Supplemental Table 1. 3 types of signals that are involved in T cell activation

Similar documents
WERNER_FIBRO_DN LEI_MYB_REGULATED_GENES BRCA1_OVEREXP_DN SUBCLASSES_DIFF P21_P53_MIDDLE_DN

WT-TP53 DLBCL WT-TP53 GCB-DLBCL

Subject ID: Date Test Started: Specimen Type: Peripheral Blood Date of Report: Date Specimen Obtained:

Supplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.

Supplementary information: Forstner, Hofmann et al.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Table S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t1/2 ± SD (hrs)

Supplementary Material. Table S1. Summary of mapping results

Supplementary information. Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls

RNA sequencing of cancer reveals novel splicing alterations

Deconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression

Quantitative Real Time PCR (RT-qPCR) Differentiation of human preadipocytes to adipocytes

Table S2. Functional annotation of the downregulated, differentially expressed genes of Rasless MEFs.

Supplementary Files to Töröcsik et al. Factor XIII-A is involved in the regulation of

Koji Kato, 1 Shuaiying Cui, 1 Rork Kuick, 2 Shin Mineishi, 1 Elizabeth Hexner, 3 James L. M. Ferrara, 4 Stephen G. Emerson, 3,5 Yi Zhang 1

Palindromic amplification of the ERBB2 oncogene in human primary breast tumors. A common pattern of copy number transition of chromosome 17 in HER2-

Targeted Genes and Methodology Details for Epilepsy/Seizure Genetic Panels

Figure 6: TERT regulates MYC half-life and ubiquitination.

Integrative Radiation Biology

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

CD80 and PD-L2 define functionally distinct memory B cell subsets that are. Griselda V Zuccarino-Catania, Saheli Sadanand, Florian J Weisel, Mary M

Epigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor

Supplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.

Supplementary Online Content

Differentially expressed genes in ATZ treated testes, cut-off value 2

SUPPLEMENTAL TABLE AND FIGURES

Supporting Information

A genome-wide association study identifies vitiligo

Nature Immunology: doi: /ni.3837

Supplementary Table 1. mirna modulated in D HF and ND HF patients. Table shows in a linear scale the same values of Fig. 2.

Table S2. Baseline characteristics of the Rotterdam Study for interaction analysis

Table S3. List of genes that display exclusive expression in selected structures TISSUE Template ID RefSeq accession Gene symbol CENTRAL NERVOUS

SUPPLEMENTARY FIGURES

Supplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing

SUPPLEMENTARY INFORMATION

Differential gene expression profiling of the sciatic nerve in type 1 and type 2 diabetic mice

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

Supporting Information

New network topology approaches reveal differential correlation patterns in breast cancer

Transcription factor Foxp3 and its protein partners form a complex regulatory network

Supplementary Figures

An integrated transcriptomic and functional genomic approach identifies a. type I interferon signature as a host defense mechanism against Candida

Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.

Novel Insights into Breast Cancer Genetic Variance through RNA Sequencing

Proteome Analysis of Human Perilymph using an Intraoperative Sampling Method

Supplemental Table 1: Enriched GO categories per cluster

Table S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed

Supplementary Materials

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Data to Supplementary Figure 1a to 1c

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Information for nature05543: Foxp3-dependent programme of regulatory T-cell differentiation

Integrated proteomic analysis of post-translational modifications by serial enrichment

Supplementary Information

RNA-mediated paternal heredity of diet-induced obesity and metabolic disorders

Supplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC

Supplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

SUPPLEMENTARY INFORMATION

Exosomes derived from B16F0 melanoma cells alter the transcriptome of cytotoxic T cells that impacts mitochondrial respiration

p5+mir30: AATGATACGGCGACCACCGACTAAAGTAGCCCCTTGAATTC

Development Supplementary Material

Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

A transcriptional mirna-gene network associated with lung adenocarcinoma metastasis based on the TCGA database

Supplementary Materials

A peer-reviewed version of this preprint was published in PeerJ on 18 September 2014.

b kb

Transduction of lentivirus to human primary CD4+ T cells

University of Groningen. B cell lymphoma Wu, Rui

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Is genomic grading killing histological grading?

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR

Supplementary Materials:

Supporting Online Material for

Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8

Supplementary Information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplemental Table 1. Cardiac mitochondrial acetyl proteoforms in mouse heart. Uniprot ID Gene Symbol Acetyl Proteoform Q8BWT1 Acaa2 K137 Q8BWT1

Common human cancer genes discovered by integrated gene-expression analysis

** *** population. (A) Representative FACS plots showing the gating strategy for T N

Supplement Results, Figures and Tables

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Requisition for DNA Testing. Reason for Referral: Patient Information: INCOMPLETE REQUESTS WILL BE BANKED. Test Requests: Sample Collection:

Sup. Fig. 1. Densitometry and IHC analysis. (a) Densitometry analysis showing

Supplementary Information

Request for expedited Result

Supplemental Table 1 Fasting-response genes (353 genes) WT fast-wt fed Fold Change 1.5, p<0.05 Up-regulated on Fasting (143 genes)

Genomic and transcriptomic landscapes of acute promyelocy3c leukemia Kankan Wang

Supplementary Figure 1. Microarray data mining and validation

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.

What Do We Know About Individual Variability and Its

Enabling Informed Clinical Decisions with Deep Insights. Routine Multi-gene Testing for Inherited Neuromuscular Disorders

Partial carotid ligation and flow pattern validation by high resolution ultrasound

Use of Molecular Assays to Assess Cellular Therapies

Transcription:

Supplemental Table 1. 3 types of signals that are involved in T cell activation Syn-T cells Allo-T cells CD3/28- T cells First signal MHC-TCR-CD3 pathway Not engaged MHC-alloantigen- TCR-CD3 Engaged CD3-Engaged Second signal Costimulatory molecules Not sure CD28, CTLA4, ICOS, OX40, CD30, CD153 CD28 signaling Third signal cytokines Not sure Cytokines from Allo- DCs and Allo-T cells Cytokines from CD3/28-T cells

Supplementary Figure 1 Pearson Correlation Coefficient R A Exp.2 Exp.2 Exp.2 Syn Allo CD3/28 Exp.1 B Exp.3 Exp.1 Exp.3 Exp.1 R=0.800981 R=0.815741 R=0.818577 Allo Allo Allo Exp.3 Exp1 Exp2 Exp3 E Exp2 Syn CD3/28 Syn CD3/28 Syn CD3/28 R=0.6701227 R=0.6504327 R=0.6680361 Pearson Correlation Coefficient R for 9 biological replicates for affymatrix microarrays C D Allo Allo mirna Exp1 E Exp2 R=0.938515(CD3/28) Syn R=0.703578681 CD3/28 Syn R=0.753278283 CD3/28 Pearson Correlation Coefficient R for 6 biological replicates for mirna microarrays

Supplementary Table 2.Enrichments of Transcripts differentially Increased in Allo- T cells Symbol Ch. ( Log) Symbol Ch. ( Log) Symbol Ch. (Log) Symbol Cha.(log) Symbol Ch.(Log) Alg8 2.060308 Cpsf6 1.22965 Arl6ip6 1.145309 5730471H19Rik 1.081846 Gmfb 1.029386 Melk 1.980582 Pno1 1.22959 C80350 1.143319 Grsf1 1.081728 Psmb7 1.028187 Eif3j 1.939782 BF228097 1.22056 Eif4a1 1.13752 Lmnb1 1.073975 Gltp 1.027779 Rg9mtd2 1.81345 Oxnad1 1.20962 Appbp2 1.137063 Senp1 1.073847 Fundc2 1.0272 Plk4 1.791148 BF228097 1.20522 Prkaca 1.136359 Psmd6 1.072738 Narfl 1.026824 Ikzf4 1.759402 Acp1 1.19909 Med28 1.129757 Hn1 1.072215 Aldh9a1 1.023497 Rbmx2 1.751609 BB728878 1.19583 Rnf219 1.128889 Vapa 1.070151 Hspd1 1.021761 Cep55 1.695522 Ccnj 1.19543 BC011499 1.128278 Cyp20a1 1.069918 Sumo1 1.021134 Taf1d 1.680666 Gsto1 1.1935 Snx5 1.126479 Eif4ebp1 1.069902 Dnmt1 1.019732 Car12 1.593412 Cldnd1 1.19101 Mcm2 1.125266 Hopx 1.067637 Slc30a7 1.017321 BM934830 1.583283 Trim37 1.18705 Uhrf1 1.125048 Adpgk 1.06675 Aagab 1.015194 Kif18b 1.496923 Slc38a1 1.1841 Bzw1 1.117773 Btf3 1.061956 Drg1 1.014896 AV155488 1.478698 Arl6ip6 1.18063 Camkk2 1.114847 Styx 1.060216 Eif1ax 1.014508 Psma5 1.441271 Mcm5 1.18048 Vps25 1.113808 Snrpd1 1.049015 Ttf2 1.014028 Mcm7 1.384297 Prkrir 1.17938 Azin1 1.113071 Hadh 1.046742 Snhg1 1.013278 Rps3 1.38057 AK002902 1.17549 4932431P20Rik 1.112251 Ppil1 1.045864 Zranb2 1.013087 Ccdc23 1.377602 Entpd6 1.17401 D17Wsu104e 1.107189 Tmem49 1.043791 Isoc1 1.012302 1110059G02Rik 1.33538 Tmem206 1.17359 Seh1l 1.105186 Sts 1.04242 Zbed4 1.011346 BM225255 1.308311 BC003788 1.17277 Dynll2 1.103297 Snx5 1.042211 Icos 1.009592 Sik3 1.306109 BM225255 1.16971 Mbnl3 1.102231 Vipar 1.041205 BB144971 1.006445 Pgk1 1.303941 Atmin 1.16244 Ppp3cc 1.09815 BG077348 1.040409 Psmd8 1.00597 Ap1g1 1.299406 Dlat 1.16196 Bcap29 1.097757 Mta2 1.040302 2610024G14Rik 1.005138 Cul5 1.263582 AV110784 1.15946 Hibadh 1.097527 Mtif3 1.039936 Tmem126a 1.002926 Yars2 1.26038 BB751093 1.15944 Vdac1 1.096555 Egr2 1.038783 Mcm7 1.000529 C1qbp 1.252782 Gtpbp10 1.15725 Mex3c 1.092194 AI597479 1.038558 Pgk1 1.244224 Fam120a 1.1529 BC002257 1.090886 Tmem69 1.035169 Cebpg 1.243272 E430014B02Rik 1.15107 Mcart1 1.083001 Raly 1.034162

Supplementary Table 3 Enrichments of Transcripts differentially Increased in CD3/28 antibody-activated T cells Symbol/Acc. Num Ch. (Log) Ch. Symbol/Acc. Num (Log) Symbol/Acc. Num Ch. (Log) Symbol/Acc. Num Ch.(Log) Symbol/Acc. Num Ch.(Log) Lypla1 1.596454 Imp4 1.165755 Gosr2 1.096668 Rpa2 1.065184 AK004568 1.037037 Pycrl 1.48934 Pms2 1.164373 Mrpl2 1.095905 Pmpca 1.064972 BB145140 1.034741 AI551874 1.45258 Gar1 1.159604 Eif2b1 1.094836 Ndufab1 1.064372 Agpat3 1.030875 NM_009082 1.367504 Siva1 1.159376 Psmc3ip 1.093395 Bzw1 1.062975 Cct2 1.029633 NM_009119 1.356857 Exosc1 1.15936 AA690930 1.089619 2700094K13Rik 1.062719 H2afz 1.028257 Nol9 1.34478 Dbi 1.15177 Thoc4 1.089041 Pppde2 1.062719 1700037H04Rik 1.027874 Cltb 1.344765 Zwilch 1.150608 Spna2 1.08845 Nfkbid 1.062338 Ptges2 1.027792 Gtf2e2 1.313391 Bola2 1.145338 Cad 1.088188 Cdc23 1.061264 NM_023119 1.027457 Pfkl 1.304789 Ndufv1 1.141496 Mpp6 1.087577 Naa10 1.060359 Gfod1 1.026122 AI414989 1.303586 Tsr2 1.141269 Pgk1 1.086831 Arf1 1.059623 Anapc5 1.02482 Aars 1.27787 Tmem167 1.138786 Tmem109 1.086313 Ndufs8 1.058682 Mrpl32 1.024699 Slc25a4 1.277711 Hspe1 1.135949 Snrpg 1.083866 Gnl3 1.05658 Tacc3 1.024568 0610012G03Rik 1.259882 Pus1 1.131414 BB811478 1.083639 Psmd6 1.056489 Noc4l 1.02373 Acot7 1.247454 Gapdh 1.131267 Rad51ap1 1.081713 E2f2 1.055445 Prdx6 1.022885 Rgs16 1.240074 Cdt1 1.130203 Ece2 1.081283 Pfdn2 1.053224 Slc25a4 1.018387 Mrps10 1.235494 Mcm7 1.130149 BG065620 1.080868 Eif4e 1.053202 Nudt1 1.016331 C80350 1.23323 Wdr36 1.129897 Etfb 1.079918 Pabpc4 1.050804 Set 1.013561 NM_010948 1.231322 Banf1 1.129473 Nhp2 1.07987 Wars 1.050489 Ube2v1 1.011275 Paxip1 1.200915 Rps18 1.127725 Tomm5 1.075241 Fam162a 1.050284 Me2 1.008857 Chtf18 1.199781 Surf4 1.122186 C79407 1.074419 Rpf2 1.049681 AI893877 1.007658 Eef1d 1.197358 Sephs1 1.120616 Phpt1 1.074085 NM_008787 1.046895 L3mbtl2 1.006212 Mrpl12 1.194039 Ndufs8 1.113868 Dbi 1.073291 Pcbp1 1.04652 Cox5b 1.002666 Psmc3ip 1.190073 Mrpl15 1.110926 Polr2j 1.0726 BG077348 1.045676 Coro1c 1.001668 Ppp1r14b 1.188978 Etfa 1.107261 Mtap 1.071897 Mthfd1 1.044188 Mrps22 1.186383 Synpo2l 1.098951 Dusp4 1.070336 Aprt 1.043453 Cct3 1.18008 2610027L16Rik 1.09776 Dusp5 1.066241 Mad2l2 1.037168

Supplementary Table 4 Enrichments of Transcripts differentially reduced in CD3/28 T cells Symbol Ch. (Log) Symbol Ch. (Log) Symbol Ch.(Log) Symbol Ch.(Log) Symbol Ch.(Log) Igk-V1-1.63971822 Stxbp5-1.18819 Myst2-1.1294 Pde7a -1.06819 AW559011-1.02788 Hsd17b4-1.58317823 Trim34-1.18709 Ncor1-1.12876 Dis3l -1.06704 Tsc1-1.02695 BC013496-1.55967109 Stxbp3a -1.18419 Ikbkb -1.12813 Cd74-1.06605 Hsdl1-1.02404 Rnf146-1.55445289 Pfn2-1.18412 Rgs2-1.12794 Kcnk6-1.06543 Srsf6-1.02302 Rbm16-1.54092405 Helb -1.18315 AI987967-1.12604 Kat2b -1.06441 Bcl6-1.02276 AV057155-1.48586401 H2-Ob -1.18279 Tmx4-1.12373 4932438A13Rik -1.05759 Ccpg1-1.02168 Slc4a7-1.48190891 Atp2b1-1.18237 Acbd5-1.11983 Ap3m2-1.05594 Clcn4-2 -1.02016 Tspo -1.44397731 Prkacb -1.18093 Pcf11-1.11863 Pja1-1.0557 Bcl3-1.01945 Zcchc3-1.38606786 Trpm7-1.1768 Zfp62-1.11813 1600012H06Rik -1.05445 Litaf -1.01685 Cd24a -1.37971791 Mgst2-1.17279 BB414617-1.11754 Pde4b -1.05438 Srgap2-1.01445 Grina -1.36027963 Smad4-1.17079 Rnf213-1.11548 Cep350-1.05427 Pyhin1-1.01433 Kdm3b -1.34424198 Als2cl -1.16913 AJ249492-1.11265 Tgoln1-1.05171 Sdad1-1.0143 Dnase2a -1.33373608 Nol8-1.16643 Fez2-1.11245 AV220340-1.05125 Spsb1-1.01303 5730601F06Rik -1.33055856 Rock1-1.16559 Mfge8-1.10668 C130039O16Rik -1.04453 4933426M11Rik -1.01261 Lasp1-1.33037007 Zfml -1.16445 C2cd3-1.10236 Tug1-1.04254 D930015E06Rik -1.01038 Slc2a3-1.3225484 Tbk1-1.16288 Ddx58-1.10178 Ddx59-1.0416 Pcnx -1.01016 Vps13d -1.31706502 Fbxo22-1.16288 Zbtb25-1.10141 Cflar -1.0403 Entpd5-1.00909 Srsf8-1.31607075 Nrip1-1.15857 Oxr1-1.1014 P4ha1-1.0402 Psap -1.00868 2310035C23Rik -1.2922489 Tspo -1.15814 Creb3-1.10098 Bmp2k -1.04002 Smg1-1.00798 Jak1-1.29089149 Marcks -1.15573 Rnf185-1.09457 Glt8d1-1.03924 Jak1-1.00719 Wdr92-1.28901879 Arid4a -1.15513 Sptlc1-1.09277 Ccndbp1-1.03827 Nsd1-1.00571 Tbc1d4-1.26777748 Dnajb9-1.15076 Cnot4-1.09103 Arhgap4-1.03799 Add3-1.00495 Tor1aip1-1.25884692 H2-Eb1-1.14949 Cpne3-1.09082 Zfp260-1.03713 Smarcc2-1.00471 BI107286-1.25070246 AK008551-1.14554 Prex1-1.09019 Ehd3-1.03548 Atf7ip -1.00346 Rapgef4-1.24795705 4933433P14Rik -1.14161 Snap23-1.09018 Plxnc1-1.03543 Ppp1r12a -1.00233 Pisd-ps3-1.24664939 Tmem106b -1.13804 Myst3-1.08365 BB115902-1.0334 1190002H23Rik -1.00137 Uhrf1bp1l -1.23684719 Whsc1l1-1.1372 Skap2-1.08192 Ifit3-1.03274 Gimap5-1.00121 Ddx46-1.22396951 Phf3-1.13654 Zeb1-1.08101 Ash1l -1.03177 Pds5b -1.0008 Rbm33-1.21728656 Whsc1l1-1.13512 Mettl9-1.07686 Sh3gl1-1.03117 Adm -1.00074 Asxl2-1.21254492 Tlr6-1.13303 Gpr183-1.0767 Mfsd6-1.03028 Ndrg1-1.20441659 Herc2-1.13268 Plec -1.07597 Wipf2-1.02931 Nbr1-1.20183101 Atp2b1-1.13055 Limd1-1.07298 Igf1r -1.02902 Zfp53-1.19895557 Slc39a9-1.12942 2810474O19Rik -1.07122 Pstk -1.02821

Fluorescence Signals Supplementary Figure 2 450 400 350 300 Syn Allo CD3/28 250 200 150 100 50 0-50 Supplementary Figure 2: Selection of differentially enriched mirs from CLIP chip We focused on the mirs in group 3, which s enrichments were differentially changed in Allo- T and Ab-T cells compared with that in Syn- T cells. It reflected the distinct features for immune response, Allo-reaction versus non-specific reaction. 6 mirs out of the 18 showed significantly changed enrichments after CLIP and were selected for further analysis.

Supplementary Figure 3 Target Prediction Frequencies A B 10 8 6 4 2 0 unenriched P<0.0001 enriched 14 12 10 8 6 4 2 0 Unenriched P=0.0004 Enriched Target Prediction for the transcripts with reduced enrichments in Allo-T cells by mirs enriched in group 3 or unenriched mirs as in Supp-table 10) Target Prediction for the transcripts with increased enrichments in Allo-T cells (Supp table 2) and mirs in group 2 (Supp table 11) or unenriched mirs as in supp table 12)

Supplementary Table 5 Frequency of targeting between mirna s in Group 3 and transcripts in Allo-enrichment reduced after CLIP Number of Targeting Frequency Name of targeted transcripts mirnas (Total 50) 9 2% (1) Il6st 8 up to 9 4% (1) Cbx7 7 up to 9 10% (3) Mll3, Med17, Rsrc2 6 up to 9 22% (5) Synj1, 4933433P14Rik, Cd200r1, Ctdsp1, Zfp622, 5 up to 9 38% (8) Akap9, Ankrd17, Dock9, Rnf185, Nub1, Ing1, Narf, Mmp15 4 up to 9 56% (9) Wapal, Bat2, Cyb5r3, Ifngr2, Ifi203, Lipa, Ccdc55, Lrrfip1, Itm2c 3 up to 9 74% (9) Brd8, C87436, Terf2ip, Tgs1, LPP, Itpr1, Rcor1, L3mbtl3, Fchsd2 2 up to 9 86% (5) Akap8, Cabin1, Nfyb, Sirt7, Yipf1, 1 up to 9 100% (9) Atp1a1, Clk3, Cyth3, Flot2, Hsd17b4, Prf1, Ptpra, Rab24, Crnkl1

Supplementary Table 6 Targeted transcripts in Allo-T cells which s enrichments are uniquely reduced after CLIP ( table 1) by randomly selected un-enriched mirnas Randomly selected unenriched mirnas Targeted transcripts in Allo-T cells which s enrichments are uniquely reduced after CLIP ( table 2) Mmu-miR-181a 4933433P14Rik, Mll3, Cbx7, 3 Mmu-miR-223 Ankrd17, Mll3, Il6st, 3 Mmu-miR-744 0 Mmu-miR-32 Dock9, Itpr1, 2 Mmu-miR-451 0 Mmu-miR-27b Ankrd17, Rsrc2, Mll3, Brd8, 4 Mmu-miR-10 0 Mmu-miR-221 AI314180, Nfyb, 2 Mmu-miR-125b-5p Flot2, Sirt7, 2 Mmu-miR-105 Itpr1, 1 Mmu-miR-122 0 Mmu-miR-134 0 Mmu-miR-136 0 Mmu-miR-137 0 Mmu-miR-145 Dock9, 1 Mmu-miR-149 0 Mmu-miR-152 Mmp15, Sirt7, Il6st, 3 Mmu-miR-182 Dock9, Ctdsp1, Rcor1, Cbx7, 4 Number of targets

Supplementary Table 7 Targeted transcripts in Allo-T cells which s enrichments are uniquely increased after CLIP ( Supplementary table 2) by enriched mirnas in group 2 mirna Name Mmu-miR-709 Mmu-miR-374 Mmu-miR-204 Mmu-miR-1958 Mmu-miR-1897-5p Targeted transcripts in Allo-T cells which s enrichments are uniquely increased after CLIP ( supplementary table 1) Rg9mtd2, Cep55, Car12, Rps3, Cebpg, Trim37, Slc38a1, Mcm5, Prkrir, Entpd6, Tmem206, Dlat, Med28, Azin1, Mbnl3, Mcart1, Senp1, Gltp, Aldh9a1, Zranb2, Eif3j, Rg9mtd2, Plk4, Cep55, Car12, Rps3, Cul5, Cpsf6, Arl6ip6, Tmem206, Atmin, Arl6ip6, Mbnl3, Mex3c, Styx, Tmem69, Gmfb, Fundc2, Zranb2, Car12, Rps3, Oxnad1, Ccnj, Tmem206, Atmin, Dynll2, Mbnl3, Cyp20a1, Mta2, AI597479, Eif3j, Slc38a1, Mta2 Cpsf6, Slc38a1, Raly, Gmfb Mmu-let-7e Mmu-miR-3081 Rg9mtd2, Acp1, Ccnj, Prkaca, Med28, Snx5, Bzw1, Vps25, Mbnl3, Bcap29, Vdac1, Hn1, Styx, Hadh, Tmem49, Snx5, Fundc2, Pgk1, Cul5, Pgk1, Senp1, Ppil1, Isoc1,

Supplementary Table 8 Targeted transcripts in Allo-T cells which s enrichments are uniquely increased after CLIP ( supplemental table 2) by randomly selected Un-enriched mirnas Randomly selected Un-enriched mirnas Targeted transcripts in Allo-T cells which s enrichments are uniquely increased after CLIP ( supplemental table 1) Mmu-miR-181a Ccnj, Entpd6, Senp1, 3 Mmu-miR-223 Styx, 1 Mmu-miR-744 0 Mmu-miR-9 Ikzf4, Grsf1, Adpgk. 3 Mmu-miR-451 Mex3c, 1 Mmu-miR-10 Eif3j, Mbnl3, 2 Mmu-miR-221 Eif3j, Styx, 2 Number of Targets

Supplementary Table 9: GSEA Results Summary Dataset Ago-CLIPCHIP. Syn-Allo.cls#Syn_versus Allo Phenotype Syn versus Allo Upregulated in class Syn GeneSet ENRICHMENTS REDUCED ALLO Enrichment Score (ES) 0.97343034 Normalized Enrichment Score (NES) 1.0980797 Nominal p-value 0.13640922 FDR q-value 0.13640922 FWER p-value 0.136

Supplementary Figure 4

P<0.001 P=0.022 P=0.9 P<0.001 P<0.01 P<0.01 Supplementary Figure 5 P<0.01 P=0.2 P<0.01 Wapal ( from 4 PM probe sets) P<0.001 P<0.01 P=0.67 LPP ( from 8 PM probe sets) P<0.05 P=0.18 P<0.05 Synj1 ( from 4 PM probe sets) P<0.05 P=0.31 P<0.05 Fchsd2 ( from 2 PM probe sets) Cyb5r3 ( from 4 PM probe sets) Med17 ( from 2 PM probe sets) Supplementary Figure 5 Validation of predicted genes with pooled transcripts from CLIP-chip To avoid single transcript positively selected by analysis algorithms, all transcripts detected by perfect match (PM) probset for the predicted 6 genes were extracted and pooled for analysis. The results were consistent with Affymetrix report.

Ct Value Supplementary Figure 6 30 25 20 15 snorna135 mir-16 mir-669d mir-142-5p Supplementary Figure 6: The relative expression levels of mirs in naïve T cells.

Supplementary figure 7 Wapal and Synj1 silencing using shrna lentiviral particles. A Wapal silencing by shrna lentiviral shrna 1.5 1 0.5 0 Scramble Wapal Wapal shrna 20 shrna 40 Wapal PCAF B Synj1 silencing by shrna lentiviral shrna 1.5 1 0.5 Synj1 PCAF 0 Scramble Synj1 shrna 20 Synj1 shrna 40

Supplementary table 10. Primers for qpcr Supplementary table 15. Primers for qpcr 5'-Forward 3'-Reverse Wapal actaaccatgtgggcaaagc tagacccaatcccagcactc Synj1 gtgcttacacccacgttcct ttgctaacagcgagtgatgg LPP tacggcatccacatcttcaa accaacacaggttggaggag Fchsd2 ggcctacattgctcagcttc cagggcccatagattcttca PCAF caaggccaatgaaacctgcaag ggtagaaatagacttgtttggtg

Supplementary table 11: Enrichments of 68 Transcripts reduced in allo-activated T cells After CLIP Symbol Change (Log) Symbol Change(Log) Symbol Change(Log) Symbol Change(Log) Fchsd2-1.36619 Cyb5r3-1.12556 Wapal -1.08012 Itpr1-1.03826 Lpp -1.27923 AK010713-1.12289 Ing1-1.07058 Klf7-1.03374 AI314180-1.2673 Akap8-1.10654 Rsrc2-1.06999 2310009A05Rik -1.03145 Zc3h7a -1.25412 Zc3h7a -1.10101 Nub1-1.06992 Cabin1-1.02948 Yipf1-1.24532 Crnkl1-1.10023 Med17-1.06989 Il6st -1.0206 Rab24-1.24232 Nfyb -1.09778 BI466860-1.06342 Use1-1.0206 Pex6-1.23133 Synj1-1.09761 4933433P14Rik -1.05726 Ctdsp1-1.01899 Flot2-1.21728 Dock9-1.09586 Ifngr2-1.05496 Rcor1-1.01502 Fmnl1-1.18548 Zfp622-1.09407 Mll3-1.05494 Itm2c -1.01173 Lipa -1.18236 Narf -1.09255 Kidins220-1.05463 C87436-1.01097 Mtor -1.17886 AI326418-1.09216 Mmp15-1.04937 Cbx7-1.0085 Hsd17b4-1.15936 Lipa -1.08997 Atp1a1-1.04807 Akap9-1.00568 Bat2-1.15317 Cir1-1.08946 Cyth3-1.04686 Terf2ip -1.00351 Ankrd17-1.14679 Cd200r1-1.08569 Brd8-1.04647 Ifi203-1.0025 Ptpra -1.14011 L3mbtl3-1.08459 Lrrfip1-1.04385 Clk3-1.00196 Ccdc55-1.13829 Igl-V1-1.08459 Rnf185-1.04299 Phrf1-1.00046 Prf1-1.13095 Tgs1-1.08063 Sirt7-1.04281 Katna1-1.00035

Supplementary Figure 8: Full unedited gels for Figure 5 C

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback