Supplemental Material for:
|
|
- Noreen Adams
- 5 years ago
- Views:
Transcription
1 Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram, Woojin Kim, Stuart H. Orkin* *To whom correspondence should be addressed.
2 Supplemental Materials and Methods Flow cytometry Cells at various stages of differentiation were analyzed by flow cytometry using FACSCalibur (BD Biosciences, San Jose, CA). Live cells were identified and gated by exclusion of 7-amino-actinomycin D (7-AAD; BD Pharmingen). The cells were analyzed for expression of cell surface receptors with antibodies specific for CD34, CD45, CD71, CD235, and CD36 conjugated to phycoerythrin (PE), fluorescein isothiocyanate (FITC), or allophycocyanin (APC; BD Pharmingen). Data were analyzed using FlowJo software (Ashland, OR). Cytology Cytocentrifuge preparations were stained with May-Grunwald-Giemsa as previously described (Sankaran et al. 28). Real-time RT-PCR Real-time quantitative RT-PCR was performed using the iq SYBR Green Supermix (Bio- Rad). The following primers were used for real-time RT-PCR: human and mouse BCL11A-XL (forward, 5 -ATGCGAGCTGTGCAACTATG-3 ; reverse, 5 - GTAAACGTCCTTCCCCACCT-3 ), human and mouse BCL11A-L (forward, 5 - CAGCTCAAAAGAGGGCAGAC-3 ; reverse, 5 -GAGCTTCCATCCGAAAACTG-3 ), and human BCL11A exon 1 and 2 (common between all known isoforms; forward, 5 - AACCCCAGCACTTAAGCAAA-3 ; reverse, 5 -GGAGGTCATGATCCCCTTCT-3 ).
3 Supplemental Figure Legends Supplemental Figure 1. Expression of BCL11A isoforms in human and mouse erythroid cells. (A) Schematic diagram of human BCL11A isoforms (Liu et al. 26). The antibodies used for ChIP experiments and their corresponding epitopes are indicated. Locations of primers used for RT-PCR analysis of all BCL11A isoforms (forward and reverse primers indicated by arrowheads), XL and L isoforms are indicated. (B) Relative mrna expression of human BCL11A XL and L isoforms in adult human proerythroblasts (Pro-E) were quantified by real-time RT-PCR. Transcript levels were normalized against human GAPDH transcript levels. (C) Relative mrna expression of mouse Bcl11a XL and L isoforms in mouse erythroleukemia (MEL) cells and FACS-sorted Ter119 + CD71 + E14 fetal liver erythroid cells were quantified by real-time RT-PCR. Transcript levels were normalized against mouse Gapd transcript levels. Supplemental Figure 2. Lack of genome-wide cooccupancy between BCL11A, H3K4me3, and H3K27me3. (A) De novo BCL11A motif search was performed in SeqPos using MDscan algorithm (Liu et al. 22) (B) Venn diagram of genome-wide colocalization of BCL11A, H3K4me3, and H3K27me3 ChIP-chip sites in adult human erythroid cells. (C) Genome-wide analysis of BCL11A, H3K4me3, H3K27me3 cooccupancy. Scatter plots displays mutual enrichment between indicated ChIP-chip datasets relative to the input. Correlation values are shown. Supplemental Figure 3. Expression of human β-like globin genes in β-yac transgenic mice. Relative mrna expression of human ε-, γ- and β-globin ain
4 E14.5 fetal liver erythroid cells from wild-type (YAC + ; Bcl11a +/+ ) and mutant (YAC + ; Bcl11a -/- ) mice were measured by qrt-pcr. Transcript levels were normalized against mouse Gapd transcript levels and calculated as percentage of total human β-like globin expression. The same cells were used for chromatin conformation capture (3C) experiments as described in Figure 2. All results are means ± SEM. Supplemental Figure 4. Expression of cell surface markers during ex vivo erythroid differentiation. CD34+ human hemotopoietic progenitors at day 3 in expansion phase (shaded histogram) and ex vivo differentiated erythroid precursors at day 5 in differentiation phase (open histogram) were analyzed by flow cytometry for expression of CD34, CD45, CD71 (transferrin receptor), CD235 (glycophorin A), and CD36 antigens. Supplemental Figure 5. Expression of human β-like globin genes during ex vivo erythroid differentiation. Relative mrna expression of human ε-, γ- and β- globin at various stages during ex vivo maturation was quantified by real-time RT-PCR. The percentage of β-globin (β/ε+γ+β) is indicated at the top of the diagram. Supplemental Figure 6. Expression of human BCL11A and SOX6 during erythroid differentiation. Human BCL11A and SOX6 mrna levels were measured by real-time RT-PCR. Transcript levels were normalized against human GAPDH transcript levels. All results are means ± s.d. of at least three independent experiments.
5 Supplemental Figure 7. Physical interaction between BCL11A and SOX6. FLAGtagged SOX6 cdna was coexpressed in COS7 cells with V5-tagged Vector, BCL11A, GATA1, and MTA2 cdna, respectively. Nuclear extracts were immunoprecipitated using anti-flag antibody, and copurified proteins were analyzed by Western blot with anti-v5 antibody. Inputs (1%) are shown. Supplemental Figure 8. Chromatin occupancy of BCL11A, SOX6, and GATA1 at the human β-globin cluster. In vivo chromatin occupancy of BCL11A, SOX6, GATA1, and RNA polymerase II (Pol II) was examined by ChIP-qPCR in human erythroid progenitors. Normal rabbit IgG was used as a negative control. Precipitated DNA samples were quantified using primers designed to amplify discrete regions across the human β-globin locus. The ChIP signals are shown as a percentage of the input DNA signal and are representative of three independent experiments. The human β-globin locus is depicted at the top containing five β-like globin genes (ε, Gγ, Aγ, δ, and β), flanked by the upstream locus control regions (LCR) and the downstream hypersensitive site (3 HS1). Supplemental Figure 9. Morphology of ex vivo differentiated erythroid precursors. At day 5 of differentiation, the cells appear to be morphologically indistinguishable shown by May-Grunwald-Giemsa staining of cytospins. This is also the case at other stages of differentiation. Supplemental Figure 1. SOX6 contributes to silencing of HbF expression. HPLC analysis of hemolysates shows the presence of mature HbF. The HbF peaks are
6 labeled with an arrow in each chromatogram, with the first peak corresponding to acetylated HbF (Garlick et al. 1981) and the second unmodified HbF. References Garlick, R.L., Shaeffer, J.R., Chapman, P.B., Kingston, R.E., Mazer, J.S., and Bunn, H.F Synthesis of acetylated human fetal hemoglobin. J Biol Chem 256(4): Liu, H., Ippolito, G.C., Wall, J.K., Niu, T., Probst, L., Lee, B.S., Pulford, K., Banham, A.H., Stockwin, L., Shaffer, A.L., Staudt, L.M., Das, C., Dyer, M.J., and Tucker, P.W. 26. Functional studies of BCL11A: characterization of the conserved BCL11A-XL splice variant and its interaction with BCL6 in nuclear paraspeckles of germinal center B cells. Mol Cancer 5: 18. Liu, X.S., Brutlag, D.L., and Liu, J.S. 22. An algorithm for finding protein-dna binding sites with applications to chromatin-immunoprecipitation microarray experiments. Nat Biotechnol 2(8): Sankaran, V.G., Menne, T.F., Xu, J., Akie, T.E., Lettre, G., Van Handel, B., Mikkola, H.K., Hirschhorn, J.N., Cantor, A.B., and Orkin, S.H. 28. Human Fetal Hemoglobin Expression Is Regulated by the Developmental Stage-Specific Repressor BCL11A. Science 322(599):
7 Supplemental Figure 1 A Exon 1 18 aa Exon 2 11 aa Exon XS 14 aa Exon 3 34 aa Exon aa Exon 5 33 aa (S) 29 aa (L) 5 UTR Antibodies used for ChIP Primers used for RT-PCR all BCL11A.ab1 BCL11A.ab2 BCL11A.ab aa aa aa XL XL 5.9 kb, 835 aa L L 4. kb, 773 aa S 2.4 kb, 243 aa XS 1.5 kb, 142 aa ORF Proline-Rich NuRD Interacting Domain C2HC ZnF C2H2 ZnF NLS ( aa) B Relative mrna BCL11A (XL) BCL11A (L) C Relative mrna Bcl11a (XL) Bcl11a (L) Human Pro-E MEL E14 FL Pro-E
8 Supplemental Figure 2 A B BCL11A 18 sites H3K27me3 52 sites H3K4me3 655 sites C H3K4me3 ChIP-chip signal 2. r = H3K27me3 ChIP-chip signal 2. r = r = BCL11A.ab1 ChIP-chip signal BCL11A.ab1 ChIP-chip signal H3K4me3 ChIP-chip signal H3K27me3 ChIP-chip signal
9 Supplemental Figure 3 % of total human β-like globin expression YAC ; Bcl11a + YAC ; Bcl11a +/+ -/- ε γ β
10 Supplemental Figure Counts Counts CD34 CD Counts Counts CD71 CD Counts CD36
11 Supplemental Figure % of mrna expression β /ε +γ +β γ /ε +γ +β Days in Differentiation
12 Supplemental Figure 6 Relative mrna Relative mrna BCL11A Days in Differentiation SOX Days in Differentiation
13 Supplemental Figure 7 Vector BCL11A GATA1 MTA2 WB IP: FLAG 1 kda 75 α-v5 5 V5 Input 1 75 α-v5 5 FLAG Input α-flag (SOX6)
14 Supplemental Figure 8 Relative enrichment (% of input) LCR ε Gγ Aγ δ β 3 HS Position (Kb) BCL11A SOX6 GATA1 Pol II IgG
15 Supplemental Figure 9 Control BCL11A shrna SOX6 shrna BCL11A+SOX6
16 Supplemental Figure 1 Control shrna BCL11A shrna SOX6 shrna BCL11A+SOX6 9.2% HbF 35.6% HbF 19.6% HbF 53.8% HbF
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationHosoya et al. TRIM28 is essential for erythroblast differentiation in the mouse (supplemental information)
TaqMan assay Gene TRIM28 GATA-1 Applied Biosystems TaqMan assay Mm00495594_m1 Mm01352636_m1 SYBR Green assay Gene Forward primer Reverse primer Reference adult α-globin CCCGGTGCCTTGTCTGCT GTGAAATCGGCAGGGTGG
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationSupplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationGamma gene expression in haemoglobin disorders
Gamma gene expression in haemoglobin disorders Innovative therapies for Red Cell and Iron related disorders EHA / ESH : April 16-18, Cascais, Portugal Swee Lay Thein King s College London School of Medicine
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationFOXO3 Regulates Fetal Hemoglobin Levels in Sickle Cell Anemia. Yankai Zhang, Jacy R. Crosby, Eric Boerwinkle, Vivien A. Sheehan
FOXO3 Regulates Fetal Hemoglobin Levels in Sickle Cell Anemia Yankai Zhang, Jacy R. Crosby, Eric Boerwinkle, Vivien A. Sheehan Sickle Cell Anemia Steinberg MH. N Engl J Med 1999;340:1021-1030. Akinsheye
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationSupplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
More informationAn Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationTransduction of lentivirus to human primary CD4+ T cells
Transduction of lentivirus to human primary CD4 + T cells Human primary CD4 T cells were stimulated with anti-cd3/cd28 antibodies (10 µl/2 5 10^6 cells of Dynabeads CD3/CD28 T cell expander, Invitrogen)
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationEukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationNature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
More informationCRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationNature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationNature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.
a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationTranscription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationPolycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
More informationGenetic Studies of Human Hematopoiesis
Genetic Studies of Human Hematopoiesis Vijay G. Sankaran, M.D., Ph.D. sankaran@broadinstitute.org @bloodgenes August 23, 2018 SWISSTRANSFUSION 2018 A Perspective on Hematopoiesis Laurenti & Gottgens, Nature,
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationNature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationChipSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation
Center for Biomics ChipSeq Technique and science The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Wilfred van IJcken Sequencing Seminar Illumina September 8 Scheme
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationThe Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice
Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationAnalysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4
Khozoie et al. BMC Genomics 2012, 13:665 RESEARCH ARTICLE Open Access Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4 Combiz Khozoie
More informationSupplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationUniversity of Miami Miller School of Medicine, Miami, FL 33136, USA, 3 State Key Laboratory
Supplementary File ASXL1 plays an important role in erythropoiesis Hui Shi 1,2,3, Shohei Yamamoto 1,2,4, Mengyao Sheng 3, Jie Bai 3, Peng Zhang 1,2, Runze Chen 1,2, Shi Chen 1,2, Lihong Shi 3, Omar Abdel-Wahab
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSupplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationStatistical Assessment of the Global Regulatory Role of Histone. Acetylation in Saccharomyces cerevisiae. (Support Information)
Statistical Assessment of the Global Regulatory Role of Histone Acetylation in Saccharomyces cerevisiae (Support Information) Authors: Guo-Cheng Yuan, Ping Ma, Wenxuan Zhong and Jun S. Liu Linear Relationship
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationTable S1. Total and mapped reads produced for each ChIP-seq sample
Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3
More informationFunctional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationThe BCL11A-XL expression predicts relapse in squamous cell carcinoma and large cell carcinoma
Original Article The BCL11A-XL expression predicts relapse in squamous cell carcinoma and large cell carcinoma Na Zhang 1,2, Ben-Yuan Jiang 2, Xu-Chao Zhang 2, Zhi Xie 2, Jian Su 2, Qi Zhang 2, Jie-Fei
More informationSupplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of
Supplemental Figure S1. A. Venn diagram depicting overlap between anti-correlated genes of 1,000 most differentially expressed genes with NKX2-1 amplification in lung adenocarcinoma cell lines and anti-correlated
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationChIPSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation
Center for Biomics ChIPSeq Technique and science The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Wilfred van IJcken EU Sequencing Seminar Illumina June 16 Genomics
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationMechanisms of alternative splicing regulation
Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationSenior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University
Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More information