Resolvin E1 reduces hepatic fibrosis in mice with Schistosoma japonicum infection

Size: px

Start display at page:

Download "Resolvin E1 reduces hepatic fibrosis in mice with Schistosoma japonicum infection"

Theresa Freeman
5 years ago
Views:

1 EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: , 2014 Resolvin E1 reduces heptic fibrosis in mice with Schistosom jponicum infection WENHONG QIU 1*, KAIWEN GUO 2*, LUYANG YI 1, YELI GONG 1, LIXIA HUANG 1 nd WEI ZHONG 1 1 Deprtment of Immunology, School of Medicine, Jinghn University, Wuhn, Hubei ; 2 Deprtment of Immunology, Wuhn University of Science nd Technology, Wuhn, Hubei , P.R. Chin Received August 24, 2013; Accepted Februry 10, 2014 DOI: /etm Abstrct. The im of this study ws to investigte whether resolvin E1 (RvE1) protects ginst heptic fibrosis in murine model of liver fibrosis induced by Schistosom jponicum infection. A totl of 30 pthogen free Kunming mice were rndomly nd eqully divided into three groups: Control (uninfected, untreted), model (infected, untreted) nd RvE1 intervention (infected, RvE1 treted; 100 ng dily). The mice were infected with Schistosom jponicum by inoculting the bdominl skin with 20±2 cercrie to induce models of liver fibrosis. The re nd numbers of the grnuloms in the livers were ssessed through histopthology fter 70 dys of tretment. The levels of tumor necrosis fctor (TNF) α nd interferon (IFN) γ were evluted in the serum by enzyme linked immu nosorbent ssy (ELISA). The expression levels of TNF α were detected in the heptic tissue by reverse trnscription polymerse chin rection nd western blot nlysis. The ctivity levels of lnine minotrnsferse nd sprtte minotrnsferse were determined in the serum by ELISA. The expression levels of lminin (LN), hyluronic cid (HA), procollgen type III (PC III) nd type IV collgen (IV C) were detected in the serum by rdioimmunossys. The results reveled tht the men re of the grnuloms ws smller in the RvE1 intervention group compred with tht in the model group. Following RvE1 tretment, the serum levels of TNF α were lower thn those in the model group, while the serum levels of IFN γ were higher compred with those in the model group. The expression levels of TNF α were lower in the Correspondence to: Dr Wenhong Qiu, Deprtment of Immunology, School of Medicine, Jinghn University, 8 Xuefu Rod, Wuhn, Hubei , P.R. Chin E mil: qiuwenhong@hotmil.com Dr Kiwen Guo, Deprtment of Immunology, Wuhn University of Science nd Technology, 947 Heping Rod, Wuhn, Hubei , P.R. Chin E mil: guowendy@hotmil.com * Contributed eqully Key words: resolvin E1, heptic fibrosis, nti inflmmtory, immune djustment, infection, Schistosom jponicum heptic tissue following RvE1 tretment compred with those in the model group. The indictors of liver fibrosis, the levels of LN, HA, PC III nd IV C in the serum, were lower following RvE1 tretment thn those in the model group. In conclusion, RvE1 tretment my reduce the growth of grnuloms, thereby slowing the process of heptic fibrosis, nd this effect my be the result of nti inflmmtory nd immune system djustment. Introduction Schistosomisis is type of zoonotic prsitic disese tht is distributed globlly nd cuses serious hrm to humn helth (1). Schistosom jponicum is minly endemic to Chin, Indonesi nd the Philippines nd is significnt public helth problem in Chin (2). The min pthologicl chnges cused by Schistosom jponicum infection re the formtion of grnuloms nd heptic fibrosis (3). Heptic fibrosis is the principl cuse of serious complictions nd mortlity due to Schistosom jponicum infection (4). Heptic fibrosis is compenstory response tht is secondry to the process of tissue repir following liver inflmmtion or dmge cused by Schistosom jponicum infection (5). The lck of n endogenous nti inflmmtory nd pro resolving meditor leds to persistent inflmmtion nd cuses liver fibrosis (6). Resolvin E1 (RvE1) is potent nti inflmmtory nd pro resolving member of the E series resolvins produced from eicospentenoic cid (EPA) (7). In the present study, the effects of RvE1 on liver fibrosis in schistosome infected mice were investigted. Mterils nd methods Experimentl nimls. A totl of 30 femle Kunming mice (pthogen free), six weeks old nd weighing 22±2 g, were purchsed from the Jinghn University Animl House (Wuhn, Chin). The mice were rndomized into three groups, with 10 mice per group: Control, model nd RvE1 intervention. The model nd RvE1 intervention groups were infected with schistosome cercrie through the bdominl skin (20±2 cercrie per mouse). The control mice were not infected. The mice in the RvE1 intervention group were dministered 100 ng RvE1 dily, from the dy of infection. The RvE1 ws dissolved in 2 ml norml sline nd dministered intrgs triclly. The mice in the control nd model groups received n equivlent volume of norml sline by intrgstric dminis trtion. Tretment occurred

1482 QIU et l: RESOLVIN E1 REDUCES HEPATIC FIBROSIS every dy for 70 dys. Subsequently, ll mice were scrificed for nlysis. Blood smples were collected by retro orbitl bleeding.

2 1482 QIU et l: RESOLVIN E1 REDUCES HEPATIC FIBROSIS every dy for 70 dys. Subsequently, ll mice were scrificed for nlysis. Blood smples were collected by retro orbitl bleeding. Following opening up of the bdomen, the whole livers were removed. The heptic middle lobules were hrvested nd the remining liver tissue ws cryopre served for the subsequent experiments. Snils infected with schistosome cercrie were obtined from the Hubei Institute of Prsitic Diseses (Wuhn, Chin), nd the surgicl instruments nd equipment were from the Jinghn University Animl Center. The present study ws pproved by the Medicl Ethics Committee of medicl college of Jinghn University (Wuhn, Chin). Mesurement of the serum tumor necrosis fctor (TNF) α, interferon (IFN) γ, lnine minotrnsferse (ALT) nd sprtte minotrnsferse (AST) levels. Serum smples from the individul mice were collected prior to when the mice were scrificed. The TNF α nd IFN γ levels were mesured using ELISA kits (R&D Systems, Minnepolis, MN, USA). Liver injury ws ssessed by mesuring the serum levels of the liver ssocited enzymes ALT nd AST using commercilly vilble kits (Shnghi Rongsheng Biotech Co. Ltd., Shnghi, Chin). Liver tissue homogentes. The liver tissue ws thwed nd rinsed, then cut into sections. The tissue (0.2 g) ws plced into 10 ml beker. A volume of homogente solution (0.1 mm Tris HCl, 0.01 mm EDTA 2N, 0.01 mm sucrose nd 0.8% NCl) nine fold (w:v = 1:4) the mount of the tissue ws dded. The liver ws processed with homogenizer for 6 8 min in order to fully homogenize the sections. The smples were centrifuged t 3,000 x g t 4 C for min. Approprite mounts of cler superntnt liquid were used for the protein detection. Lminin (LN), hyluronic cid (HA), procollgen type Ⅲ (PC III) nd type Ⅳ collgen (IV C) detection. The LN, HA, PC III nd IV C concentrtions in the serum smples were detected by rdioimmunossys conducted ccording to the instructions provided with the ssy kits. LN, HA, PC III nd IV C ssy kits were provided by Tinjin Atomic Energy Industry (Tinjin, Chin). RNA extrction nd reverse trnscription polymerse chin rection (RT PCR). The totl RNA of the liver tissues ws extrcted with TRIzol regent (Invitrogen Life Technologies, Crlsbd, CA, USA). Two microgrms of the totl RNA ws used for ech reverse trnscription rection for cdna synthesis. Quntittive PCR ws performed using sequence detector (ABI Prism StepOnePlus; Applied Biosystems, Foster City, CA, USA) nd SYBR Premix Ex Tq [Tkr Biotechnology (Dlin) Co., Ltd., Dlin, Chin] ccording to the mnufcturer's instructions. PCR ws performed using the following primers for TNF α: 5' TGAGCACTGAAAGCATGATCC 3' nd 5' ATCACTCCAAAGTGCAGCAG 3'. A housekeeping gene encoding β non muscle ctin ws used s normliztion control. The sequencing involved therml cycling t 95 C for 1 min (denturtion), 50 C for 1 min (nneling) nd 72 C for 1 min (extension). The products were evluted by grose gel electrophoresis nd nlyzed using the ChemiDoc MP imging system (Bio Rd, Hercules, CA, USA). Tble I. Grnulom numbers nd re in niml models of Schistosom jponicum untreted or treted with RvE1 (n=10 per group). Men no. of Men re of Group grnuloms grnulom (mm 2 ) Control 0.0± ±0.00 Model 11.94± ±3.51 RvE ± ±4.38,b F-vlue P vlue P<0.05 vs. the control group; b P<0.05 vs. the model group. Dt re presented s the men ±SD. RvE1, resolvin E1. A B C Figure 1. H&E stined liver tissue from the mice infected with Schistosom jponicum (mgnifiction, x400). (A) Control group; (B) model group; nd (C) RvE1 intervention group. Grnulom formtion is present in the model nd RvE1 intervention groups. H&E, hemtoxylin nd eosin; RvE1; Resolvin E1. Western blot nlysis. To detect the levels of TNF α protein, 20 µg protein extrcted from the ech liver ws seprted by SDS PAGE nd electroblotted onto nitrocellulose membrne, which ws probed with nti TNF α mouse ntibody (1:1,000; Cell Signling Technology, Inc., Beverly, MA, USA) nd polyclonl ntibody ginst glycerldehyde 3 phosphte dehydrogense (GAPDH; 1:1,000; Cell Signling Technology, Beverly, MA, USA). HRP conjugted got nti mouse IgG (1:50,000; Cell Signling Technology, Beverly, MA, USA) ws used to detect the bound mouse ntibody, while HRP conjugted got nti rbbit IgG (1:50,000; Cell Signling

3 EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: , Tble II. Concentrtions of LN, HA, PC III nd IV C in serum smples from RvE1 treted nd untreted mice (n=10 per group). Group LN (ng/ml) HA (ng/ml) PC III (ng/ml) IV C (ng/ml) Control ± ± ± ±17.2 Model ± ± ± ±35.2 RvE ±149.8,b 44.4±8.6,b 76.7±18.2,b 88.2±15.8,b F-vlue P-vlue P<0.05 vs. the control group; b P<0.05 vs. the model group. Dt re presented s the men ±SD. LN, lminin; HA, hyluronic cid; PC III, procollgen type III; IV C, type IV collgen. RvE1, resolvin E1. Technology, Beverly, MA, USA) ws used to detect the nti GAPDH polyclonl ntibody. The secondry ntibodies were detected using n ECL Immunoblot Detection system (Pierce Biotechnology, Inc., Rockford, IL, USA). Liver pthology. The middle lobule of ech liver ws fixed in 4% formldehyde, embedded in prffin, sectioned t thickness of 4 µm nd plced onto glss slides. The prffin embedded smples were dewxed nd stined with hemtoxylin nd eosin. In order to determine the number nd re of the grnuloms, five different visul fields were cptured t x400 mgnifiction under microscope (Olympus, Tokyo, Jpn). An imge nlysis system (VIAS, Ventn Medicl Systems, Inc., Tucson, AZ, USA) ws pplied to mesure the re of the grnuloms. Sttisticl nlysis. The mens of triplicte experiments were used for sttisticl nlysis by one wy nlysis of vrince with post hoc Tukey's test for pirwise group comprisons (SPSS softwre, version 13; SPSS, Inc., Chicgo, IL, USA). P<0.05 ws considered to indicte sttisticlly significnt difference (two sided). Results RvE1 tretment improves the liver pthology in infected mice. The livers from the control mice showed cler lobules nd norml structure under microscopic exmintion. The portl nd heptic sinuses ppered norml with uniform distribution (Fig. 1A). The livers from model mice showed typicl dmge in the liver lobules. Segregtion of the liver by collgen fibers, necrosis lesions in the grnuloms nd inflmmtory cells extensively in the periphery of the grnuloms ws observed (Fig. 1B). However, the severity of the heptocellulr necrosis nd fibroplsi ws mrkedly reduced in the livers of the mice treted with RvE1 compred with tht of the model group (Fig. 1C). The mice in the RvE1 intervention group lso showed thin fibroseptl ttchments nd decresed inflmmtory cell infiltrtions in the livers, demonstrting mrkedly improved or norml rchitecture of the heptic lobules. Grnulom number nd re re reduced in infected mice receiving RvE1 tretment. The livers from the control mice exhibited no grnuloms; therefore, the men number nd re of grnuloms in ech of the infected groups were significntly incresed compred with those of the controls (Tble I). Tble III. Effect of tretment with RvE1 on the levels of serum trnsminses (ALT/AST) in Schistosom jponicum induced liver fibrosis model (n=10 per group). Group ALT (U/l) AST (U/l) Control 37.42± ±8.30 Model ± ±88.22 RvE ±43.77,b ±39.29,b F-vlue P-vlue P<0.05 vs. the control group; b P<0.05 vs. the model group. Dt re presented s the men ± SD. RvE1, resolvin E1; ALT, lnine minotrnsferse; AST, sprtte minotrnsferse. However, the men re of the grnuloms in the RvE1 intervention group ws smller thn tht in the model group. RvE1 lowers the levels of mrkers of liver fibrosis in infected mice. To further mesure the extent of the liver fibrosis in the mice, the concentr tions of severl mrkers were mesured (Tble II). LN, HA, PC III nd IV C concentrtions were elevted in ech of the infected groups compred with those in the control group. However, in the mice receiving RvE1 tretment, ech of these mrkers exhibited reduced levels compred with those in the model group. RvE1 lowers the levels of mrkers of liver injury in infected mice. To further observe the extent of the liver injury in the mice, the serum concentr tions of ALT nd AST were mesured (Tble III). The serum ALT nd AST concentrtions were incresed in ech of the infected groups compred with those of the control group. However, the serum ALT nd AST concentrtions were reduced in the mice tht received RvE1 tretment compred with those in the model group. RvE1 ffects the TNF nd IFN γ expression levels in infected mice. The production nd expression levels of TNF α were determined by n ELISA, RT PCR nd western blot nlysis. The serum TNF α produc tion levels were elevted in ech of the infected groups compred with those in the control group. However, the serum TNF α produc tion levels were reduced in the mice receiving RvE1 tretment compred with those in

1484 QIU et l: RESOLVIN E1 REDUCES HEPATIC FIBROSIS A B Figure 2. ELISA detection of TNF α nd IFN γ levels in serum from Schistosom jponicum infected mice.

TNF α, tumor necrosis fctor α; IFN, interferon; ELISA, enzyme linked immu nosorbent ssy. A B C Figure 3. Profiles of TNF α mrna (RT PCR) nd protein (western blot nlysis) expression levels.

4 1484 QIU et l: RESOLVIN E1 REDUCES HEPATIC FIBROSIS A B Figure 2. ELISA detection of TNF α nd IFN γ levels in serum from Schistosom jponicum infected mice. The (A) TNF α nd (B) nd IFN γ levels in the serum were mesured by ELISA ssys. Dt re presented s the men ± SD of three independent experiments ( * P<0.05, ** P<0.01, *** P<0.001). TNF α, tumor necrosis fctor α; IFN, interferon; ELISA, enzyme linked immu nosorbent ssy. A B C Figure 3. Profiles of TNF α mrna (RT PCR) nd protein (western blot nlysis) expression levels. (A) The expression levels of TNF α nd β ctin mrna over time. The 100 bp β ctin mrna frgment ws used s n internl control. (B) The expression levels of TNF α nd GAPDH protein over time. The 37 kd GAPDH bnd ws used s n internl control. (C) The IOD of TNF α/β ctin or TNF α/gapdh ws expressed s the men ± SD. n=10 t ech time ( * P<0.05, ** P<0.01, *** P<0.001). TNF α, tumor necrosis fctor α; β ctin, β non muscle ctin; GAPDH, glycerldehyde 3 phosphte dehydrogense; RT PCR, reverse trnscription polymerse chin rection; IOD, integrl opticl density. the model group (Fig. 2A). In ddition, the TNF α mrna nd protein levels were lso reduced by RvE1 tretment compred with those in the model group (Fig. 3). The production nd expression levels of IFN γ were determined by ELISA. The serum IFN γ produc tion levels were reduced in ech of the infected groups compred with those in the control group. However, the serum IFN γ production levels were incresed in the mice receiving RvE1 tretment compred with those of the model group (Fig. 2B). Discussion Schistosomisis is n infectious disese tht is seriously hrmful to humn helth (8). Schistosom jponicum is one of the most common public helth problem in Chin (9). Schistosom jponicum is typicl chronic infectious disese tht induces heptic schistosomisis, nd the min pthologic lesions of heptic schistosomisis re grnulom formtion nd liver fibrosis round the schistosome eggs (10). Schistosome eggs re n importnt source of ntigens to which the host is exposed during Schistosom jponicum infection nd these cells induce n imblnce in T cell immunity, which is considered to be trigger of liver fibrosis (11). The imblnce of T helper (Th)1/Th2 cell immunity excessively ctivtes Th2 nd induces hemtopoietic stem cells to differentite into fibroblsts (7). These fibroblsts increse the levels of collgen formtion nd suppress its decomposition, which eventully results in mtrix protein deposition nd fibrosis (12). Th2 derived cytokines cuse liver dmge nd prolifertion of fibrous tissue, ccelerting fibrosis through the ctivtion of mcrophges nd the induction of TNF α nd other inflmmtory cytokines (13). There is correltion between elevted serum levels of TNF α nd n incresed degree of liver fibrosis, nd TNF α generlly promotes liver fibrosis. In ddition, IFN γ is ssocited with nti heptic fibrosis, which is very strong nti fibrotic fctor. These results hve been demonstrted in numerous studies of the induction of liver fibrosis in models with heptic schistosomisis (14 16). The inflmmtory cytokines produced in heptic schistosomisis induce liver fibrosis to protect the liver.

5 EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: , RvE1 (5S,12R,18R trihydroxy 6Z,8E,10E,14Z,16Eeicospentenoic cid) is n endogenous nti inflmmtory nd pro resolving meditor derived from the ω 3 ftty cid EPA during resolution (17). Systemic spirin tretment enhnces locl exudte conversion of EPA to the potent, bioctive RvE1 (18). RvE1 stimultes endogenous resolution mechnisms in vivo in complex disese models nd in vitro (19,20). In nnogrm quntities RvE1 promotes resolution of cute inflmmtion by regulting leukocyte infiltrtion, incresing the ingestion of poptotic neutrophils by mcrophges nd enhncing the clernce of phgocytes to the lymph nodes nd spleen (21). In the present study, the effects of dministered RvE1 were investigted nd it ws demonstrted tht RvE1 regultes the levels of inflmmtory fctors by n nti inflmmtory nd pro resolving mechnism, improves the locl inflmmtory response nd effectively llevites liver fibrosis in schistosome infected mice. The serum levels of TNF α were reduced in the RvE1 treted mice compred with those in the untreted infected mice. Similrly, the mrna nd protein expression levels of TNF α were reduced in the RvE1 treted mice compred with those in the untreted infected mice. The serum levels of IFN γ were incresed in the infected nimls treted with RvE1 compred with those in the untreted infected mice. The results suggest tht the RvE1 tretment chnged the cytokine levels nd thereby resolved the inflmmtion. This nti inflmmtory response my be responsible for the less severe liver pthology observed in the infected mice treted with RvE1 compred with tht in the untreted infected mice. The levels of serum ALT nd AST were significntly reduced following the RvE1 tretment compred with those in the untreted infected mice, which indicted tht the RvE1 treted mice exhibited ttenuted liver injury. Thus, it is hypothesized tht interventions in the inflmmtory response my effectively llevite liver injury. The effects of dministered RvE1 on liver pthology in schistosome infected mice were lso investigted. Administered RvE1 tretment reduced the effects of schistosome infec tion on the liver. While grnulom formtion occurred with the sme frequency s in the untreted infected mice, the re of the grnuloms ws significntly reduced in the RvE1 treted mice. In ddition, the concentrtions of the serum indictors of liver fibrosis (LN, HA, PC III nd IV C) were significntly lower in the infected mice treted with RvE1 thn those in the untreted infected mice. These results further confirmed the nti fibrotic effects of the dministrtion of RvE1. In conclusion, RvE1 tretment regultes the levels of cytokines to reduce the inflmmtory response within the liver in order to resist fibrosis following schistosome infection. The present study suggests tht dministered RvE1 tretment my slow the progression of liver fibrosis in individuls ffected by schistosomisis. Acknowledgements This study ws supported by the Nturl Science Foundtion of Hubei Province (no. 2011CDB173), the Scientific Reserch Foundtion of Helth Deprtment of Hubei Province (no. XF nd JX6B34) nd the Scientific Reserch Foundtion of Wuhn City (no. Z \ ). The reserch performed in this study ws in complince with the lws of Chin nd the uthors' respective institutions. References 1. Wilson MS, Mentink Kne MM, Pesce JT, Rmlingm TR, Thompson R nd Wynn TA: Immunopthology of schistosomisis. Immunol Cell Biol 85: , Chitsulo L, Engels D, Montresor A nd Svioli L: The globl sttus of schistosomisis nd its control. Act Trop 2000, 77: Perce EJ nd McDonld AS: The immunobiology of schistosomisis. Nt Rev Immunol 2: , Fbre V, Wu H, PondTor S, Coutinho H, Acost L, Jiz M, Olved R, Cheng L, White ES, Jrill B, McGrvey ST, Friedmn JF nd Kurtis JD: Tissue inhibitor of mtrix metlloprotese 1 predicts risk of heptic fibrosis in humn Schistosom jponicum infection. J Infect Dis 203: , Zou WL, Yng Z, Zng YJ, Li DJ, Ling ZP nd Shen ZY: Inhibitory effects of prostglndin E1 on ctivtion of heptic stellte cells in rbbits with schistosomisis. Heptobiliry Pncret Dis Int 6: , Iredle JP: Models of liver fibrosis: exploring the dynmic nture of inflmmtion nd repir in solid orgn. J Clin Invest 117: , Ohir T, Arit M, Omori K, Recchiuti A, Vn Dyke TE nd Serhn CN: Resolvin E1 receptor ctivtion signls phosphoryltion nd phgocytosis. J Biol Chem. 285: , WHO Expert Committee: Prevention nd control of schistosomisis nd soil trnsmitted helminthisis. World Helth Orgn Tech Rep Ser 912, Collins C, Xu J nd Tng S: Schistosomisis control nd the helth system in P.R. Chin. Infect Dis Poverty 1: 8, Gryseels B, Polmn K, Clerinx J nd Kestens L: Humn schistosomisis. Lncet 368: , Coutinho HM, Acost LP, Wu HW, McGrvey ST, Su L, Lngdon GC, Jiz MA, Jrill B, Olved RM, Friedmn JF nd Kurtis JD: Th2 cytokines re ssocited with persistent heptic fibrosis in humn Schistosom jponicum infection. J Infect Dis 195: , McDonld TT: Decoy receptor springs to life nd eses fibrosis. Nt Med 12: 13 14, Fichtner Feigl S, Strober W, Kwkmi K, Puri PK nd Kitni A: IL 13 signling through the IL 13lph2 receptor is involved in induction of TGF bet1 production nd fibrosis. Nt Med 12: , Bonnrd P, Remoué F, Schcht AM, Piloux G nd Riveu G: Assocition between serum cytokine profiles nd schistosomisisrelted heptic fibrosis: infection by Schistosom jponicum versus S. mnsoni. J Infect Dis 193: , Henri S, Chevillrd C, Mergni A, Pris P, Gudrt J, Cmill C, Dessein H, Montero F, Elwli NE, Seed OK, Mgzoub M nd Dessein AJ: Cytokine regultion of periportl fibrosis in humns infected with Schistosom mnsoni: IFN-gmm is ssocited with protection ginst fibrosis nd TNF-lph with ggrvtion of disese. J Immunol 169: , Booth M, Mwth JK, Joseph S, Jones FM, Kdzo H, Ireri E, Kzibwe F, Kemijumbi J, Kriuki C, Kimni G, Oum JH, Kbtereine NB, Vennervld BJ nd Dunne DW: Periportl fibrosis in humn Schistosom mnsoni infection is ssocited with low IL-10, low IFN-gmm, high TNF-lph, or low RANTES, depending on ge nd gender. J Immunol 172: , Serhn CN, Clish CB, Brnnon J, Colgn SP, Ching N nd Gronert K: Novel functionl sets of lipid derived meditors with ntiinflmmtory ctions generted from omeg 3 ftty cids vi cyclooxygense 2 nonsteroidl ntiinflmmtory drugs nd trnscellulr processing. J Exp Med 192: , Serhn CN, Hong S, Gronert K, Colgn SP, Devchnd PR, Mirick G nd Moussignc RL: Resolvins: fmily of bioctive products of omeg 3 ftty cid trnsformtion circuits initited by spirin tretment tht counter proinflmmtion signls. J Exp Med 196: , Serhn CN: Resolution phse of inflmmtion: novel endogenous nti inflmmtory nd proresolving lipid meditors nd pthwys Annu Rev Immunol 25: , Connor KM, SnGiovnni JP, Lofqvist C, Adermn CM, Chen J, Higuchi A, Hong S, Prvd EA, Mjchrzk S, Crper D, Hellstrom A, Kng JX, Chew EY, Slem N Jr, Serhn CN, Smith LE: Incresed dietry intke of omeg 3 polyunsturted ftty cids reduces pthologicl retinl ngiogenesis Nt Med 13: , Schwb JM, Ching N, Arit M nd Serhn CN: Nture 447: , 2007.

TNF-α (pg/ml) IL-6 (ng/ml)

Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6