee on Swine Nutrition. J. Anim. Sci. 71, D Cost, N., NcGillivry, C., Bi, Q., Wood, J., Evns, G., Chng, K.-C., Restriction of dietry energy nd protein induces moleculr chnges in young porcine skeletl muscles. J. Nutr. 134, De Vol, D.L., McKeith, F.K., Bechtel, P.J., Novkofski, J., Shnks, R.D., Crr, T.R., Vrition in composition nd pltility trits nd reltionships etween muscle chrcteristics nd pltility in rndom smple of pork crcsses. J. Anim. Sci. 66, Dorn, O., Moule, S.K., Teye, G.A., Whittington, F.M., Hllett, K.G., Wood, J.D., A reduced protein diet induces steroyl-coa desturse protein expression in pig muscle ut not in sucutneous dipose tissue: reltionship with intrmusculr lipid formtion. Br. J. Nutr. 95, Folch, J., Lee, M., Slone Stnley, G.H., A simple method for the isoltion nd purifiction of totl lipids from niml tissues. J. Biol. Chem. 226, Gerens, F., Jnsen, A., vn Erp, A.J., Hrders, F., Meuwissen, T.H.E., Rettenerger, G., Veerkmp, J.H., te Ps, M.F., The dipocyte ftty cid inding protein locus: chrcteriztion nd ssocition with intrmusculr ft content in pigs. Mmm. Genome 9, Gerens, F., vn Erp, A.J., Hrders, F.L., Verurg, F.J., Meuwissen, T.H., Veerkmp, J.H., te Ps, M.F., Effect of genetic vrints of the hert ftty cid-inding protein gene on intrmusculr ft nd performnce trits in pigs. J. Anim. Sci. 77, Gerens, F., Verurg, F.J., Vn Moerkerk, H.T., Engel, B., Buist, W., Veerkmp, J.H., te Ps, M.F., Associtions of hert nd dipocyte ftty cid-inding protein gene expression with intrmusculr ft content in pigs. J. Anim. Sci. 79, Gondret, F., Leret, B., Feeding intensity nd dietry protein level ffect dipocyte cellulrity nd lipogenic cpcity of muscle homogentes in growing pigs, without modifiction of the expression of sterol regultory element inding protein. J. Anim. Sci. 80, Heuckeroth, R.O., Birkenmeier, E.H., Levin, M.S., Gordon, J.I., Anlysis of the tissue-specific expression, developmentl regultion, nd linkge reltionships of rodent gene encoding hert ftty cid inding protein. J. Biol. Chem. 262, Hodgson, R.R., Dvis, G.W., Smith, G.C., Svell, J.W., Cross, H.R., Reltionships etween pork loin pltility trits nd physicl chrcteristics of cooked chops. J. Anim. Sci. 69, Kerr, B.J., Southern, L.L., Bidner, T.D., Friesen, K.G., Ester, R.A., Influence of dietry protein level, mino cid supplementtion, nd dietry energy levels on growing-finishing pig performnce nd crcss composition. J. Anim. Sci. 81, Knowles, T.A., Southern, L.L., Bidner, T.D., Kerr, B.J., Friesen, K.G., Effect of dietry fier or ft in low-crude protein, crystlline mino cidsupplemented diets for finishing pigs. J. Anim. Sci. 76, Le Bellego, L., vn Milgen, J., Duois, S., Nolet, J., Energy utiliztion of low-protein diets in growing pigs. J. Anim. Sci. 79, Li, B., Zery, H.N., Lee, K., Hert ftty cid inding protein is upregulted during porcine dipocyte development. J. Anim. Sci. 85,

6 116 X. Guo et l. / Livestock Science 140 (2011) Livk, K.J., Schmittgen, T.W., Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the 2 ΔΔCt method. Methods 25, My, S.G., Svell, J.W., Lunt, D.K., Wilson, J.J., Lurenz, J.C., Smith, S.B., Evidence for predipocyte prolifertion during culture of sucutneous nd intrmusculr dipose tissues from Angus nd Wgyu crossred steers. J. Anim. Sci. 72, Medus, W.J., McInnis, R., Dugn, M.E.R., Prolonged dietry tretment with conjugted linoleic cid stimultes porcine muscle peroxisome prolifertor ctivted receptor gmm nd glutmine-fructose minotrnsferse gene expression in vivo. J. Mol. Endocrinol. 28, Michel, E.S., Kren, L.H., Crl, P.P., Steven, G.C., Gwin, M.W., Christopher, A.B., Regultion of PPARγ ut not oese gene expression y dietry ft supplementtion. J. Nutr. Biochem. 11, Mourot, J., Kou, M., Peiniu, P., Compretive study of in vitro lipogenesis in vrious diopose tissues in the growing domestic pig (sus domesticus). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 111, Nolet, J., Henry, Y., Duois, S., Effect of protein nd lysine levels in the diet on ody gin composition nd energy utiliztion in growing pigs. J. Anim. Sci. 65, NPPC, Procedures to Evlute Mrket Hogs, third ed. Ntionl Pork Producers Council, Des Moines, IA. NRC, Nutrient Requirements of Swine, ninth ed. Ntionl Acdemy Press, Wshington, DC. Rmsy, T.G., White, M.E., Wolverton, C.K., Glucocorticoids nd the differentition of porcine predipocytes. J. Anim. Sci. 67, Shriver, J.A., Crter, S.D., Sutton, A.L., Richert, B.T., Senne, B.W., Pettey, L.A., Effects of dding fier sources to reduced-crude protein, mino cid-supplemented diets on nitrogen excretion, growth performnce, nd crcss trits of finishing pigs. J. Anim. Sci. 81, Teye, G.A., Sherd, P.R., Whittington, F.M., Nute, G.R., Stewrt, A., Wood, J.D., Influence of dietry oils nd protein level on pork qulity. 1. Effects on muscle ftty cid composition, crcss, met nd eting qulity. Met Sci. 73, Tontonoz, P., Hu, E., Spiegelmn, B.M., Regultion of dipocyte gene expression nd differentition y peroxisome prolifertors ctivted receptor gmm. Curr. Opin. Genet. Dev. 5, Vlmsed, A., Crmon, M.C., Brer, M.J., Vins, O., Mmpel, T., Inglesis, R., Villrroy, F., Girlt, M., Opposite regultion of PPAR- nd -g gene expression y oth their lignds nd retinoic cid in rown dipocytes. Mol. Cell. Endocrinol. 154, vn Brneveld, R.J., Modern pork production-lncing efficient growth nd feed conversion with product qulity requirements nd consumer demnds. Asi Pc. J. Clin. Nutr. 12, S31 Suppl.. vn Milgen, J., Nolet, J., Duois, S., Energetic efficiency of strch, protein nd lipid utiliztion in growing pigs. J. Nutr. 131, Vidl-Puig, A.J., Considine, R.V., Jimenez-Liñn, M., Wermn, A., Pories, W.J., Cro, J.F., Flier, J.S., Peroxisome prolifertor-ctivted receptor gene expression in humn tissues. Effects of oesity, weight loss, nd regultion y insulin nd glucocorticoids. J. Clin. Invest. 99, Wood, J.D., Consequences of chnges in crcss composition on met qulity. In: Cole, D.J.A., Hresign, W., Grnsworthy, P.C. (Eds.), Recent Developments in Pig Nutrition. Nottinghm University Press, Nottinghm, UK, pp Wood, J.D., Nute, G.R., Richrdson, R.I., Whittington, F.M., Southwood, O., Plstow, G., Mnsridge, R., d Cost, N., Chng, K.C., Effects of reed, diet nd muscle on ft deposition nd eting qulity in pigs. Met Sci. 67,