Table 1A. Genes enriched as over-expressed in DPM treatment group
|
|
|
- Gavin Wood
- 5 years ago
- Views:
Transcription
1 Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description Npy NM_ Mus musculus neuropeptide Y (Npy), mrna NC_ gi ref NC_ : , trna-his Ifit3 NM_ Mus musculus interferon-induced protein with tetratricopeptide repeats 3 (Ifit3), mrna NC_ gi ref NC_ : , trna-thr Loxl3 NM_ Mus musculus lysyl oxidase-like 3 (Loxl3), mrna Itgb3 NM_ Mus musculus integrin beta 3 (Itgb3), mrna Trim30 NM_ Mus musculus tripartite motif-containing (Trim30), mrna Emb NM_ Mus musculus embigin (Emb), mrna ENSMUST cdna:known chromosome:ncbim37:9: : :1 gene:ensmusg Six1 NM_ Mus musculus sine oculis-related homeobox homolog (Drosophila) (Six1), mrna Hpse2 BC Mus musculus similar to Heparanase-2 (Hpa2), mrna (cdna clone MGC: IMAGE: ), complete cds Vcan NM_ Mus musculus versican (Vcan), transcript variant 1, mrna Loxl4 BC Mus musculus cdna clone IMAGE: , partial cds Smr2 NM_ Mus musculus submaxillary gland androgen regulated protein 2 (Smr2), mrna Wfdc5 NM_ Mus musculus WAP four-disulfide core domain (Wfdc5), mrna Cpm NM_ Mus musculus carboxypeptidase M (Cpm), mrna Klk10 NM_ Mus musculus kallikrein related-peptidase (Klk10), mrna Mme NM_ Mus musculus membrane metallo endopeptidase (Mme), mrna mmu-mir-140 MI Mus musculus mir-140 stem-loop Amtn ENSMUST Amelotin gene:ensmusg Mup5 NM_ Mus musculus major urinary protein 5 (Mup5), ENSMUST NC_ // NC_ mrna. cdna:known chromosome:ncbim37:2: : :-1 gene:ensmusg gi ref NC_ : , trna-ser // gi ref NC_ : , trna-leu Lect1 NM_ Mus musculus leukocyte cell derived chemotaxin 1 (Lect1), mrna
2 Table 1B. s enriched as under-expressed in DPM treatment group Affy Probeset mrna Accession Description Slc47a1 NM_ solute carrier family 47, member 1 (Slc47a1) BC NM_ cdna sequence BC (BC018465) Mup1 NM_ major urinary protein 1 (Mup1), transcript variant Mup2 NM_ major urinary protein 2 (Mup2), transcript variant U46068 NM_ cdna sequence U46068 (U46068), transcript variant Gjb2 NM_ gap junction protein, beta 2 (Gjb2) Mup2 NM_ major urinary protein 2 (Mup2), transcript variant Vmn2r96 NM_ vomeronasal 2, receptor 96 (Vmn2r96) Mup7 NM_ predicted gene (Gm12546) Fbp1 NM_ fructose bisphosphatase 1 (Fbp1) EG FJ endogenous virus Friend spleen focus-forming virus (SFFVp) cell-line DS19-sc9 envelope glycoprotein 52 mrna, complete cds Cox8b NM_ cytochrome c oxidase, subunit VIIIb (Cox8b), nuclear gene encoding mitochondrial protein Thrsp NM_ thyroid hormone responsive SPOT14 homolog (Rattus) (Thrsp) Pdk4 NM_ pyruvate dehydrogenase kinase, isoenzyme (Pdk4).
3 Table 2A. Functional enrichment (based on GO Biological Process) of genes overexpressed in DPM treatment group using DAVID. Annotation Cluster 1 Enrichment Score: 4.4 Count P_Value Benjamin i SP_PIR_KEYWORDS signal E-8 1.7E-5 UP_SEQ_FEATURE signal peptide E-7 2.6E-4 SP_PIR_KEYWORDS glycoprotein E-5 2.5E-3 SP_PIR_KEYWORDS disulfide bond E-5 4.2E-3 UP_SEQ_FEATURE glycosylation site:n-linked (GlcNAc...) E-4 3.7E-2 UP_SEQ_FEATURE disulfide bond E-4 5.8E-2 Annotation Cluster 2 Enrichment Score: 4.53 Count P_Value Benjamin i GOTERM_CC_FAT extracellular region E-6 1.6E-4 SP_PIR_KEYWORDS Secreted E-5 1.9E-3 GOTERM_CC_FAT extracellular region part E-3 4.4E-2 Annotation Cluster 3 Enrichment Score: 3.47 Count P_Value Benjamin i GOTERM_BP_FAT cell adhesion E-5 5.1E-2 GOTERM_BP_FAT biological adhesion E-5 2.6E-2 SP_PIR_KEYWORDS cell adhesion E-4 2.5E-2 INTERPRO EGF-like region, conserved site 8 4.1E-3 2.9E-1 Table 2B. Functional enrichment (based on GO Biological Process) of genes under-expressed in DPM treatment group using DAVID. Annotation Cluster 1 Enrichment Score: 4.4 Count P_Value Benjamini GOTERM_CC_FAT extracellular region E-9 9.1E-8 SP_PIR_KEYWORDS Secreted E-7 1.6E-5 SP_PIR_KEYWORDS signal E-7 1.3E-5 UP_SEQ_FEATURE signal peptide E-6 3.0E-4 SP_PIR_KEYWORDS disulfide bond E-3 1.6E-1 UP_SEQ_FEATURE disulfide bond E-2 8.0E-1 SP_PIR_KEYWORDS glycoprotein E-2 4.6E-1 UP_SEQ_FEATURE glycosylation site:n-linked (GlcNAc...) E-2 9.8E-1
4 Table 3. Cell growth, proliferation and migration related functions of those genes differentially-enriched in the DPM treatment group Function Up-regulated Down-regulated Cell adhesion Mme, Edil3, Lypd3, Amtn, Vcan, Cldn2, Dsc1 Ccdc80, Col11a1, Dsg3, Emb, Flrt3, Itgb4, Itgb3, Lgals3bp, Llgl2, Pcdh9, Tubb2b, Tnc, Thbs Negative regulation of H19, Npy cell proliferation Apoptosis Sap30bp, Casp1, Casp12, Casp1, Xaf1, Slc5a8 Autophagy Wipi1 Anti-angiogenesis Lect1 MAPKKK cascade Gadd45b, Plce1, Prkca, Map3k3 Tumorigenesis Klk10 * Bold font indicates gene validated by qpcr and by western blotting
5 Table 4. Comparison of gene expression fold changes between microarray and qpcr. Up-regulated from Microarray Down-regulated from Microarray (RT-qPCR) (microarray) (RT-qPCR) (microarray) Npy Slc47a Ifit BC Loxl Mup Itgb Mup2 (transcript variant 2) Trim U Emb Gjb Six Mup2 (transcript variant 1) Hpse Vmn2r Vcan Mup Loxl Fbp Smr EG Wfdc Cox8b Cpm Thrsp Klk Pdk Mme Amtn Mup Lect
6 Table 5. Differentially expressed mirnas in DPM treatment group Affy Probeset Up-regulated (qpcr) (array) Affy Probeset Down-regulated (qpcr) (array) mmu-mir-455-star_st N.D mmu-mir-322_st N.D v11_mmu-mir-685_st mmu-mir-148b_st N.D mmu-mir-140-star_st mmu-mir-139-5p_st N.D mmu-mir-1937b_st mmu-mir-181a-1- N.D star_st mmu-mir-140_st mmu-let-7d-star_st N.D v11_mmu-mir-699_st N.D mmu-mir-101b_st N.D mmu-mir-1937a_st mmu-mir-148astar_st N.D mmu-mir-455_st mmu-mir-10b_st N.D mmu-mir-711_st mmu-mir-203_st mmu-mir-10a_st N.D. N.D mmu-mir-466b-3p_st N.D mmu-mir-1274a_st N.D mmu-mir-532-3p_st N.D hp_mmu-mir-465c-2_s_st N.D mmu-mir-434-3p_st N.D mmu-mir-712_st N.D mmu-mir-466e-3p_st N.D mmu-mir-503_st N.D mmu-mir-98_st N.D mmu-mir-1931_st N.D mmu-mir-375_st N.D mmu-mir-298_st N.D mmu-mir-193_st N.D mmu-mir-1949_st mmu-mir-329_st N.D mmu-mir p_st N.D mmu-mir-128_st N.D mmu-mir-2133_st N.D mmu-mir-1895_st N.D hp_mmu-mir-465c-1_s_st N.D mmu-mir-148a_st mmu-mir-214_st mmu-mir-467e_st N.D mmu-mir-326_st N.D v11_mmu-mir-467astr_st N.D mmu-mir-351_st mmu-mir-15b_st mmu-mir-762_st mmu-mir-125a-5p_st mmu-mir-150_st N.D mmu-mir-374_st N.D mmu-mir-133a_st N.D mmu-mir-34c-star_st N.D mmu-mir-690_st N.D. N.D.= not determined, or not detectable by qpcr
Supplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
A bioinformatics driven cancer study
The 11th China-Japan-Korea Bioinformatics Training Course & Symposium, June 16-18, Suzhou, China A bioinformatics driven cancer study Chao Li and Yixue Li yxli@sibs.ac.cn Shanghai Institutes for Bio-Medicine
Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
Growth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
SUPPLEMENTAL TABLE AND FIGURES
SUPPLEMENTAL TABLE AND FIGURES Zhang et al. (29) - Enzymes in the NAD + Salvage Pathway Regulate SIRT1 Activity at Target Gene Promoters This document contains supplemental data (1 table and 6 figures)
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
CONTRACTING ORGANIZATION: Oregon Health and Science University Portland, Oregon
AD AWARD NUMBER: W81XWH-05-1-0152 TITLE: A Novel Mechanism of Androgen Receptor Action PRINCIPAL INVESTIGATOR: Charles T. Roberts, Jr., Ph.D. CONTRACTING ORGANIZATION: Oregon Health and Science University
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Proteome analysis of human amniotic mesenchymal stem cells (h A-MSCs) reveals impaired
Supplementary Information for Proteome analysis of human amniotic mesenchymal stem cells (h A-MSCs) reveals impaired antioxidant ability, cytoskeleton and metabolic functionality in maternal obesity Valentina
Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)
MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
Phospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
Supplementary figures legends
Supplementary Information to Nijmegen Breakage Syndrome fibroblasts and ipscs: cellular models for uncovering diseaseassociated signaling pathways and establishing a screening platform for anti-oxidants
The T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
Mutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals
Mutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals Jong-Gyu Lee 1,2, Ji-Hye Ahn 1,2, Tae Jin Kim 3, Jae Ho Lee 4, and Jung-Hye Choi 1,2 Table S1. Primer
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
The Transcriptional Response to Irradiation: Time to Move the Focus from Cellular to Tissutal Level
Laboratory of Functional Genomics and Proteomics of Model System Rodolfo Negri Sapienza Università di Roma The Transcriptional Response to Irradiation: Time to Move the Focus from Cellular to Tissutal
A novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary information for: Community detection for networks with. unipartite and bipartite structure. Chang Chang 1, 2, Chao Tang 2
Supplementary information for: Community detection for networks with unipartite and bipartite structure Chang Chang 1, 2, Chao Tang 2 1 School of Life Sciences, Peking University, Beiing 100871, China
Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal
24 Ayman Mesleh & Leen Alnemrawi Bayan Abusheikha Faisal We were talking last time about receptors for lipid soluble hormones.the general mechanism of receptors for lipid soluble hormones: 1. Receptors
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
Sequence Coverage (%) Profilin-1 P UD 2
Protein Name Accession Number (Swissprot) Sequence Coverage (%) No. of MS/MS Queries Mascot Score 1 Reference Cytoskeletal proteins Beta-actin P60709 37 14 298 Alpha-actin P68032 33 10 141 20 Beta-actin-like
Insight into cancer research from discovery to validation
Insight into cancer research from discovery to validation 1 Exosomes in cancer research: from exosome isolation to biomarker discovery Zheng Songyue, PhD Technical Sales Specialists Life Technologies The
Supplementary Table 1 : Transcripts and pathways up-regulated in SLE compared to control renal biopsies
Supplementary Table 1 : Transcripts and pathways up-regulated in SLE compared to control renal biopsies Differences in (Log2-transformed, mean-centered) gene expression between lupus and control biopsies
Cell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-15 FUNDAMENTALS OF CELL BIOLOGY AND BIOCHEMISTRY BIO-4004B Time allowed: 2 hours Answer ALL questions in Section
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
Discovery. Gerry Graham* and Rob Nibbs SUMMARY BACKGROUND
D6 Gerry Graham* and Rob Nibbs Cancer Research Campaign Laboratories, The Beaton Institute for Cancer Research, Garscube Estate Switchback Road, Bearsdon, Glasgow G61 1BD, UK * corresponding author tel:
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
mirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
Identification of mirnas in Eucalyptus globulus Plant by Computational Methods
International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational
BCM 226 LECTURE SALEMCITY, A.J
BCM 226 LECTURE SALEMCITY, A.J BIOLOGICAL MEMBRANE Biological membranes are composed of proteins associated with a lipid bilayer matrix. They are the molecular gateway to the cell. Viewed under electron
CHANGES IN GENE EXPRESSION RELATED TO DECLINE OF THE AGING IMMUNE SYSTEM
CHANGES IN GENE EXPRESSION RELATED TO DECLINE OF THE AGING IMMUNE SYSTEM HHMI Summer 2012 Oregon State University Student: Jenny Tran Mentor: Adrian F. Gombart, Ph.D. My project involves Studying age-
Follicle-Stimulating Hormone (Follitropin) As many people know, the vast complexities and intricacies involved in the
Wayne Heath Professor Champlin BIO 421 19 February 2014 Follicle-Stimulating Hormone (Follitropin) As many people know, the vast complexities and intricacies involved in the functioning of the human body
MCB 4211 Basic Immunology 2nd Exam; 10/26/17 Peoplesoft #:
For this first section, circle the letter that precedes the best answer for each of the following multiple-choice questions. LOOK AT ALL ALTERNATIVES BEFORE CHOOSING YOUR ANSWER. 1. The TcR (T cell receptor)
NFκB What is it and What s the deal with radicals?
The Virtual Free Radical School NFκB What is it and What s the deal with radicals? Emily Ho, Ph.D Linus Pauling Institute Scientist Department of Nutrition and Food Management Oregon State University 117
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
Significance and Functions of Carbohydrates. Bacterial Cell Walls
Biochemistry 462a - Carbohydrate Function Reading - Chapter 9 Practice problems - Chapter 9: 2, 4a, 4b, 6, 9, 10, 13, 14, 15, 16a, 17; Carbohydrate extra problems Significance and Functions of Carbohydrates
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
Gene-microRNA network module analysis for ovarian cancer
Gene-microRNA network module analysis for ovarian cancer Shuqin Zhang School of Mathematical Sciences Fudan University Oct. 4, 2016 Outline Introduction Materials and Methods Results Conclusions Introduction
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
Introduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 2 Questions of the Day: How does the hormone insulin trigger the uptake of glucose in the cells that it targets. Introduction! Signal transduction
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
Biol403 MAP kinase signalling
Biol403 MAP kinase signalling The mitogen activated protein kinase (MAPK) pathway is a signalling cascade activated by a diverse range of effectors. The cascade regulates many cellular activities including
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system
Cell Biology Lecture 9 Notes Basic Principles of cell signaling and GPCR system Basic Elements of cell signaling: Signal or signaling molecule (ligand, first messenger) o Small molecules (epinephrine,
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Diabetes Mellitus and Breast Cancer
Masur K, Thévenod F, Zänker KS (eds): Diabetes and Cancer. Epidemiological Evidence and Molecular Links. Front Diabetes. Basel, Karger, 2008, vol 19, pp 97 113 Diabetes Mellitus and Breast Cancer Ido Wolf
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
Endocrine pharmacology (3)
بسم رلا هللا Endocrine pharmacology (3) Natural hormone characterized by short of action : a lot of them ineffective orally ( for example ), but when we give it from outside it enters the body exactly
Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
Paul J. Davis, MD. Albany Medical College and Pharmaceutical Research Institute, Albany College of Pharmacy and Health Sciences, Albany, NY USA
ANTI-APOPTOTIC AND PRO- ANGIOGENIC PROPERTIES OF ENDOGENOUS THYROID HORMONE AND ITS ACTION ON P-GLYCOPROTEIN MAY BLUNT RESPONSE TO CONVENTIONAL CHEMOTHERAPY Paul J. Davis, MD Albany Medical College and
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Cell Physiology Final Exam Fall 2008
Cell Physiology Final Exam Fall 2008 Guys, The average on the test was 69.9. Before you start reading the right answers please do me a favor and remember till the end of your life that GLUCOSE TRANSPORT
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
Regarding techniques of proteomics, there is:
Molecular الحلقة biology 14 واألخيرة To put you back in the context; the discussion was about Trancriptomics (the study of transcription). The following topic will be PROTEOMICS, which is the study of
FIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302
FIRST BIOCHEMISTRY EXAM Tuesday 25/10/2016 10-11 40 MCQs. Location : 102, 105, 106, 301, 302 The Behavior of Proteins: Enzymes, Mechanisms, and Control General theory of enzyme action, by Leonor Michaelis
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Bioinformation by Biomedical Informatics Publishing Group
Predicted RNA secondary structures for the conserved regions in dengue virus Pallavi Somvanshi*, Prahlad Kishore Seth Bioinformatics Centre, Biotech Park, Sector G, Jankipuram, Lucknow 226021, Uttar Pradesh,
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
Cell Communication. Local and Long Distance Signaling
Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life
Intrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings
Concept 5.4: Proteins have many structures, resulting in a wide range of functions Proteins account for more than 50% of the dry mass of most cells Protein functions include structural support, storage,
Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
FGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student