doi: /s British Journal of Nutrition (2016), 115, The Authors 2016

Transcription

1 British Journl of Nutrition (2016), 115, The Authors 2016 doi: /s Supplementtion of rnched-chin mino cids to reduced-protein diet improves growth performnce in piglets: involvement of incresed feed intke nd direct muscle growth-promoting effect Liufeng Zheng 1, Hongkui Wei 1,2, Chunshng Cheng 1, Qunhng Xing 1, Jimn Png 1 nd Jin Peng 1,2 * 1 Deprtment of Animl Nutrition nd Feed Science, College of Animl Science nd Technology, Huzhong Agriculturl University, Wuhn , People s Repulic of Chin 2 The Coopertive Innovtion Center for Sustinle Pig Production, Wuhn , People s Repulic of Chin (Sumitted 28 August 2015 Finl revision received 28 Decemer 2015 Accepted 1 Ferury 2016 First pulished online 15 April 2016) Astrct The im of this study ws to investigte whether supplementing rnched-chin mino cids (AA) (BCAA) long with reduced-protein diet increses piglet growth, nd whether elevted feed intke nd muscle growth-promoting effect contriute to this improvement. In Expt 1, twenty-eight wenling piglets were rndomly fed one of the following four diets: positive control (PC) diet, reduced-protein negtive control (NC) diet, n NC diet supplemented with BCAA to the sme levels s in the PC diet (test 1 (T1)) nd n NC diet supplemented with 2-fold dose of BCAA in T1 diet (test 2 (T2)) for 28 d. In Expt 2, twenty-one wenling piglets were rndomly ssigned to NC, T1 nd pir-fed T1 (P) groups. NC nd T1 diets were the sme s in Expt 1, wheres piglets in the P group were individully pir-fed with the NC group. In Expt 1, the NC group hd reduced piglet growth nd feed intke compred with the PC group, which were restored in T1 nd T2 groups, ut no differences were detected etween T1 nd T2 groups. In Expt 2, T1 nd P groups showed increses in growth nd mss of some muscles compred with the NC group. Incresed feed intke fter BCAA supplementtion ws ssocited with incresed mrna expressions of goutirelted peptide nd co-express neuropeptide Y (NPY) nd phosphoryltion of mmmlin trget of rpmycin (mtor) nd riosoml protein S6 kinse 1 (S6K1), s well s decresed mrna expressions of melnocortin-4 receptor nd cocine- nd mphetmine-regulted trnscript nd phosphoryltion of eukryotic initition fctor 2α in the hypothlmus. No differences were oserved mong PC, T1 nd T2 groups except for higher NPY mrna expression in the T2 group thn in the PC group (Expt 1). Phosphoryltion of mtor nd S6K1 in muscle ws enhnced fter BCAA supplementtion, which ws independent of chnge in feed intke (Expt 2). In conclusion, supplementing BCAA to reduced-protein diets increses feed intke nd muscle mss, nd contriutes to etter growth performnce in piglets. Key words: Brnched-chin mino cids: Piglets: Growth performnce: Feed intkes: Muscle mss Post-wening dirrhoe is mjor prolem in pig production (1,2), which cn cuse considerle loss due to mortlity or production of non-mrketle pigs (3). As n effective strtegy to solve this prolem, reducing dietry protein level hs een found to reduce the incidence of dirrhoe nd the severity of digestive prolems in piglets (4 6). Recent studies hve shown tht reducing dietry protein intke could improve gstrointestinl helth nd function fter wening (7,8).However,impirmentofpigletgrowthegins to occur when crude protein (CP) content is reduced from the level recommended y the Ntionl Reserch Council (NRC) (9) to 17 %, lnced with the first four limiting mino cids (AA) (lysine, methionine, threonine nd tryptophn) (10 12). Thus, identifying the next-limiting AA tht cn mintin the growth performnce of piglets fed reduced-protein diets is of enormous nutritionl importnce. Numerous studies hve suggested tht rnched-chin AA (BCAA), prticulrly vline nd isoleucine, re the next-limiting AA for growth of piglets, nd supplementtion with these AA mkes it possile to mintin growth performnce of piglets fed reduced-protein diets (10,12,13). Moreover, it hs een demonstrted tht dietry deficiency of AA cuses rpid decline in niml feed intke, which is prticulrly the cse for BCAA in pigs (14 16) nd mice (17). In pigs, the suppressive effect of vline deficiency on feed intke is ggrvted y n excess supply of leucine due to the shred enzymes in their ctolic pthwys, which therey increses the ctolism of vline (18). However, Arevitions: AA, mino cids; ADFI, verge dily feed intke; ADG, verge dily gin; BCAA, rnched-chin AA; BW, ody weight; CART, cocine- nd mphetmine-regulted trnscript; CP, crude protein; eif2α, eukryotic initition fctor 2α; GAAC, generl mino cids control; G:F, gin:feed intke; LD, longissimus dorsi; MC4R, melnocortin-4 receptor; mtor, mmmlin trget of rpmycin; NC, reduced-protein negtive control; NPY, co-express neuropeptide Y; P, pir-fed T1; PC, positive control; S6K1, riosoml protein S6 kinse 1; T1, test 1; T2, test 2. * Corresponding uthor: J. Peng, fx , emil pengjin@mil.hzu.edu.cn Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

2 Brnched-chin mino cids improve pig growth 2237 when vline nd isoleucine requirement is fulfilled in the diet, n excess supply of leucine does not ffect feed intke ny more (19,20), ut cn ct s signlling molecule to increse muscle protein synthesis nd growth performnce in piglets (20 22). In ddition, s leucine is the most effective single AA in promoting muscle protein synthesis vi stimulting mmmlin trget of rpmycin (mtor) pthwy ctivity, ddition of leucine to reduced-protein diet to regulte niml growth hs een the focus of mny previous studies (23,24). Thus fr, little hs een reported regrding the enhncing effect of supplementtion of ll the three BCAA to reduced-protein diets on the growth performnce of piglets. Severl AA hve een known to ct s signl molecules in regulting feed intke of rodents (25 27). However, the moleculr mechnisms y which AA regulte the feed intke of pigs remin unknown. Hypothlmic neurons tht express ppetiteregultory neuropeptides re considered s criticl regultors of feeding ehviour nd ody weight (BW). Agouti-relted peptide (Agrp) nd co-express neuropeptide Y (NPY) stimulte feed intke, wheres pro-opiomelnocortin (POMC), melnocortin-4 receptor (MC4R) nd cocine- nd mphetmine-regulted trnscript (CART) inhiit feed intke (28). Recently, two evolutionrily conserved signl trnsduction pthwys, generl AA control (GAAC) pthwy in nterior piriform cortex (APC) nd hypothlmus nd mtor pthwy in hypothlmus, hve een shown contriute to the regultion of feed intke in response to dietry AA chnges (25 27). Tken together, we hypothesised tht supplementtion of BCAA to reduced-protein diets might increse feed intke nd skeletl muscle mss in piglets, nd these improvements re ssocited with chnges in ctivities of relted AA signlling pthwys. Therefore, the im of this study ws to evlute the effect of dietry BCAA supplementtion on growth performnce, feed intke nd muscle mss in piglets fed reduced-protein diets with CP content of 17 %. All diets were fortified with lysine, methionine, threonine nd tryptophn to stisfy the stndrdised ilel digestile (SID) AA requirement. We further elucidted the roles of hypothlmic GAAC nd mtor signlling pthwys in feed intke regultion s well s the role of mtor signlling pthwy involved in the control of muscle protein synthesis fter dietry supplementtion with BCAA. Methods Two experiments were conducted, nd Huzhong Agriculture University Animl Cre nd Use Committee reviewed nd pproved the protocols for ech experiment. Animls nd diets In Expt 1, twenty-eight Lrge White Lndrce rrows wened t 26 d of ge were individully housed in metolism cges ( m) with d liitum ccess to feed nd wter. The piglets continued to receive the sme commercil strter diet they hd received since wening for 7-d dpttion period. Piglets were ssigned to one of four tretments in completely rndomised design sed on BW nd ncestry seven per group. Between 8 nd 12 d fter wening, the strter diet ws grdully replced y the experimentl diets, so tht from 13 d fter wening piglets were fed the experimentl diets only. The experiment egn 13 d fter wening ( men initil BW of 8 45 (SD 0 62) kg) nd lsted for 28 d. Room temperture ws initilly set t 28 C nd progressively decresed y 1 C/week. Piglets were weighed individully t the eginning nd t the end of ech week fter n overnight fst. Feed intke ws determined dily. Feed smples were collected weekly nd pooled t the end of the experimentl period for chemicl nlysis. Four experimentl diets sed on mize nd soyen mel were formulted to differ in CP nd BCAA contents (Tle 1). Piglets were ssigned rndomly into one of the four diets, including positive control (PC) diet, reduced-protein negtive control (NC) diet, test 1 (T1) diet nd test 2 (T2) diet with CP contents of 19 5, 16 7, 16 7 nd 17 2 %, respectively. The NC diet ws formulted without considering SID vline, leucine or isoleucine concentrtions, ut ws supplemented with 0 42 % Al (isonitrogenous mount), nd thus ws deficient in vline nd isoleucine compred with the recommendtion y the NRC (29). The T1 diet ws supplemented with 0 17 % isoleucine, 0 24 % leucine nd 0 16 % vline to provide SID AA equl to the levels in the PC diet. The T2 diet ws supplemented with 2-fold dose of ech BCAA in T1 diet. All diets were fortified with lysine, methionine, threonine nd tryptophn to stisfy the SID AA requirement s recommended y the NRC (29). One piglet from the PC group nd one from the NC group were excluded ecuse of deth due to cute respirtory disese during the period of grdul replcement of the strter diet. At the end of the experiment, six pigs were selected rndomly from ech group to e humnely euthnised y electricl stunning, coupled with exsnguintion fter 12 h of feed deprivtion. The hypothlmus ws extrcted from the rin within 5 10 min, nd susequently the hypothlmus smples were rpidly removed, wrpped in foil nd frozen in liquid N 2 to e stored t 80 C until nlyses. In Expt 2, twenty-one Lrge White Lndrce rrows wened t 28 d of ge were individully housed in metolism cges ( m) with d liitum ccess to wter nd were fed commercil diet for 3-d dpttion period. Susequently, the piglets were ssigned rndomly to one of the three groups in completely rndomised design sed on BW nd ncestry seven per group, including NC, T1 nd pir-fed T1 (P) groups. Grdul replcement of the strter diet y the experimentl diets lsted for 5 d. The experiment egn 9 d fter wening when the piglets otined men initil BW of 9 21 (SD 0 70) kg, nd were fed the experimentl diets, which lsted for 28 d. NC nd T1 diets were the sme s in Expt 1 (Tle 1). Piglets in the P group fed diet T1 were individully pir-fed with the piglets in the NC group s descried y Swmy et l. (30).In rief, piglets in the NC group hd free ccess to feed, wheres piglets in the P group were provided with the sme mount of feed consumed y the NC group piglets on the previous dy. Piglets were weighed individully t the eginning nd t the end of the experiment, nd the feed intke ws determined dily. One piglet from the NC group ws excluded ecuse of sudden deth due to unknown cuses t the eginning of week 1. At the end of the experiment, ll pigs were humnely Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

3 2238 L. Zheng et l. Tle 1. Composition of the experimentl diets (s-fed sis) Tretments* Items PC NC T1 T2 Ingredients (%) Mize (7 4 % CP) Soyen mel (42 2 % CP) Whey powder (4 0 % CP) Fishmel (62 2 % CP) Concentrted soyen protein (64 0 % CP) Soyen oil L-Lys HCl DL-Met L-Thr L-Trp L-Ile L-Leu L-Vl L-Al 0 42 Diclcium phosphte Limestone Slt Bentonite Premix Anlysed composition (%) CP Diethyl ether extrct Crude fire Lys Met + Cys Thr Trp Ile Leu Vl His Phe Arg Clculted SID AA concentrtion nd NE vlue (%) NE (MJ/kg) Totl C Aville P SID Lys SID Met + Cys SID Thr SID Trp SID Ile SID Leu SID Vl SID AA rtio (Met + Cys):Lys Thr:Lys Trp:Lys Ile:Lys Leu:Lys Vl:Lys PC, positive control; NC, reduced-protein negtive control; T1, test 1; T2, test 2; CP, crude protein; SID, stndrdised ilel digestile; AA, mino cids; NE, net energy; BCAA, rnched-chin AA; V, vitmin. * PC diet nd NC diet without considering SID Vl, Leu or Ile concentrtion; T1 diet ws formulted y dding 0 17 % Ile, 0 24 % Leu nd 0 16 % Vl to the NC diet to chieve the levels in the PC group. T2 diet ws supplemented with 2-fold dose of ech BCAA in the T1 diet. Provided per kg of diet (s-fed sis): VA, IU (4500 μg); VD 3, 1500 IU (37.5 μg); VE, 30 mg; VB 1,3 2 mg; VB 2, 8 mg; VB 6, 4 mg; VB 12,0 03 mg; VK 3, 3 2 mg; nicin, 34 mg; folte, 1 6 mg; pntothenic cid, 18 mg; iotin, 0 2 mg; choline chloride, 500 mg; Cu, 150 mg; Fe, 120 mg; Mn, 45 mg; Zn, 90 mg; I, 0 6 mg; Se, 0 3 mg; Co, 0 3 mg; chlortetrcycline, 35 mg; timulin 12 mg. Vlues for SID AA concentrtion nd NE were clculted ccording to the Ntionl Reserch Council (29). slughtered y electricl stunning, coupled with exsnguintion fter 12 h of feed deprivtion. In ll, twenty-three mjor skeletl muscles from the forequrter, midqurter nd hindqurter of the left crcss side were seprted entirely nd weighed (Tle 5). The longissimus dorsi (LD) muscle smples etween the 10th nd the lst ri on the right crcss side were rpidly removed, wrpped in foil nd frozen in liquid N 2 to e stored t 80 C until nlyses. Chemicl nlyses All diets were nlysed for DM, CP (N 6 25), diethyl ether extrct nd crude fire ccording to Assocition of Officil Anlyticl Chemists (31) procedures. Dietry AA contents were determined y ion-exchnge chromtogrphy using n Automtic Amino Acid Anlyzer (Hitchi L-8800 Amino Acid Anlyzer; Hitchi), nd tryptophn content ws nlysed with n Agilent 1200 HPLC (Agilent Technologies) system using C18 ( mm) column fter lkline hydrolysis t 110 C for 20 h s previously descried (32). Feed smples were hydrolysed in 6 N-HCl t 110 C for 24 h under reflux, wheres sulphur AA content ws mesured fter performic cid oxidtion efore cid hydrolysis. Quntittive PCR Tissue smples of the hypothlmus in Expt 1 were homogenised nd totl RNA (trna) ws isolted nd purified using TRIzol Regent (100 mg tissue/1 ml Trizol; Life Technologies) ccording to the specifictions of the mnufcturer. The integrity of RNA ws checked y 1 % grose gel electrophoresis stined with 1 μg/ml of ethidium romide. The RNA concentrtion nd qulity were determined using the Nnodrop 2000 spectrophotometer (NnoDrop Technologies). A smple of 2 μg oftrna ws reverse trnscried to synthesise complementry DNA (cdna) for rel-time PCR fter tretment with TURBO DNse (2 U/μl; Life Technologies) for 50 min t 37 C to remove contminting genomic DNA. The primers used for the rel-time PCR detection of selected genes re listed in Tle 2. Rel-time quntittive PCR nlyses were performed (CFX Connect TM Rel-time PCR Detection System; Bio-Rd) with totl volume of 10 μl contining 5 ng of cdna, 5 μl itq Universl SYBR Green Supermix (Bio-Rd) nd 0 3 μl of ech of forwrd nd reverse primers. The reltive qulifiction of gene expression for ech smple ws djusted with the control gene β-ctin using the 2 ΔΔCT method (33) nd normlised to the PC group. Western lotting The hypothlmus smples were used to detect the levels of p-mtor, mtor, p-riosoml protein S6 kinse 1 (S6K1), S6K1, p-eukryotic initition fctor 2α (eif2α) nd eif2α proteins. The skeletl muscle smples were used to detect the levels of p-mtor, mtor, p-s6k1 nd S6K1 proteins. The frozen tissues smples were powdered under liquid N 2, nd the powdered tissue (100 mg) ws dissolved in 1 ml protein lysis uffer contining 50 mm-tris-hcl (ph 7 4), 150 mm-ncl, 1 % Triton X-100, 1 % sodium deoxycholte, 0 1 % SDS nd Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

4 Brnched-chin mino cids improve pig growth 2239 Tle 2. Primers used for rel-time PCR nlysis Genes Accession no. Direction Sequences (5' 3') Size AgRP NM_ Forwrd CGTCGCTGCGTAAGGCT 99 GCAGAAGGCGTTGAAGAAA NPY NM_ Forwrd CGTACCCCTCCAAGCCCGACAAC 176 AACATTTTCCGTGCCTTCTCT POMC NM_ Forwrd TCCGAGAAGAGCCAGACG 126 GGCTTTGGGGTCGGCTTC MC4R NM_ Forwrd CCCAGAATCCATACTGTGT 130 TCTTTGAAGGTTTTCCTCAG CART NM_ Forwrd CCGCCCTGCTGCTGCTGCTAC 200 AGGGACTTGGCCATACTTCTTCTC AY Forwrd CCAGGTCATCACCATCGG 158 CCGTGTTGGCGTAGAGGT AgRP, gouti-relted peptide; NPY, co-express neuropeptide Y; POMC, pro-opiomelnocortin; MC4R, melnocortin-4 receptor; CART, cocine- nd mphetmine-regulted trnscript. Tle 3. Effect of supplementing rnched-chin mino cids (BCAA) to reduced-protein diets on growth performnce of piglets (Expt 1) (Men vlues with their pooled stndrd errors, n 6 7/group) Tretments* Items PC NC T1 T2 SEM P Initil BW (kg) Finl BW (kg) ADFI (g/d) Week Week Week Week Overll ADG (g/d) Week Week Week 3 419, Week 4 543, Overll G:F Week Week Week Week Overll 0 59, PC, positive control; NC, reduced-protein negtive control; T1, test 1; T2, test 2; BW, ody weight; ADFI, verge dily feed intke; ADG, verge dily gin; G:F, gin:feed intke; SID, stndrdised ilel digestile., Men vlues within row with unlike superscript letters were significntly different (P < 0 05). * PC diet nd NC diet without considering SID Vl, Leu or Ile concentrtions; T1 diet ws formulted y dding 0 17 % Ile, 0 24 % Leu nd 0 16 % Vl to the NC diet to chieve the levels in the PC group. T2 diet ws supplemented with 2-fold dose of ech BCAA in the T1 diet. 1 mm-phenylmethylsulphonyl fluoride plus 10 μl phosphtse inhiitors mixture (P1260; Applygen Technologies Inc.). After centrifugtion t g nd 4 C for 15 min, the protein concentrtion in the superntnt fluid ws determined y icinchoninic cid ssy (Beyotime Biotechnology) ccording to the mnufcturer s instructions. All the smples were djusted to n equl protein concentrtion nd then diluted with 5 loding uffer (1 25 ml of 1 M-Tris-HCl (ph 6 8), 2 5 ml glycerol, 0 5 g SDS, 0 25 ml β-mercptoethnol, 25 mg romophenol lue nd 1 ml wter to finl volume of 5 ml) to finl volume of 1 ml. The smples were oiled for 10 min nd cooled on ice Tle 4. Effect of supplementing rnched-chin mino cids (BCAA) to reduced-protein diets on growth performnce of piglets fed d liitum or t similr level in the group without supplementl BCAA (Expt 2) (Men vlues with their pooled stndrd errors, n 6 7/group) Tretments* Items NC T1 P SEM P Initil BW (kg) Finl BW (kg) ADFI (g/d) ADG (g/d) 288 c <0 001 G:F NC, reduced-protein negtive control; T1, test 1; P, pir-fed T1 group; BW, ody weight; ADFI, verge dily feed intke; ADG, verge dily gin; G:F, gin:feed intke; SID, stndrdised ilel digestile.,,c Men vlues within row with unlike superscript letters were significntly different (P < 0 05). * NC diet without considering SID Vl, Leu or Ile concentrtions; T1 = test 1 diet, which ws formulted y dding 0 17 % Ile, 0 24 % Leu nd 0 16 % Vl to the NC diet; P, pir-fed T1 group, in which piglets fed the T1 diet were provided with the sme mount of feed consumed y the NC group piglets. efore eing used for Western lot nlysis. Aliquots of smples (50 μg protein) were seprted y electrophoresis on 10 % (S6K1), 12 % (eif2α) or 8 % (mtor) SDS-PAGE, nd electrotrnsferred to poly vinylidene fluoride memrnes (Millipore). The memrnes were locked in 5 % ft-free milk in Tris-uffered sline contining 0 1 % Tween-20 (TBST) for 3 h nd then incuted with the following primry ntiodies t 4 C overnight with gentle rocking: nti-s6k1 (1:1000; Snt Cruz Biotechnology), nti-p-s6k1 (1:500; Affinity Biosciences), ntieif2α (1:500; Affinity Biosciences), nti-p-eif2α (1:1000; Cell Signling Technology), nti-mtor (1:1000; Cell Signling Technology), nti-p-mtor (1:1000; Cell Signling Technology) nd nti-β-ctin (1:1000; Snt Cruz Biotechnology). After eing wshed three times with TBST, the memrnes were incuted t room temperture for 3 h with horserdish peroxidse-linked secondry ntiodies diluted 1: in 1 % ovine serum lumin TBST. Finlly, the memrnes were wshed three times with TBST nd three times with TBS, followed y development using the SuperSignl West Pico Chemiluminescent Sustrte ccording to the mnufcturer s instructions (Pierce). Imges were quntified using the Gel Logic Pro 2200 system (Crestrem Moleculr Imging) nd Imge J softwre. Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

5 2240 L. Zheng et l. Tle 5. Effect of supplementing rnched-chin mino cids (BCAA) to reduced-protein diets on the solute skeletl muscle mss of piglets fed d liitum or t similr level in the group without supplementl BCAA (Expt 2) (Men vlues with their pooled stndrd errors, n 6 7/group) Tretments* Items NC T1 P SEM P Muscle mss in the forequrter (g) Trpezius Suprspintus Infrspintus Teres mjor Deltoids 16 1 c Suscpulris Tricepsrchii , Tensor fscie nterchii , Biceps Brchii Muscle mss in the midqurter (g) Ltissimus dorsi Pectorlis profundus , Longissimus dorsi c <0 001 Psos mjor Muscle mss in the hindqurter (g) Gluteus superficilis Gluteus medius Biceps femoris , Semitendinosus Sememrnosus Tensor fsci lte Grcilis Adductor Qudriceps femoris , NC, reduced-protein negtive control; T1, test 1; P, pir-fed T1 group; SID, stndrdised ilel digestile.,,c Men vlues within row with unlike superscript letters were significntly different (P < 0 05). * NC diet without considering SID Vl, Leu or Ile concentrtion; T1 ws formulted y dding 0 17 % Ile, 0 24 % Leu nd 0 16 % Vl to NC diet; P-fed T1 group, in which piglets fed the T1 diet were provided with the sme mount of feed consumed y the NC group piglets. Tle 6. Effect of supplementing rnched-chin mino cids (BCAA) to reduced-protein diets on reltive skeletl muscle mss of piglets fed d liitum or t similr level in the group without supplementl BCAA (Expt 2) (Men vlues with their pooled stndrd errors, n 6 7/group) Tretments* Items NC T1 P SEM P Reltive muscle mss in the forequrter (%) Trpezius , Suprspintus Infrspintus Teres mjor Deltoids Suscpulris Tricepsrchii Tensor fscie nterchii Biceps Brchii Reltive muscle mss in the midqurter (%) Ltissimus dorsi , Pectorlis profundus , Longissimus dorsi Psos mjor Reltive muscle mss in the hindqurter (%) Gluteus superficilis Gluteus medius Biceps femoris , Semitendinosus Sememrnosus Tensor fsci lte Grcilis Adductor Qudriceps femoris NC, reduced-protein negtive control; T1, test 1; P, pir-fed T1 group; SID, stndrdised ilel digestile., Men vlues within row with unlike superscript letters were significntly different (P < 0 05). * NC diet without considering SID Vl, Leu or Ile concentrtions; T1 ws formulted y dding 0 17 % Ile, 0 24 % Leu nd 0 16 % Vl to NC diet; P-fed T1 group, in which piglets fed T1 diet were provided with the sme mount of feed consumed y NC group piglets. Reltive muscle mss is expressed s percentge of the ody weight. Sttisticl nlyses For ll dt nlyses, the individul piglet ws used s the experimentl unit. The dt were nlysed y ANOVA ccording to rndomised complete lock design using generl liner model procedures. Significnt ANOVA effects were further exmined using Duncn s multiple rnge test. Simple liner nd qudrtic reltionships etween feed intke nd hypothlmic ppetite regultory gene expressions were determined using regression procedures. All nlyses were performed using SAS 8.0. Results re presented s mens with their stndrd errors. Proilities <0 05 were considered s significnt. No differences in piglet growth were detected mong PC, T1 nd T2 groups, ut finl BW, ADG for ll experimentl periods, G:F during week 1 nd overll G:F were higher (P < 0 05) in T1 nd T2 groups compred with the NC group. Interestingly, verge dily feed intke (ADFI) for ll experimentl periods ws decresed (P < 0 05) in the NC group, wheres in T1 nd T2 groups it ws restored to the levels of the PC group. Thus, we conducted pir-feeding experiment (Expt 2) to ensure similr feed intke mong piglets etween NC nd P groups. In Expt 2, ADFI ws higher (P < 0 05) in the T1 group thn in the NC group, which is consistent with the results of Expt 1. T1 nd P groups hd significntly higher (P < 0 05) ADG nd G:F compred with the NC group (Tle 4). Results Growth performnce The growth performnce of piglets in Expt 1 is presented in Tle 3. Compred with the PC group, the NC group showed decrese (P < 0 05) in finl BW, verge dily gin (ADG) during weeks 1 2, overll ADG (d 0 28) nd gin:feed intke (G:F) during week 1. Skeletl muscle mss In totl, twenty-three mjor skeletl muscles of piglets in NC, T1 nd P groups were seprted entirely nd weighed in Expt 2. The results showed tht the solute (Tle 5) nd reltive (expressed s percentge of the BW) (Tle 6) weights of skeletl muscles in piglets were ffected y the tretments. Compred with the NC group, the solute weights of most Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

6 Brnched-chin mino cids improve pig growth 2241 muscles in the forequrter nd midqurter were enhnced (P < 0 05) in the T1 group, except for infrspintus, teres mjor, rchii nd psos mjor muscles. Moreover, the solute weights of three muscles with lrge mss (iceps femoris, semitendinosus nd qudriceps femoris muscles) in the hindqurter were lso incresed (P < 0 05) in the T1 group. When the piglets were provided with the sme mount of feed, the P group hd incresed (P < 0 05) weights of LD, trpezius, suprspintus, deltoids nd ltissimus dorsi muscles compred with the NC group, prticulrly LD muscle. The P group showed higher (P < 0 05) reltive weights of trpezius, deltoids, ltissimus dorsi, pectorlis profundus, LD nd iceps femoris muscles compred with the NC group. The reltive weights of these muscles in the T1 group were intermedite etween those in the other two groups, ut only two muscles (deltoids nd LD) showed sttisticlly different weights (P < 0 05) compred with the NC group. There were no differences in the reltive weights of other muscles mong ll the three groups. decresed (P < 0 05) with n increse in MC4R mrna levels (Fig. 2()), wheres there were no significnt qudrtic or liner reltionships etween ADFI nd the mrna levels of Agrp nd CART (dt not shown). Protein undnce of generl mino cids control signlling pthwy in the hypothlmus Stimultion of the GAAC pthwy in the hypothlmus hs een shown to inhiit feed intke of nimls. We detected the undnce of phosphorylted nd totl eif2α protein in the hypothlmus in Expt 1 y Western lotting. Compred with the PC group, the NC group hd incresed (P < 0 05) undnce of phosphorylted eif2α protein (expressed s rtio to totl eif2α or β-ctin), which ws restored to the tht of the PC group in T1 nd T2 groups (Fig. 3). The chnges in the undnce of phosphorylted eif2α protein were opposite to the chnges in feed intke. However, there ws no difference in the undnce of totl eif2α protein mong the four groups. mrna expressions of ppetite regultory genes in the hypothlmus Agrp nd NPY re clssified s orexigenic genes, ut POMC, MC4R nd CART re clssified s norexigenic genes. We detected the mrna expressions of these ppetite regultory genes in the hypothlmus in Expt 1, nd the results re shown in Fig. 1. Hypothlmic Agrp nd NPY mrna levels were higher (P < 0 05) in the T2 group compred with the NC group (Fig. 1(A)), wheres MC4R mrna level in the T2 group nd CART mrna level in the T1 group were lower (P < 0 05) compred with the NC group (Fig. 1(B)). However, POMC mrna level showed no differences mong the four groups. Interestingly, there were no differences in hypothlmic Agrp, NPY, MC4R nd CART mrna levels mong T1, T2 nd PC groups, except for the higher (P < 0 05) NPY mrna level in the T2 group compred with the PC group. Further regression nlysis showed tht ADFI ws positively (P < 0 05) ssocited with NPY mrna levels rnging from 0 32 to 2 94, wheres it ws not ffected y further increse in NPY mrna levels (Fig. 2()). ADFI linerly Protein undnce of mmmlin trget of rpmycin signlling pthwy in the hypothlmus The protein undnce of mtor signlling pthwy in the hypothlmus in Expt 1 is shown in Fig. 4. The undnce of totl S6K1 nd mtor proteins ws not different mong the four groups. However, compred with the NC group, PC, T1 nd T2 groups hd enhnced (P < 0 05) undnce of phosphorylted S6K1 protein (expressed s rtio to totl S6K1 or β-ctin) (Fig. 4(A)). Moreover, the mount of phosphorylted mtor protein (expressed s rtio to totl mtor) ws higher in the T1 group (P < 0 05) thn in the NC group (Fig. 4(B)). There were no differences in the undnce of phosphorylted S6K1 nd mtor proteins mong PC, T1 nd T2 groups. Protein undnce of mmmlin trget of rpmycin signlling pthwy in longissimus dorsi muscle In Expt 2, compred with T1 nd P groups, the NC group hd reduced (P < 0 05) undnce of phosphorylted S6K1 (A) mrna reltive expression , Orexigenic genes,, (B) mrna reltive expression 0 AgRP NPY POMC MC4R CART Anorectic genes,, Fig. 1. mrna levels of (A) orexigenic genes (gouti-relted peptide (AgRP) nd co-express neuropeptide Y (NPY)) nd (B) norectic genes (pro-opiomelnocortin (POMC), melnocortin-4 receptor (MC4R) nd cocine- nd mphetmine-regulted trnscript (CART)) in the hypothlmus of piglets fed positive control (PC, ) diet, reduced-protein negtive control (NC, ) diet or two NC diets supplemented with 1- or 2-fold dose of BCAA (test 1 ( ) nd test 2 ( ), respectively) in Expt 1. Vlues were normlised using β-ctin s n internl control. Dt re expressed reltive to expression in the PC group; vlues re mens (n 4 6/group), with their stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P < 0 05). Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

7 2242 L. Zheng et l. () () ADFI (g/d) ADFI (g/d) NPY mrna expression MC4R mrna expression Fig. 2. Regression reltionships etween verge dily feed intke (ADFI) in week 4 nd the mrna levels of () co-express neuropeptide Y (NPY) (y = 7 84x x ; R ; P = 0 02) nd () melnocortin-4 receptor (MC4R) (y = 98 59x ; R ; P = 0 02) genes in the hypothlmus of piglets. Protein reltive expression PC (Fig. 5(A)) nd mtor (Fig. 5(B)) proteins in LD muscle, wheres no differences were detected etween T1 nd P groups. Besides, the undnce of totl S6K1 nd mtor proteins ws not different mong the three groups. Discussion NC T1 The results of the present study showed tht reducing CP content from 19 5 to 16 7 % without lncing the BCAA levels impired piglet growth, which ws restored to the level of the PC group fter supplementtion with BCAA. However, the reduced-protein diet supplemented with 2-fold dose of ech BCAA did not further increse piglet growth. The positive effect eif2α/β-ctin p-eif2α/β-ctin p-eif2α/eif2α T2 p-eif2α(ser51) eif2α Fig. 3. Aundnce of phosphorylted nd totl eukryotic trnsltion initition fctor 2α (eif2α) protein in the hypothlmus of piglets fed positive control (PC, ) diet, reduced-protein negtive control (NC, ) diet or two NC diets supplemented with 1- or 2-fold dose of BCAA (test 1 ( ) nd test 2 ( ), respectively) in Expt 1. Western lotting method ws used. Vlues were normlised using β-ctin or reltive totl protein s n internl control. Dt re expressed reltive to expressions in the PC group; vlues re mens (n 4 6/ group), with their stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P < 0 05). of dietry BCAA supplementtion on growth of piglets fed reduced-protein diets ws lso previously oserved (11). A novel nd importnt finding of this study is tht the incresed feed intke of piglets is ssocited with the enhnced mtor nd reduced GAAC pthwy ctivities in the hypothlmus fter BCAA supplementtion. Furthermore, we lso indicte tht BCAA my ct s signlling molecules to increse locl mtor pthwy ctivity, which is independent of chnge in feed intke, nd thus might prtly contriute to the elevted muscle mss fter the supplementtion of BCAA to the reducedprotein diet. Dietry rnched-chin mino cids supplementtion increses feed intke of piglets fed reduced-protein diets There re growing evidences showing tht mny species re le to sense dietry AA imlnce nd respond to it y reducing feed intke (26). In growing pigs, the suppressive effect on growth fter vline- or tryptophn-deficiency tretment is minly ssocited with reduction in feed intke (14 16,34). Recent studies with mice hve shown tht dietry deficiency in isoleucine, vline nd leucine cuses the most drmtic decrese in feed intke (17). In this study, we reported tht the deficiency of vline nd isoleucine in diet (NC group) for 4 weeks reduced the feed intke of piglets, which ws restored to the level of the PC group fter dietry supplementtion with BCAA (Tles 3 nd 4). In contrst, intrcereroventriculr dministrtion of leucine inhiited feed intke (25,35). This prdoxicl effect of leucine on feed intke is likely due to n extremely higher tretment level thn the level under physiologicl conditions, which my led to n imlnce mong BCAA in the rin. Noteworthily, dietry BCAA imlnce (deficiency of vline nd excess supply of leucine) results in susequent reduction of feed intke in pigs (14 16,18). There hve een numer of specultions out the mechnism responsile for the effect of dietry AA imlnce on the inhiition of feed intke in nimls. In mice nd rts, n AA imlnce is detected y the APC nd the hypothlmus to inhiit feed intke (27,36,37).AAdeficiency stimultes the GAAC pthwy vi n ccumultion of its unchrged trna, which induces phosphoryltion of eif2α vi the generl control Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

8 Brnched-chin mino cids improve pig growth 2243 (A) PC NC T1 T2 p-s6k1(t389) (B) PC NC T1 T2 p-mtor(s2448) S6K1 mtor Protein reltive expression S6K1/β-ctin p-s6k1/β-ctin p-s6k1/s6k1 mtor/ β-ctin Protein reltive expression p-mtor/ β-ctin,, p-mtor/ mtor Fig. 4. Aundnce of phosphorylted nd totl (A) riosoml protein S6 kinse 1 (S6K1) nd (B) mmmlin trget of rpmycin (mtor) proteins in the hypothlmus of piglets fed positive control (PC, ) diet, reduced-protein negtive control (NC, ) diet or two NC diets supplemented with 1- or 2-fold dose of BCAA (test 1 ( ) nd test 2 ( ), respectively) in Expt 1. Western lotting method ws used. Vlues were normlised using β-ctin or reltive totl protein s n internl control. Dt re expressed reltive to expressions in the PC group; vlues re mens (n 4 6/group), with their stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P < 0 05). (A) NC T1 P (B) NC T1 P p-s6k1(t389) p-mtor (S2448) S6K1 mtor Protein reltive expression S6K1/β-ctin p-s6k1/ p-s6k1/s6k1 mtor/ Protein reltive expression p-mtor/ p-mtor/ mtor Fig. 5. Aundnce of phosphorylted nd totl (A) riosoml protein S6 kinse 1 (S6K1) nd (B) mmmlin trget of rpmycin (mtor) proteins in longissimus dorsi muscle of piglets in reduced-protein negtive control (NC, ) group, NC group supplemented with 1-fold dose of BCAA (test 1(T1, ) or pir-fed T1 (P) ( ) group in Expt 2. Piglets in P group were fed the sme mount of T1 diet s the NC group piglets. Western lotting method ws used. Vlues were normlised using β-ctin or reltive totl protein s n internl control. Dt re expressed reltive to expressions in the NC group; vlues re mens (n 4 6/group), with their stndrd errors represented y verticl rs., Men vlues with unlike letters were significntly different (P < 0 05). nonderepressile kinse 2 (GCN2). In ddition, mtor is cellulr fuel nd AA sensor (leucine prticulrly), whose hypothlmic ctivity is directly relted to the regultion of feed intke. A previous study showed tht intrcereroventriculr dministrtion of leucine decresed the feed intke of rts y stimulting the mtor pthwy ctivity (25). In contrst, centrl ghrelin dministrtion promoted feed intke y stimulting hypothlmic mtor pthwy ctivity (38). Further studies re needed to explin this seemingly prdoxicl role of hypothlmic mtor. However, the roles of hypothlmic GAAC nd mtor signlling pthwys, which re involved in the feed intke regultion y dietry AA, hve not een identified in pigs. In our study, we reported for the first time tht the increse in feed intke of piglets fter dietry BCAA supplementtion is relted to the elevtion/reduction of hypothlmic mtor/gaac pthwy ctivity, which supports the specultion tht the mtor or GAAC pthwy my ply n importnt role in the positive effect of BCAA on the feed intke of piglets. Moreover, the expressions of hypothlmic ppetite regultory genes (Agrp nd NPY) tht stimulte feed intke were up-regulted, ut tht of the genes inhiiting feed intke (MC4R nd CART) were down-regulted fter dietry BCAA supplementtion (Fig. 1). Further ssessment of the correltion etween feed intke nd expression of these ppetite regultory genes (Fig. 2) indictes tht the expressions of NPY nd MC4R genes pper to e more responsive to BCAA supplementtion compred with the other two genes. In ddition, it hs een demonstrted tht hypothlmic mtor plys n importnt role in regulting the expressions of ppetite regultory genes (25,38). Morrison et l. (39) suggested tht AA cn ct within the rin to inhiit Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

9 2244 L. Zheng et l. feed intke of rts nd tht the direct mtor-dependent inhiition of Agrp gene expression my contriute to this effect. These oservtions indicte tht mtor or GAAC my function s n AA sensor to regulte the expressions of hypothlmic ppetite regultory genes nd feed intke in piglets. However, dietry supplementtion with 2-fold dose of ech BCAA in the present study did not further increse the feed intke of piglets (Tle 3). As no chnges in hypothlmic GAAC nd mtor pthwy ctivities were oserved etween T1 nd T2 groups (Fig. 3 & 4), it is possile tht supplementing 1-fold dose of BCAA to the reduced-protein diet is sufficient to ctivte these hypothlmic ppetite regultory signlling pthwys. Dietry rnched-chin mino cids supplementtion increses muscle growth of piglets fed reduced-protein diets Skeletl muscle ccounts for pproximtely 50 % of the ody mss. In the present study, the solute weights of nerly hlf of the muscles (Tle 5) nd reltive weights of some muscles (Tle 6) were greter in oth BCAA-supplemented T1 nd P groups compred with the NC group. The incresed muscle growth in response to BCAA supplementtion my e due to, t lest in prt, the ctivtion of trnsltion initition fctors, which is supported y the stimultion of mtor signlling pthwy ctivity in LD muscle, independent of chnge in feed intke fter dietry BCAA supplementtion oserved in the present study (Fig. 5). mtor hs een known to stimulte the ctivtion of trnsltion initition fctors induced y AA (40,41). The effect of triggering the ctivtion of trnsltion initition fctors ppers to e unique to BCAA, especilly leucine, oth in vivo (23,24) nd in intro (42,43). It hs een shown tht supplementing excess leucine to reduced-protein diets increses the muscle protein synthesis of piglets y ctivting the mtor signlling pthwy to stimulte trnsltion initition (20 22). On the other hnd, even though BCAA-supplemented T1 nd P groups hd similr musculr mtor ctivity, the solute weight of LD muscle in the P group did not rech the level of the T1 group (Tle 5). Interestingly, previous study hs reported tht protein synthesis in skeletl muscle ws not stimulted y infusion of leucine for 2 h despite the continuous ctivtion of trnsltion initition signls (23). These results indicte tht stimultion of muscle protein synthesis needs oth the vilility of sufficient sustrtes for synthesis nd the ctivtion of trnsltion initition fctors. In conclusion, the present study shows tht supplementing BCAA to reduced-protein diets cn increse growth performnce of piglets, nd the increse in feed intke nd direct skeletl muscle growth-promoting effect contriute to this improvement. Our results for the first time indicte the possile importnt role of hypothlmic GAAC or mtor pthwy in the feed intke regultion of piglets fter dietry BCAA supplementtion. The muscle growth-promoting effect induced y BCAA supplementtion my e medited y the mtor signlling pthwy. However, supplementing 2-fold dose of ech BCAA to the reduced-protein diet in the present study did not further increse growth performnce. Thus, further studies re needed to revel the pproprite dose of ech BCAA to e supplemented to the reduced-protein diet for mximum growth in piglets. Acknowledgements The uthors re grteful for English revision from Z. Liu. This study ws jointly supported y the Ntionl Bsic Reserch Progrmme of Chin (no. 2013CB127305), the Nturl Science Foundtion of Huei Province of Chin (no. 2013CFA010) nd the Fundmentl Reserch Funds for the Centrl Universities (no. 2013PY047). The uthors contriutions re s follows: J. Peng, L. Z. nd H. W. designed the reserch; L. Z., C. C., Q. X nd J. Png conducted the reserch; L. Z. nlysed the dt; L. Z., H. W. nd J. Peng wrote the mnuscript. The uthors hve no conflicts of interest to declre. References 1. McCrcken BA, Gskins HR, Ruwe-Kiser PJ, et l. (1995) Diet-dependent nd diet-independent metolic responses underlie growth stsis of pigs t wening. J Nutr 125, Brown DC, Mxwell CV, Erf GF, et l. (2006) The influence of different mngement systems nd ge on intestinl morphology, immune cell numers nd mucin production from golet cells in post-wening pigs. Vet Immunol Immunopthol 111, Rose N, Lrour G, Le Diguerher G, et l. (2003) Risk fctors for porcine post-wening multisystemic wsting syndrome (PMWS) in 149 French frrow-to-finish herds. Prev Vet Med 61, Nychoti CM, Omogenigun FO, Rdemcher M, et l. (2006) Performnce responses nd indictors of gstrointestinl helth in erly-wened pigs fed low-protein mino cidsupplemented diets. J Anim Sci 84, Oppeju FO, Kruse DO, Pyne RL, et l. (2009) Effect of dietry protein level on growth performnce, indictors of enteric helth, nd gstrointestinl microil ecology of wened pigs induced with postwening colicillosis. J Anim Sci 87, Kong X, Wu G, Lio Y, et l. (2007) Effects of Chinese herl ultr-fine powder s dietry dditive on growth performnce, serum metolites nd intestinl helth in erlywened piglets. Livest Sci 108, Heo JM, Oppeju FO, Pluske JR, et l. (2013) Gstrointestinl helth nd function in wened pigs: review of feeding strtegies to control post-wening dirrhoe without using in-feed ntimicroil compounds. J Anim Physiol Anim Nutr (Berl) 97, Rist V, Weiss E, Eklund M, et l. (2013) Impct of dietry protein on microiot composition nd ctivity in the gstrointestinl trct of piglets in reltion to gut helth: review. Animl 7, Ntionl Reserch Council (1998) Nutrient Requirements of Swine, 10th rev. ed. Wshington, DC: The Ntionl Acdemies Press. 10. Lordelo M, Gspr A, Le Bellego L, et l. (2008) Isoleucine nd vline supplementtion of low-protein corn-whet-soyen mel-sed diet for piglets: growth performnce nd nitrogen lnce. J Anim Sci 86, Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t

10 Brnched-chin mino cids improve pig growth Zhng S, Qio S, Ren M, et l. (2013) Supplementtion with rnched-chin mino cids to low-protein diet regultes intestinl expression of mino cid nd peptide trnsporters in wenling pigs. Amino Acids 45, Le Bellego L & Nolet J (2002) Performnce nd utiliztion of dietry energy nd mino cids in piglets fed low protein diets. Livest Prod Sci 76, Nørgrd JV & Fernández JA (2009) Isoleucine nd vline supplementtion of crude protein-reduced diets for pigs ged 5-8 weeks. Anim Feed Sci Tech 154, Gloguen M, Le Floc h N, Brossrd L, et l. (2011) Response of piglets to the vline content in diet in comintion with the supply of other rnched-chin mino cids. Animl 5, Gloguen M, Le Floc h N, Corrent E, et l. (2012) Providing diet deficient in vline ut with excess leucine results in rpid decrese in feed intke nd modifies the postprndil plsm mino cid nd lph-keto cid concentrtions in pigs. J Anim Sci 90, Gloguen M, Le Floc h N, Corrent E, et l. (2013) Mel ptterns in reltion to the supply of rnched-chin mino cids in pigs. J Anim Sci 91, Kmt S, Ymmoto J, Kmijo K, et l. (2014) Dietry deprivtion of ech essentil mino cid induces differentil systemic dptive responses in mice. Mol Nutr Food Res 58, Wiltfsky MK, Pfffl MW & Roth FX (2010) The effects of rnched-chin mino cid interctions on growth performnce, lood metolites, enzyme kinetics nd trnscriptomics in wened pigs. Br J Nutr 103, Soumeh EA, vn Milgen J, Sloth NM, et l. (2015) The optimum rtio of stndrdized ilel digestile leucine to lysine for 8 to 12 kg femle pigs. J Anim Sci 93, Yin Y, Yo K, Liu Z, et l. (2010) Supplementing L-leucine to low-protein diet increses tissue protein synthesis in wenling pigs. Amino Acids 39, Murgs Torrzz R, Surywn A, Gzzneo MC, et l. (2010) Leucine supplementtion of low-protein mel increses skeletl muscle nd viscerl tissue protein synthesis in neontl pigs y stimulting mtor-dependent trnsltion initition. J Nutr 140, Surywn A, Torrzz RM, Gzzneo MC, et l. (2012) Enterl leucine supplementtion increses protein synthesis in skeletl nd crdic muscles nd viscerl tissues of neontl pigs through mtorc1-dependent pthwys. Peditr Res 71, Escor J, Frnk JW, Surywn A, et l. (2005) Physiologicl rise in plsm leucine stimultes muscle protein synthesis in neontl pigs y enhncing trnsltion initition fctor ctivtion. Am J Physiol Endocrinol Met 288, E914 E Escor J, Frnk JW, Surywn A, et l. (2006) Regultion of crdic nd skeletl muscle protein synthesis y individul rnched-chin mino cids in neontl pigs. Am J Physiol Endocrinol Met 290, E612 E Cot D, Proulx K, Smith KAB, et l. (2006) Hypothlmic mtor signling regultes food intke. Science 312, Gietzen DW, Ho S & Anthony TG (2007) Mechnisms of food intke repression in indispensle mino cid deficiency. Annu Rev Nutr 27, Murin A-C, Benni A, Lorsignol A, et l. (2014) Hypothlmic eif2α signling regultes food intke. Cell Rep 6, Morton G, Cummings D, Bskin D, et l. (2006) Centrl nervous system control of food intke nd ody weight. Nture 443, Ntionl Reserch Council (2012) Nutrient Requirements of Swine, 11th rev. ed. Wshington, DC: The Ntionl Acdemies Press. 30. Swmy H, Smith T & McDonld E (2004) Effects of feeding lends of grins nturlly contminted with mycotoxins on rin regionl neurochemistry of strter pigs nd roiler chickens. J Anim Sci 82, Assocition of Officil Anlyticl Chemists (2003) Officil Methods of Anlysis, 17th rev. ed. Arlington, VA: AOAC. 32. Wng X, Wei H, Co J, et l. (2015) Metolomics nlysis of muscle from piglets fed low protein diets supplemented with rnched chin mino cids using HPLC-high resolution MS. Electrophoresis 36, Livk KJ & Schmittgen TD (2001) Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the 2 ΔΔCT method. Methods 25, Ettle T & Roth F (2004) Specific dietry selection for tryptophn y the piglet. J Anim Sci 82, Blouet C, Jo YH, Li X, et l. (2009) Mediosl hypothlmic leucine sensing regultes food intke through ctivtion of hypothlmus-rinstem circuit. J Neurosci 29, Murin A-C, Jousse C, Averous J, et l. (2005) The GCN2 kinse ises feeding ehvior to mintin mino cid homeostsis in omnivores. Cell Met 1, Ho S, Shrp JW, Ross-Int CM, et l. (2005) Unchrged trna nd sensing of mino cid deficiency in mmmlin piriform cortex. Science 307, Mrtins L, Fernández-Mllo D, Novelle MG, et l. (2012) Hypothlmic mtor signling medites the orexigenic ction of ghrelin. PLOS ONE 7, e Morrison CD, Xi X, White CL, et l. (2007) Amino cids inhiit Agrp gene expression vi n mtor-dependent mechnism. Am J Physiol Endocrinol Met 293, E165 E Meijer AJ & Duelhuis PF (2004) Amino cid signlling nd the integrtion of metolism. Biochem Biophys Res Commun 313, Columus DA, Fiorotto ML & Dvis TA (2015) Leucine is mjor regultor of muscle protein synthesis in neontes. Amino Acids 47, Atherton PJ, Smith K, Etheridge T, et l. (2010) Distinct nolic signlling responses to mino cids in C2C12 skeletl muscle cells. Amino Acids 38, Hr K, Yonezw K, Weng Q-P, et l. (1998) Amino cid sufficiency nd mtor regulte p70 S6 kinse nd eif-4e BP1 through common effector mechnism. J Biol Chem 273, Downloded from IP ddress: , on 13 Jun 2018 t 13:57:08, suject to the Cmridge Core terms of use, ville t