cells. 15 The GATA-1 transcription factor has been shown to including -globin, PBGD, erythropoietin receptor (EPOR) Reagents
|
|
- Kelly Hamilton
- 6 years ago
- Views:
Transcription
1 Leukemia (1997) 11, Stockton Press All rights reserved /97 $12.00 BRIEF COMMUNICATION Time-course of butyric acid-induced differentiation in human K562 leukemic cell line: rapid increase in -globin, porphobilinogen deaminase and NF-E2 mrna levels B Chénais, I Molle, C Trentesaux and P Jeannesson Laboratoire de Biochimie et Biologie Moléculaire, EA2063, IFR53-Biomolécules, Faculté de Pharmacie, Université de Reims Champagne Ardenne, Reims, France Butyric acid (BA) was shown to induce hemoglobinization of dence of globin gene expression on the NF-E2 transcription K562 cells in a dose- and time-dependent manner. The maximal factor has been demonstrated in murine erythroleukemia differentiation (54% of hemoglobinized cells) was obtained with cells. 15 The GATA-1 transcription factor has been shown to the 0.5 mm concentration, which induced a 60% inhibition of cell growth at day 3 without cytotoxicity. Parallel to the kinetics play a central role in the control of several erythroid genes of hemoglobinization, a rapid increase in -globin and porphobilinogen deaminase (PBGD) mrnas was observed in BA- and GATA-1 itself. 16 including -globin, PBGD, erythropoietin receptor (EPOR) treated cells. This increase was time-dependent and higher for In view of the above, we propose in this report to study the -globin than for PBGD (six- and two-fold at day 3, time-course of BA-induced hemoglobinization and erythroid respectively). In contrast, erythropoietin receptor mrnas were mrna overexpression in human K562 cells. By so doing, we not affected by BA treatment. Analysis of erythroid transcripintend to bring new insights into the involvement of GATA-1 tion factor mrna levels during the time course of BA treatment showed, for the first time, an early and marked (up to three-fold) and, especially, NF-E2 transcription factors in the BA-triggered increase in p45 NF-E2 mrna, contrasting with that of GATA-1 differentiation process. mrna ( 1.5-fold). Taken together, these results showed the rapid differentiating effect of BA and suggest the involvement of the NF-E2 transcription factor. Materials and methods Keywords: butyric acid; NF-E2; GATA-1; erythroid genes; leukemia; differentiation Reagents All chemical reagents were purchased from Sigma (St Quentin Introduction Fallavier, France) unless otherwise stated and were of reagent grade or molecular biology grade when necessary. n-butyric Butyric acid (BA) is a widely used short-chain fatty acid which acid solution was diluted to 100 mm in water and sterilized demonstrated a variety of effects both in vivo and in tumoral through 0.22 m filters (Millipore, St Quentin en Yvelines, cell lines. BA induces cell growth arrest, changes in cell morphology, France). induction of erythroid differentiation of erythro- leukemic cell lines and especially induction of fetal hemoglobin synthesis. 1 Cell culture In the human K562 leukemic cell line, 2 BA has been reported to induce an increase, either of the activity of heme K562 cells were cultured in RPMI-1640 medium (Life Techno- biosynthesis enzymes such as -aminolevulinate synthase logies, St Quentin en Yvelines, France) supplemented with (ALAS 3 ), -aminolevulinate dehydratase (ALAD 4,5 ) and 10% heat-inactivated fetal bovine serum and 2 mm L-glutaporphobilinogen deaminase (PBGD 5 ), or of glycophorin-a mine, in a 5% CO 2 humidified atmosphere. expression, a membrane-specific protein of red blood cells. 3 Nevertheless, neither these recent results nor former report 7 mentioned short-term kinetics analysis of BA-differentiating Assays for cell growth and erythroid differentiation effect. Furthermore, although -globin mrna level has been found to increase in sodium butyrate-treated K562 cells, Cells were treated with BA, or other inducers, at the beginning owing to a transcriptional activation 6 and an enhancement of of this exponential growth phase. Cell growth and viability promoter activity, 8,9 no information is yet available concerncells. were assessed by direct counting of trypan blue dye-excluding ing BA action on erythroid transcription factors NF-E2 and Growth inhibition was calculated from GATA-1. {[(C n C 0 ) (T n T 0 )]/(C n C 0 ) 100} The heterodimeric NF-E2 transcription factor 10,11 recogwhere C n, C 0, T n, T 0 represent the numbers of cells/ml at days nizes an extended AP-1 site initially characterized in the PBGD gene promoter 12 and in the locus control region of the 0 and n, respectively. The percentage of hemoglobinhuman -globin gene. 13 Despite mild effects on erythropoiesis producing cells was determined by a benzidine staining of p45 NF-E2 suppression in knockout mice, 14 the depen- method as previously described. 17 Northern blot analysis Correspondence: B Chénais, Laboratoire de Biochimie et Biologie Moléculaire, Faculté de Pharmacie, Université de Reims Champagne Ardenne, 51 Rue Cognacq-Jay, F Reims Cedex, France Total RNAs were extracted using Trizol reagent (Life Received 30 December 1996; accepted 6 May 1997 Technologies), 10 g were submitted to formaldehyde-
2 1576 containing 1% agarose gel electrophoresis and capillary blot- with the optimal differentiation-inducing concentration, BA ted onto a nylon membrane (Hybond N; Amersham, Les Ulis, 0.5 mm, which exhibited a cytostatic effect, and BA 1 mm, France). Random priming labeling of cdna probes was per- which combined a maximal growth inhibitory effect with a formed using the Ready-To-Go DNA labeling kit (Pharmacia low cytotoxicity (90% of viable cells). Biotech, St Quentin en Yvelines, France) and - 32 P-dCTP Hemoglobinization of K562 cells was studied as a function (3000 Ci/mmol; DuPont NEN, Les Ulis, France). Membranes of time by scoring benzidine-positive cells after 2 to 72 h of were then hybridized with labeled cdna according to the treatment with 0.5 and 1.0 mm BA. The percentage of differentiated cells increased in a time-dependent manner for both supplier s instructions. The A -globin, EPOR and GATA-1 human cdnas were a kind gift from Dr S Ottolenghi concentrations, and was significantly increased as soon as (University of Milan, Italy), human PBGD and murine p45 NF- 10 h after treatment with 0.5 mm BA (Figure 2a). Cell prolifer- E2 cdnas were from Dr P-H Roméo (Hôpital Henri Mondor, ation was not affected before 12 h of treatment (Figure 2b), Créteil, France) and Dr SH Orkin (Harvard Medical School, then, as soon as 24 h, both BA concentrations induced a cell Boston, MA, USA), respectively. Finally membranes were growth inhibitory effect of 20% to reach 60% and 71%, dehybridized in boiling 0.1% SDS and reprobed with human respectively, at 72 h. glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cdna In order to investigate the reversibility of the BA-differentiating effect, K562 cells were treated by 0.5 and 1 mm BA for from Clontech (Montigny le Bretonneux, France). Northern blots were quantified using a GS363 molecular imager 24 h and then incubated in complete drug-free medium for (BioRad, Ivry sur Seine, France) and submitted to autoradiography. cells. Hemin (30 M), which did not affect cell proliferation, an additional 24 or 48 h before scoring the benzidine-positive was used as a control of reversible induction as previously described. 18 Anthracyclines (aclarubicin and doxorubicin) Results and discussion have been demonstrated to be potent differentiating agents in K562 cells (reviewed in Ref. 19) and were used at optimal Effect of BA on cell growth and differentiation differentiating concentrations as irreversible inducers. The results presented in Table 1 showed that BA-induced differentiation and cell growth inhibition were irreversible, at least for Exponentially growing K562 cells were treated with mMBA for 3 days and cell hemoglobinization was studied by scoring benzidine-positive cells. As shown in Figure 1, the increase of benzidine-positive cells was gradual and reached a maximum of 54% of hemoglobinized cells with 0.5 mm BA vs 3% in control cells. In contrast, higher concentrations (1 to 2mM) resulted in a decline in the percentage of hemoglobinized cells followed by an increase of cell mortality which went up to 39% in 2 mm BA-treated cells vs 5% in both 0.5 mm BA-treated and untreated cells (Figure 1). In addition, cell proliferation was strongly affected by BA treatment, and a 60% growth inhibition was observed with 0.25 mm BA, increasing up to a plateau of 87% with 1 mm BA. Consequently, further differentiation analyses were performed both Figure 1 Dose-response of BA-induced hemoglobinization and cell growth inhibition. The percentage of benzidine-positive cells (- -) was scored at day 3 of culture in the presence of 0.1 to 2 mm of BA. For each culture the percentage of mortality (- -) was estimated Figure 2 Time-course of BA-induced hemoglobinization (a) and by using the trypan blue dye exclusion method, and the percentage cell growth inhibition (b). Hemoglobinization and cell number/ml of growth inhibition (- -) was calculated as described in Materials and were determined after 2 to 72 h incubation in the presence of 0.5 and methods. Data represent the mean ± s.d. from three independent 1mM of BA, and in untreated cells (control). Data represent the mean experiments. ± s.d. from five independent experiments.
3 Table 1 Treatment Brief communication Irreversibility of BA-induced hemoglobinization and cell growth inhibition % of benzidine-positive cells (% of growth inhibition) a Day 2 Day Continuous Pulse Continuous Pulse Control 3 ± 1 3 ± ± 1 2 ± 1 Butyric acid 0.5 mm 35 ± 3 31 ± 2 b 47 ± 9 39 ± 7 b (57 ± 7) (59 ± 6) b (60 ± 6) (51 ± 7) b Butyric acid 1 mm 23 ± 5 24 ±3 b 38 ± 4 33 ± 11.7 b (64 ± 4) (54 ± 9) b (76 ± 11) (61 ± 6) b Hemin 30 M c 75 ± 4 9 ± 7 80 ± 1 13 ± 3 Aclarubicin 20 nm 24 ± ± 3 b 49 ± ± 5 b (57 ± 11) (58 ± 7) b (52 ± 8) (35 ± 7) b Doxorubicin 40 nm 42 ± 3 41 ± 13 b 47 ± 1 50 ± 9 b (88 ± 1) (89 ± 5) b (93 ± 1) (90 ± 4) b a Cell induction was performed with the indicated drugs as continuous treatment (48 and 72 h), and pulse treatment (24 h in the presence of the drug followed by incubation for 24 h or 48 h in complete drug-free medium). Hemoglobinization of K562 cells was determined as the percentage of benzidine-positive cells at day 2 and day 3, and the percentage of growth inhibition was calculated as described in Materials and methods. Data represent the mean ± s.d. from at least three independent experiments. b Values from pulse treatment were not significantly different from those obtained from continuous treatment with P 0.05 according to the Student s t-test for paired data. c Cell growth was not affected by hemin (30 M) in all cases. 72 h, in contrast to hemin-induced hemoglobinization which on the surface of aclarubicin-treated cells was augmented. 22 requires the continuous presence of the drug. In contrast, we did not observe any increase of EPOR mrna Consequently, although more rapid, BA-inducing effects in K562 cells treated for 6 to 72 h with 0.5 and 1 mm BA share some similarities with those of anthracyclines, particularly (Figure 4), thus ruling out a putative role of EPOR in BA- aclarubicin. 19 Indeed, BA as well as anthracyclines induced differentiation of K562 cells. induce irreversible, time- and dose-dependent hemoglobinization and cell growth inhibition. Moreover, like aclarubicin, but in contrast with doxorubicin, 17,19 BA did not require the BA-induced increase of erythroid transcription factor mrna level total arrest of cell growth to induce optimal hemoglobinization of K562 cells. Effect of BA on erythroid gene expression -Globin mrna expression was studied in 0.5 mm and 1 mm BA-treated cells for 6 to 72 h. Hybridization of Northern blots with 32 P-labeled cdna showed that -globin expression increased as soon as 6 h (1.5-fold) after BA treatment (Figure 3). This effect was time-dependent with a maximum of sixfold at 72 h, in accordance with previous results. 6 This marked increase of -globin mrna correlated with cell hemoglobinization, since benzidine-positive cells appeared 4 h after the increase of -globin mrna. An upregulation of -globin mrna was also observed in cells treated with 1 mm BA with approximately the same efficiency (data not shown). Concerning the heme synthesis pathway, PBGD gene expression was increased by 1.5-fold in 0.5 mm BA-treated cells as soon as 12 h, with a maximum of two-fold at 72 h (Figure 3). According to Fowler et al, 5 this indicates that, in BA-treated cells, the PBGD mrna increase is lower than that of -globin. In addition, the time-course of PBGD mrna increase paralleled that of hemoglobinized cells. This observation is in agreement with that of Kawasaki et al 3 who reported that ALAS activity and hemoglobin levels were simultaneously increased to a similar extent and with a similar timecourse in sodium butyrate-treated K562 cells. The EPOR gene, like PBGD and -globin genes, has been previously found to be transcriptionally activated in aclarubicin-differentiated K ,21 Moreover, the EPOR expression The erythroid transcription factors NF-E2 and GATA-1 have been previously shown to be increased during aclarubicin-, but not doxorubicin-induced differentiation of K562 cells. 20,23,24 In an attempt to better understand the involvement of these transcription factors, we used p45 NF-E2 and GATA-1 cdnas to investigate their mrna expression timecourses during BA-induced differentiation of K562 cells. As shown in Figure 3, p45 NF-E2 mrna level was increased as early as 6 h (1.2-fold) to reach a maximum of three-fold at 72 h after 0.5 mm BA treatment (Figure 3). With 1mM BA the maximal increase in p45 NF-E2 mrna was obtained much earlier (as soon as 12 h after treatment) and was enhanced up to three-fold (data not shown). It should be noted that the time-course of p45 NF-E2 mrna increase paralleled that of PBGD and that of cell hemoglobinization (Figures 3b and 2a). In contrast, GATA-1 mrna slightly increased during the time-course of BA treatment, with a maximum of 1.3-fold at 12 h (Figure 3) and then decreased. The use of 1 mm BA instead of 0.5 mm did not amplify the GATA-1 mrna increase which remained below 1.5-fold (data not shown). In conclusion, these results showed the rapid effect of BA on erythroid gene expression, with the major exception of the EPOR gene, and the correlation between -globin, PBGD and p45 NF-E2 mrna expression and cell hemoglobinization time-courses. Contrasting with the mildness of the GATA-1 mrna increase, the early and marked increase of p45 NF- E2 mrna level is consistent with a transcriptional activation process and suggests an important role of this transcription
4 1578 factor. Nevertheless, the involvement in BA-triggered differentiation of NF-E2, GATA-1, as well as other transcription factors such as EKLF, remains to be directly demonstrated. Acknowledgements This work was supported by grants from Association pour la Recherche sur le Cancer and from the Ligue Nationale Contre le Cancer, comité de l Aisne. We are grateful to Hélène Bobichon for the photographs and Denis Bosson for his grammatical assistance. References 1 Kruh J. Effects of sodium butyrate, a new pharmacological agent, on cells in culture. Mol Cell Biol 1982; 42: Lozzio CB, Lozzio BB. Human chronic myelogenous leukemia cell line with positive Philadelphia chromosome. Blood 1975; 45: Kawasaki N, Morimoto K, Tanimoto T, Hayakawa T. Control of hemoglobin synthesis in erythroid differentiating K562 cells. Arch Biochem Biophys 1996; 328: Chang CS, Sassa S. -Aminolevulinate dehydratase in human erythroleukemia cells: an immunologically distinct enzyme. Blood 1985; 65: Fowler DA, Weidner DA, Sommadossi J-P. Effects of 3 -azido-3 - deoxythymidine on erythroid inducible gene expression in human K562 leukemia cells. Toxicol Lett 1995; 80: Weidner DA, Sommadossi J-P, 3 -Azido-3 -deoxythymidine inhibits globin gene transcription in butyric acid-induced K562 human leukemia cells. Mol Pharmacol 1990; 38: Anderson LC, Jokinen M, Gahmberg CG. Induction of erythroid differentiation in the human leukemia cell line K562. Nature 1979; 278: Safaya S, Ibrahim A, Rieder RF. Augmentation of -globin gene promoter activity by carboxylic acids and components of the Figure 3 Time-course of mrna expression during BA-induced human -globin locus control regions. Blood 1994; 84: 3929 differentiation. (a) Total RNA from 0.5 mm BA-treated cells and untreated cells (control) were transferred onto nylon membranes and 9 Pace B, Li Q, Peterson K, Stamatoyannopoulos G. -Amino butyric hybridized sequentially with NF-E2 and -globin or GATA-1 and acid cannot reactivate the silenced gene of the locus YAC PBGD cdna probes. Finally blots were hybridized with GAPDH transgenic mouse. Blood 1994; 84: cdna as control. Before autoradiography, each blot was submitted 10 Andrews NC, Erdjument-Bromage H, Davidson MB, Tempst P, to BioRad molecular imager scanning to allow quantification of RNA Orkin SH. Erythroid transcription factor NF-E2 is a haematopoiexpression. (b) Results were plotted as the relative mrna level etic-specific basic-leucine zipper protein. Nature 1993; 36: increases vs control for each incubation time. Data from a typical experiment representative of three. 11 Andrews NC, Kotkow KJ, Ney PA, Erdjument-Bromage H, Tempst P, Orkin SH. The ubiquitous subunit of erythroid transcription factor NF-E2 is a small basic-leucine zipper protein related to the v- maf oncogene. Proc Natl Acad Sci USA 1993; 90: Mignotte V, Eleouet J-F, Raich N, Romeo P-H. Cis- and trans-acting elements involved in the regulation of the erythroid promoter of the human porphobilinogen deaminase gene. Proc Natl Acad Sci USA 1989; 86: Ney PA, Sorrentino BP, Lowrey CH, Nienhuis AW. Inducibility of the HSII enhancer depends on binding of an erythroid specific nuclear protein. Nucleic Acids Res 1990; 18: Shivdasani RA, Orkin SH. Erythropoiesis and globin gene expression in mice lacking the transcription factor NF-E2. Proc Natl Acad Sci USA 1995; 92: Kotkow KJ, Orkin SH. Dependence of globin gene expression in mouse erythroleukemia cells on the NF-E2 heterodimer. Mol Cell Biol 1995; 15: Weiss JW, Orkin SH. GATA transcription factors: key regulators of hematopoiesis. Exp Hematol 1995; 23: Ngo Nyoung M, Trentesaux C, Aries A, Carpentier Y, Jardillier J-C, Gorisse M-C, Jeannesson P. Effect of aclacinomycin doxorubicin association on differentiation and growth of human erythroleu- Figure 4 Time-course of EPOR mrna expression in K562 cells treated with BA. Northern blot of total RNA from untreated and kemic K562 cells. Anticancer Res 1994; 14: mm and 1 mm BA-treated cells were hybridized simultaneously 18 Dean A, Erard F, Schneider AB, Schechter AN. Induction of hemowith EPOR and GAPDH radiolabeled cdnas, and submitted to auto- globin accumulation in human K562 cells by hemin is reversible. radiography. Data from a typical experiment. Science 1981; 212:
5 19 Jeannesson P, Lahlil R, Chénais B, Devy L, Gillet R, Aries A, Mor- R, Jardillier J-C. Induction of erythropoietin receptors during aclaceau F, Trentesaux C. Anthracyclines as tumor cell differentiating cinomycin-mediated erythroid differentiation of K562 leukemia agents: effects on the regulation of erythroid gene expression. Leuk cells. Leukemia 1991; 5: Lymphoma (in press). 23 Trentesaux C, Ngo Nyoung M, Aries A, Morceau F, Ronchi A, 20 Morceau F, Chénais B, Gillet R, Jardillier J-C, Jeannesson P, Tren- Ottolenghi S, Jardillier J-C, Jeannesson P. Increased expression of tesaux C. Transcriptional and post-transcriptional regulation of GATA-1 and NF-E2 erythroid transcription factors during aclacinoerythroid gene expression in anthracycline-induced differentiation mycin-mediated differentiation of human erythroleukemic cells. of human erythroleukemic cells. Cell Growth Differ 1996; 7: Leukemia 1993; 7: Morceau F, Aries A, Lahlil R, Devy L, Jardillier J-C, Jeannesson 21 Aries A, Trentesaux C, Ottolenghi S, Jardillier J-C, Jeannesson P, P, Trentesaux C. Evidence for distinct regulation processes in the Doubeikovski A. Activation of erythroid specific promoters during aclacinomycin and doxorubicin-mediated differentiation of anthracycline-induced differentiation of K562 cells. Blood 1996; human erythroleukemic cells. Biochem Pharmacol 1996; 51: 87: Jeannesson P, Trentesaux C, Ngo Nyoung M, Mayeux P, Jacquot 1579
Oxidative stress in K562 cells differentiation 1 OXIDATIVE STRESS INVOLVEMENT IN CHEMICALLY-INDUCED DIFFERENTIATION OF K562 CELLS.
Author manuscript, published in "Free Radical Biology and Medicine / Free Radical Biology & Medicine; Free Radicals in Biology and Medicine 28, 1 (2000) 18-27" Oxidative stress in K562 cells differentiation
More informationThioredoxin-interacting (TXNIP) protein regulates the differentiation of erythroid precursors
Thioredoxin-interacting (TXNIP) protein regulates the differentiation of erythroid precursors Volker Blank Lady Davis Institute for Medical Research McGill University www.scientificimages.co.uk INSTITUT
More informationCellular and Molecular Biology of Megakaryocyte Differentiation
Cellular and Molecular Biology of Megakaryocyte Differentiation in the Absence of Lineage-Restricted Transcription Factors PATRICK LECINE, RAMESH A. SHIVDASANI Departments of Medicine, The Dana-Farber
More informationAnalysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
More informationSupplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells
Supplementary Information Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells Stefan Schoenfelder, * Tom Sexton, * Lyubomira Chakalova, * Nathan
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationAkt targeting as a strategy to boost chemotherapy efficacy in non-small cell lung cancer through metabolism suppression.
Akt targeting as a strategy to boost chemotherapy efficacy in non-small cell lung cancer through metabolism suppression. Marion Le Grand 1,2, Raphael Berges 1, Eddy Pasquier 1,3, Marie-Pierre Montero 1,
More information2013 OTS Annual Meeting Pre-clinical Development of ALN-AS1 RNAi Therapeutic for the Treatment of Acute Intermittent Porphyria.
2013 OTS Annual Meeting Pre-clinical Development of ALN-AS1 RNAi Therapeutic for the Treatment of Acute Intermittent Porphyria October 8, 2013 Acute Intermittent Porphyria (AIP) Program Unmet Need and
More informationChapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
More informationApplication Note. Introduction
Simultaneously Measuring Oxidation of Exogenous and Endogenous Fatty Acids Using the XF Palmitate-BSA FAO Substrate with the Agilent Seahorse XF Cell Mito Stress Test Application Note Introduction The
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2005 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2005) offered
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationFocus Application. Compound-Induced Cytotoxicity
xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity Featured Study: Using the Time Resolving Function of the xcelligence System to Optimize Endpoint Viability and
More informationEML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3
EML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3 1 Department of Haematology, University of Cambridge, Cambridge, UK; 2 Dipartimento de Biotecnologie
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationDifferentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
More informationConversion of green note aldehydes into alcohols by yeast alcohol dehydrogenase
Conversion of green note aldehydes into alcohols by yeast alcohol dehydrogenase M.-L. Fauconnier 1, A. Mpambara 1, J. Delcarte 1, P. Jacques 2, P. Thonart 2 & M. Marlier 1 1 Unité de Chimie Générale et
More informationGlutathione Regulation
The Virtual Free Radical School Glutathione Regulation Dale A. Dickinson 1, Henry Jay Forman 1 and Shelly C. Lu 2 1 University of California, Merced, School of Natural Sciences, P.O. Box 2039, Merced,
More informationThe Two-step Liquid Culture: A Novel Procedure for Studying Maturation of Human Normal and Pathological Erythroid Precursors
The Two-step Liquid Culture: A Novel Procedure for Studying Maturation of Human Normal and Pathological Erythroid Precursors E. Fibach, E. A. Rachmilewitz Department of Hematology, Hadassah University
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationPlate-Based Assay Methods for the Assessment of Cellular Health
Plate-Based Assay Methods for the Assessment of Cellular Health Andrew L. Niles, Senior Research Scientist 2012, Promega Corporation. Biological Outcomes in Cell Culture Treatment -Small molecule -Bio-molecule
More informationالفريق االكاديمي الطبي HLS/ Biochemistry Sheet Porphyrin and Heme metabolism By: Shatha Khtoum
الفريق االكاديمي الطبي HLS/ Biochemistry Sheet Porphyrin and Heme metabolism By: Shatha Khtoum اا Today we will take about heme metabolism: -Heme is iron (Fe +2 ) with 4 pyrrole rings. -Its function it
More informationPedro A. Martinez, PhD December 7 th, 2015
RAP-536 (Murine ACE-536/Luspatercept) Inhibits Smad2/3 Signaling and Promotes Erythroid Differentiation By Restoring GATA-1 Function in Murine β-thalassemia Pedro A. Martinez, PhD December 7 th, 2015 Outline
More informationFocus Application. Compound-Induced Cytotoxicity
xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving
More informationThe Human Immunoglobulin Kappa Variable (IGKV) Genes and Joining (IGKJ) Segments
IMGT Locus on Focus Exp Clin Immunogenet 1998;15:171 183 Received: June 13, 1998 Valérie Barbié Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire, CNRS, Université Montpellier II, Montpellier,
More informationMembrane Fluidity Changes Are Associated with Benzo[a]Pyrene-Induced Apoptosis in F258 Cells
Membrane Fluidity Changes Are Associated with Benzo[a]Pyrene-Induced Apoptosis in F258 Cells Protection by Exogenous Cholesterol MORGANE GORRIA, a XAVIER TEKPLI, a ODILE SERGENT, b LAURENCE HUC, a FRANÇOIS
More informationStructure and Function of Fusion Gene Products in. Childhood Acute Leukemia
Structure and Function of Fusion Gene Products in Childhood Acute Leukemia Chromosomal Translocations Chr. 12 Chr. 21 der(12) der(21) A.T. Look, Science 278 (1997) Distribution Childhood ALL TEL-AML1 t(12;21)
More informationAnnals of Oncology Advance Access published January 10, 2005
Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g
More informationIn vitro DNase I foot printing. In vitro DNase I footprinting was performed as described
Supplemental Methods In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described previously 1 2 using 32P-labeled 211 bp fragment from 3 HS1. Footprinting reaction mixes contained
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationLi et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationLocus control regions
Review article Locus control regions Qiliang Li, Kenneth R. Peterson, Xiangdong Fang, and George Stamatoyannopoulos Introduction Locus control regions (LCRs) are operationally defined by their ability
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationThe Human Immunoglobulin Heavy Variable Genes
IMGT Locus on Focus Exp Clin Immunogenet 1999;16:36 60 Received: September 25, 1998 The Human Immunoglobulin Heavy Variable Genes Nathalie Pallarès a Sophie Lefebvre a Valérie Contet a Fumihiko Matsuda
More informationProblem-solving Test: The Mechanism of Protein Synthesis
Q 2009 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Vol. 37, No. 1, pp. 58 62, 2009 Problem-based Learning Problem-solving Test: The Mechanism
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationFunctional genomics reveal that the serine synthesis pathway is essential in breast cancer
Functional genomics reveal that the serine synthesis pathway is essential in breast cancer Results Presented by Stacey Lin Lloyd Lab http://www.amsbio.com/expression-ready-lentiviral-particles.aspx Overview
More informationStudy N 286V AGRI GERM /14
Study N 286V15-2015-01 1/14 TEST REPORT VIRUCIDAL ACTIVITY OF THE PRODUCT AGAINST THE ENTERIC CYTOPATHOGENIC BOVINE ORPHAN VIRUS (ECBO) Delivered to: For : Mme FELBACQ-SERRANO Laboratoires CEETAL 1, rue
More informationChapter 7 Conclusions
VII-1 Chapter 7 Conclusions VII-2 The development of cell-based therapies ranging from well-established practices such as bone marrow transplant to next-generation strategies such as adoptive T-cell therapy
More informationEffects of COX-2 Inhibitor on the Proliferation of MCF-7 and LTED MCF-7 Cells
Mahidol University Journal of Pharmaceutical Sciences 2008; 35(1-4): 47-51. Original Article Effects of COX-2 Inhibitor on the Proliferation of MCF-7 and LTED MCF-7 Cells K. Poemsantitham, N. Sookvanichsilp
More informationCRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
More informationDevelopment of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells
Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationCholesterol determination using protein-templated fluorescent gold nanocluster probes
Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,
More informationThe Human T cell Receptor Beta Variable (TRBV) Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:42 54 Received: July 3, 1999 The Human T cell Receptor Beta Variable (TRBV) Genes Géraldine Folch Marie-Paule Lefranc Laboratoire d ImmunoGénétique Moléculaire,
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationFeasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas
University of Groningen Feasibility of hyperthermia as a purging modality in autologous bone marrow transplantation Wierenga, Pieter Klaas IMPORTANT NOTE: You are advised to consult the publisher's version
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplemental Material for:
Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram,
More informationTumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
More informationLack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims
Kobe J. Med. Sci., Vol. 53, No. 4, pp. 151-155, 2007 Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims KAORU SAKURAI 1, NAOKI NISHIGUCHI 2, OSAMU SHIRAKAWA 2,
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationInhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor
International Journal of Cell Cloning 1: 142-150 (1983) Inhibition of Mwine CFU-C by Vindesine: Restoration of Colony Growth by Colony Stimulating Factor Giuseppe Pigoli, Lina Mangoni, Cecilia CaFamatti,
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationSpherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin
Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA
ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA 1Rosline H, 1Majdan R, 1Wan Zaidah A, 1Rapiaah M, 1Selamah G, 2A A Baba, 3D M Donald 1Department of Haematology, 2Department
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationDevelopment and Application of an Enteric Pathogens Microarray
Development and Application of an Enteric Pathogens Microarray UC Berkeley School of Public Health Sona R. Saha, MPH Joseph Eisenberg, PhD Lee Riley, MD Alan Hubbard, PhD Jack Colford, MD PhD East Bay
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationFactors controlling induction of commitment of murine erythroleukemia (TSA8) cells to CFU-E (colony forming unit-erythroid)
Development 101, 169-174 (1987) Printed in Great Britain The Company of Biologists Limited 1987 169 Factors controlling induction of commitment of murine erythroleukemia (TSA8) cells to CFU-E (colony forming
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationExpression of a Testis-Specific Form of TBP-Related Factor 2 (TRF2) mrna During Mouse Spermatogenesis
Journal of Reproduction and Development, Vol. 49, No. 1, 2003 Research Note Expression of a Testis-Specific Form of TBP-Related Factor 2 (TRF2) mrna During Mouse Spermatogenesis Shin SUGIURA 1), Shin-ichi
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationproperties of erythroid progenitor burst-forming cell
Proc. Natl. Acad. Sci. USA Vol. 8, pp. 3721-3725, June 1983 Cell Biology Isolation and induction of erythroleukemic cell lines with properties of erythroid progenitor burst-forming cell (BFU-E) and erythroid
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationCombining Calcium Phosphates with Polysaccharides: A Bone Inspired Material Modulating Monocyte/Macrophage Early Inflammatory Response
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Type of the Paper (Article) Combining Calcium Phosphates with Polysaccharides: A Bone Inspired Material Modulating Monocyte/Macrophage
More informationData Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621
Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T
More informationINTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells
Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,
More informationIII. Results and Discussion
III. Results and Discussion 1. Histological findings in the coronary artery Twenty-four swine had surgical treatments performed in two of the coronary arteries, LAD as well as either the LCX or RCA. A
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationErythropoietin triggers a burst of GATA-1 in normal human erythroid cells differentiating in tissue culture
.=. 1993 Oxford University Press Nucleic Acids Research, 1993, Vol. 21, No. 17 431-437 Erythropoietin triggers a burst of GATA-1 in normal human erythroid cells differentiating in tissue culture Nava Dalyot,
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationIN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS
292 Tang, An, Du, Zhang, Zhou 292 IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS Qin-qing Tang, a Xiao-jing An, a Jun Du, a Zheng-xiang Zhang, a Xiao-jun Zhou a
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationSupplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells
Cell Chemical Biology, Volume 24 Supplemental Information Inhibition of the Proteasome b2 Site Sensitizes Triple-Negative Breast Cancer Cells to b5 Inhibitors and Suppresses Nrf1 Activation Emily S. Weyburne,
More informationModulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis
icell Skeletal Myoblasts Application Protocol Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis Introduction The skeletal muscle is one of the
More informationThe Human T Cell Receptor Alpha Variable (TRAV) Genes
IMGT Locus in Focus Exp Clin Immunogenet 2000;17:83 96 Received: September 23, 1999 The Human T Cell Receptor Alpha Variable (TRAV) Genes Dominique Scaviner Marie-Paule Lefranc Laboratoire d ImmunoGénétique
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationBreeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationThe levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,
Supplemental material Supplemental method RNA extraction, reverse transcription, and real-time PCR The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided
More informationObjective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More information