Research Article Early Oral Ovalbumin Exposure during Maternal Milk Feeding Prevents Spontaneous Allergic Sensitization in Allergy-Prone Rat Pups

Transcription

1 Hindwi Pulishing Corportion Clinicl nd Developmentl Immunology Volume 212, Article ID , 1 pges doi:1.1155/212/ Reserch Article Erly Orl Ovlumin Exposure during Mternl Milk Feeding Prevents Spontneous Allergic Sensitiztion in Allergy-Prone Rt Pups Adweyh El-Merhii, 1 Kerry Lymn, 1 Irene Knter, 1 ndirmelia.penttil1, 2, 3 1 Women s nd Children s Helth Reserch Institute, North Adelide, SA, 56, Austrli 2 Discipline of Peditrics, Deprtment of Helth Sciences, University of Adelide, SA, 55, Austrli 3 Discipline of Medicine, Deprtment of Helth Sciences, University of Adelide, SA, 55, Austrli CorrespondenceshouldeddressedtoIrmeliA.Penttil,irmeli.penttil@delide.edu.u Received 1 My 211; Revised 9 August 211; Accepted 8 Septemer 211 Acdemic Editor: Vlerie Verhsselt Copyright 212 Adweyh El-Merhii et l. This is n open ccess rticle distriuted under the Cretive Commons Attriution License, which permits unrestricted use, distriution, nd reproduction in ny medium, provided the originl work is properly cited. There re conflicting dt to support the prctice of delying the introduction of llergenic foods into the infnt diet to prevent llergy development. This study investigted immune response development fter erly orl egg ntigen (Ovlumin; OVA) exposure in rt pup model. Brown Norwy (BN) rt pups were rndomly llocted into groups: dm rered (), pups chllenged dily (dys 4 13) with orl OVA ( + OVAc), pups chllenged intermittently (on dy 4, 1, 12, nd 13) with orl OVA( + OVAi), formul-fed pups (), nd pups chllenged dily with orl OVA ( + OVA). Immune prmeters ssessed included OVA-specific serum IgE, IgG1, nd IgA. Ilel nd splenic messenger rionucleic cid (mrna) expression of trnsforming growth fctor-et (TGF-β1), mothers ginst decpentplegic (Smd) 2/4/7, nd forkhed ox P3 (Foxp3) were determined. Ileum ws stined for TGF-β1ndSmd4.Results. Feeding OVA dily to pups mintined systemic nd locl gut ntiody nd immunoregultory mrker mrna responses. Systemic TGF-β1 ws lower in + OVAi pups compred to nd + OVAc pups. Feeding OVA to pups resulted in significntly greter OVA-specific IgE nd IgG1, nd lower IgA nd TGF-β1 nd Smd expression compred to pups. Conclusions. Erly dily OVA exposure in the presence of mternl milk mintins immunemrkersssocited with regulted immune response, preventing erly llergic sensitiztion. 1. Introduction Allergic disese rises due to complex interction etween genetic predisposition nd environmentl fctors, rest or formul feeding nd ptterns of erly microil exposure [1 3]. The most common food llergies emerging in young infnts re to egg nd penut ntigens. Approximtely 6 8% of children under three yers of ge re ffected, with the incidence of these llergies incresing [4 7]. Food llergy to milk nd eggs typiclly disppers y ge three to five, however there re dt to suggest tht the nturl history of food llergy my e chnging nd even food llergies, such s egg nd milk, which we think of s typiclly trnsient re showing greter persistence into teenge nd dult yers [8, 9]. Antigen (llergen) stimultion of the mucosl immune system is thought to e criticl for the development of orl tolernce. In erly life, exposure to repeted doses of food ntigens my help prime the developing immune response towrd induction of orl tolernce [1]. The ility to develop tolernce to llergens lso ppers to coincide with the estlishment of helthy gut coloniztion y commensl cteri [11]. Filure to develop orl tolernce is thought to e ssocited with development of food-llergic disese. However, the mechnism(s) y which the norml intestinl immune system responds to food nd its involvement in the development of food llergy remins unresolved. Understnding the mechnisms involved would llow for the potentil to develop intervention strtegies for the prevention of food llergy nd lso therpeutic tretments for infnts who hve lredy developed food llergy. Orl tolernce to food ntigens cn e induced experimentlly, ut optimiztion of the dose used for sensitiztion

2 2 Clinicl nd Developmentl Immunology is criticl [12]. For exmple, induction of tolernce to penut requires significntly higher orl dose thn for egg. Animls fed high doses of chicken OVA secrete more interleukin-4 (IL-4; ssocited with llergy) nd less TGF-β (ssocited with tolernce) thn those fed low doses, where more TGF-β nd less IL-4 re produced [13]. There re only few studies in neontes ssessing timing of ntigen exposure in inducing orl tolernce. In n niml model, Stroel et l. [14] hve shown tht orl OVA given in the first week of life to mice induces humorl s well s cell-medited immunity [14]. In contrst, recent studies ssocite erly ntigen exposure with development of tolernce [15, 16]. More reserch is required to determine the optimum intervention strtegy to promote orl tolernce. Mternl milk cytokines, such s TGF-β2 nd interleukin (IL-1) hve the potentil to regulte immune responses to food ntigens nd promote tolernce [17 23]. Although the reltionship etween restfeeding nd llergy prevention is controversil [24 26], there hs recently een growing interest in the role of rest milk in regulting immune response development to food ntigens s new foods re introduced into the diet [16, 27]. During infncy, T helper 1 (Th1) immune response development is importnt in preventing persistent T helper 2 (Th2) responses nd the susequent promotion of llergic disese [3]. The mturtion of nïve T cells into committed effector nd regultor cells depends on complex interctions etween ntigen, immune cells, nd the immedite cytokine environment. TGF-β, which predominntly signls through the Smd fmily of proteins, plys mjor role in the development of T-cell linege. TGF-β induces development of Foxp3 + T regultory cells (Tregs) to promote tolernce [28, 29]. IL-4 together with TGF-β inhiits the genertion of Foxp3 + Tregs y promoting Th cells tht secrete IL-1, ut which do not hve regultory function [3]. TGF-β in the locl gut environment plys n importnt role in development of the infnt immune response to food ntigens s they re introduced into the diet [23, 31]. The interctions etween restfeeding nd the timing of food ntigen encounter re key fctors which influence food llergy development [15, 32]. Currently there is concern tht delyed feeding until fter 6 months (trditionl wening ge) my progrm the developing immune response towrd sensitiztion insted of tolernce [33, 34]. In countries where delyed feeding hs een recommended, rtes of food llergy hve esclted, including greter thn 5-fold increse oserved in food nphylxis in Austrlin children under 4 yers of ge [35]. The locl intestinl environment plys n importnt role in regulting immune response development during introduction of food ntigens. Since nlysis of the locl gut immune response during orl ntigen introduction is not ethiclly fesile in infnts, we ssessed in n topic rt pup model the developing immune response fter dily erly orl OVA exposure (continuous), s compred to intermittent (occsionl) OVA exposure. In this in vivo study we focused on n erly wening time point (dy 14). The developing immune response ws ssessed when OVA ws introduced into the diet during criticl time in erly life. Formul-fed groups were included s controls, s we hve previously shown sensitiztion fter erly orl ntigen feeding in formul-fed pups [16]. Egg ovlumin ws used s the trget ntigen to ssess ntigen-specific responses s it is one of the most common cuses of food llergy in infnts. 2. Mterils nd Methods 2.1. Animls. The BN rt hs nturlly occurring genetic predisposition towrd llergy development [36 39]. BN rts were red nd housed in the Animl Fcility of the Child, Youth nd Women s Helth Services, Adelide nd experimenttion ws completed with pprovl from the Child, Youth nd Women s Helth Services Animl Ethics Committee Cnnultion nd Mintennce. The detils of the rtificil rt milk (formul) composition (Womroo Food Products, South Austrli, Austrli; Tle 1 of Supplementry Mteril ville doi /212/396232) nd the procedure for rtificil feeding hve een previously descried [16, 23]. We hve lso previously shown tht the rtificil rt milk (formul) does not contin ctive TGF-β [18, 4]. Briefly, t dy 4 of ge, rt pups in the formul fed groups were lightly nesthetized using forthne (Isoflurthne) nd surgiclly implnted with flexile i.g. cnnul. Artificil rt milk ws delivered to rt pups through polyethylene line connected to the cnnul using multisyringe infusion pump (KDS22 multisyringe infusion pump; KD Scientific). We hve demonstrted tht chnges in immune mrkers re directly ttriuted to the formul nd not the surgicl procedure [17] Experimentl Design. Rt dms were fed stndrd nonpurified diet which does not contin OVA (Ridley Agriproducts Pty Ltd, Victori, Austrli). Rt pups from 12 BN litters were rndomly ssigned to groups (n = 8/group). Ech group (including the dm rered groups) were composed of mix of pups tken from litters originting from numer of different dms. A dily or n intermittent orl OVA exposure regime ws used. There ws five feeding groups: dm rered pups (), pups receiving dily orl gvge (.1 ml) of 1 mg OVA/dy (OVA: Sigm-Aldrich, St.Louis, Mo, USA) from dy 4 13 ( + OVAc), pups receiving n initil orl gvge of OVA t dy 4 followed y susequent gvge with OVA on dy 1, 12, nd 13, (.1 ml) of 1 mg OVA/dy ( + OVAi), formul-fed pups (), nd pups receiving dily orl gvge (.1 ml) of 1 mg OVA/d ( + OVA). Rt pups were killed t dy 14 (prior to wening). Blood ws collected y crdic puncture nd ser stored t 8 C. The spleen ws removed, snp-frozen in liquid nitrogen, nd stored t 8 C. The gstrointestinl trct ws excised, nd tissue from the ileum ws isolted nd either weighed nd snp-frozen in liquid nitrogen for lter RNA nd protein nlysis or fixed in 4% neutrl uffered formldehydefor24hourndtrnsferredto7%(v/v) ethnol for lter processing IgE, IgG1, nd IgA Anlyses. Serum OVA-specific IgE nd OVA-specific IgG1 were quntified y ELISA s previously

3 Clinicl nd Developmentl Immunology 3 Tle 1 Gene Forwrd primer Reverse primer TGF-β1 TGCGCCTGCAGAGATTCAAGTCAA AAAGACAGCCACTCAGGCGTATCA Smd2 TGAGCTTGAGAAAGCCATCA TGTGTCCCACTGATCTACCG Smd4 GGCATTGGTGTAGACGACCT GGGGTTTCTTTGATGCTCTG ismd7 GCAGCAGTTACCCCATCTTC TGATGGAGAAACCAGGGAAC FoxP3 CCACACCTCCTCTTCTTCCTT TGACTAGGGGCACTGTAGGC Cyclophilin A GGTTGGATGGCAAGCATGTG TGCTGGTCTTGCCATTCCTG descried [23] ut OVA ws used for coting.ser from the pups were diluted 5-fold for nlysis in the ELISA ssy. Stndrds nd smples were dded in duplicte nd detected colorimetriclly using 3,3,5,5 tetrmethylenzidine (TMB; Sigm-Aldrich Chemicl Co., St. Louis, Mo, USA). The limits of detection for the OVA-specific IgE nd OVA-specific IgG1 ELISA ssys were 1.95 nd.78 ng/ml, respectively. The pltes were red with Sunrise Mgelln plte reder t 45 nm (Tecn Group Ltd, Mnnedorf, Switzerlnd) nd dt expressed s ng immunogloulin/ml ser. IgA ws quntified y ELISA using ilel tissue. Ilel protein lystes for use in the IgA ELISA were prepred s descried in Tooley et l. [16]. Briefly, ilel protein lystes were prepred y dding cocktil of protese inhiitors (Sigm-Aldrich Chemicl Co., St. Louis, Mo, USA) to intestinl tissue (1 ml/1 mg tissue), which ws then homogenized nd centrifuged twice. Superntnts were collected, liquoted, nd stored t 8 C until nlysed. Smples from pups for IgA nlyses were diluted 1/2 for groups nd 1/5 for groups. The stndrd, purified rt IgAκ, cpture ntiody, mouse nti-rt IgA nd the secondry, iotin mouse nti-rt IgA were ll purchsed from BD Biosciences (Frnklin Lkes, NJ, USA). Briefly, 96-well pltes (Greiner, Frickenhusen, Germny) were coted with 2 μg/ml mouse nti-rt IgA in phosphte-uffered sline (PBS) overnight t 4 C. The wells were wshed five times with wsh uffer (PBS/.5% Tween2) nd then locked for 1 hour t room temperture with 1% Polypep protein digest (Sigm-Aldrich Chemicl Co., St. Louis, Mo, USA) in PBS. The smples nd stndrds (purified rt IgA; stndrd rnge: 125 ng/ml to 1.95 ng/ml) were then dded to the plte nd incuted for 1 hour t room temperture. After incution, the pltes were wshed five times nd iotin mouse nti-rt IgA ws dded (.5 μg/ml). Pltes were incuted t room temperture for 1 hour nd then wshed six times. Following the finl wsh, solution of ABC regent (Vector Lortories, Inc. Burlingme, Clif, USA) ws dded nd the pltes incuted for 3 minutes t room temperture. Pltes were then wshed six times; fter wshing TMB sustrte ws dded to the wells for 3 minutes fter which time the rection ws stopped using 5 μlof2nhclndredtnsornceof45nm. The limit of detection for the IgA ws 1.95 ng/ml. Dt ws expressed s ng immunogloulin/g of tissue Rel-Time PCR. RNA extrction from the spleen nd ileum, cdna synthesis, primer design, rel-time PCR, nd nlysis were performed s previously descried [16]. Primers for TGF-β1, Smd2, Smd4, ismd7, nd Foxp3 re provided in Tle Histologicl Assessment. Immunohistochemicl nlyses of TGF-β1 nd Smd4 were crried out on segments of the ileum. Four-micrometer sections were cut from prffinemedded tissue nd plced on geltin-coted slides. Sections were deprffinized with xylene nd rehydrted in grded ethnol in wter. Sections were then plced in 1 mm citrte uffer (1.8 mm citric cid; 8.2 mm sodium citrte, ph 6.) nd sujected to het-induced epitope recovery using microwve irrdition [41]. Sections were then cooled t room temperture for 3 minutes efore stining. For TGF-β1, sections werestinedsdescried inpenttil et l. [4]. For Smd4 stining, tissue sections were first incuted with 5% norml horse serum/1% ovine serum lumin (5% NHS/1% BSA) in Tris uffered sline (TBS) for 3 minutes t room temperture to lock nonspecific inding of the secondry ntiody. The locking ntiody ws then decnted nd 1 μl of nti-smd4 IgG (8μg/mL; Snt Cruz Biotechnology Inc, Snt Cruz, CA, USA) ws dded, nd the sections were incuted overnight t 4 C. After incution the sections were then wshed three times in TBS contining.5% Tween 2 (TTBS; 5 minutes/wsh) nd then incuted in 3% (v/v) hydrogen peroxide for 15 minutes t room temperture to quench endogenous peroxidse ctivity. The sections were then wshed three times with TBS (5 minutes/wsh) fter which the secondry ntiody (HRP conjugted donkey nti-mouse 3.2 μg/ml; Jckson Immuno Reserch Lortories, West Grove, PA. USA) ws pplied to the sections (1 μl per section) nd the sections incuted for 6 minutes t room temperture. The sections were then wshed with TTBS (5 minutes/wsh) two times followed y two wshes with TBS (5 minutes/wsh). For oth TGF-β1 nd Smd4 stining, immunohistochemistry rections were visulized using 3,3-diminoenzidine (DAB) sustrte plus enhncer (Invitrogen, Crlsd, Clif, USA). After sustrte development, sections were counterstined, dehydrted with grded ethnol, nd mounted. Control smples for TGF-β1 included sections incuted with norml chicken IgY (R&D Systems Inc, Minnepolis, MN, USA) or with ntiody dilution uffer only. Control smples for Smd4 included sections incuted with 5% NHS/1% BSA (R&D Systems Inc, Minnepolis, MN, USA) or with the isotype control, mouse IgG1 (8 μg/ml). Digitl imges of oth TGF-β1 nd Smd4 immunohistochemicl sections (4x mgnifiction) were tken nd nlysed using

4 4 Clinicl nd Developmentl Immunology Imge Pro Plus softwre, version 5.1 (Medi Cyernetics, Bethesd, Md, USA) Sttisticl Anlyses. All dt were expressed s the men + stndrd error of the men (SEM). Dt ws ssessed for Normlity efore nlysis. OVA-specific IgE nd IgG1 nd TGF-β1, Foxp3, Smd2, Smd4, nd ismd7 mrna expression dt were evluted utilizing nonprmetric one-wy ANOVA (Kruskl-Wllis) followed y Dunn s Multiple Comprisons post hoc test. Differences were considered significnt t P <.5. All sttisticl nlyses nd comprisons were mde using GrphPd Prism softwre, version 3 (GrphPd Softwre Inc, Sn Diego, Clif, USA). 3. Results 3.1. Bodyweight Chnge. Feeding OVA to either or pups did not ffect ody weight gin t dy 14 (dt not shown) OVA-Specific IgE, OVA-Specific IgG1 nd IgA. OVA given during formul feeding resulted in significntly incresed OVA-specific IgE titer compred with the nd +OVAc groups (P <.5; Figure 1()). Serum OVA-specific IgG1 ws lso significntly incresed in the + OVA group (P <.5) compred with the, + OVAc,, nd groups (Figure 1()). Importntly, OVA-specific IgG1 titers did not differ significntly etween the groups regrdless of orl OVA exposure. IgA ws significntly greter in the, + OVAc, + OVAi groups (P <.1) nd rely detectle in the nd + OVA groups (Figure 1(c)). IgA levels did not differ etween the groups. Expression of splenic Smd2 mrna did not differ significntly etween the, + OVAc, nd groups. Smd 4 mrna expression in the spleen ws significntly greter in nd groups compred with the group (P <.5; Figure 3()). No significnt difference in Smd4 mrna expression ws oserved etween the, +OVAc,, nd + OVA groups. ismd7 mrna expression in the spleen ws significntly greter in the nd + OVAc groups compred with the + OVAi nd + OVA groups (P <.5; Figure 3(c)). No significnt difference in ismd7 mrna expression in the spleen ws oserved etween, + OVAc, nd rts. In the ileum, Smd2, Smd4 nd ismd7 mrna expression ws significntly greter in the groups regrdless of OVA exposure compred with nd + OVA groups (P <.5; Figures 3(d), 3(e), nd 3(f)). There were no significnt differences in Smd2, Smd4, nd ismd7 mrna expression in the ileum etween the, + OVAc, nd + OVAi groups TGF-β1 nd Smd4 Protein Expression in the Ileum. TGF-β1 stining ws minly loclized to the enterocytes nd occsionl individul cells in the villus lmin propri of the ileum (Figures 4 (), 4(), 4(c), 4(d), nd 4(e)). No TGF-β1 stining ws evident t the se of the villus in the crypts or the surrounding lmin propri. Stining of Smd4 ws loclized throughout the enterocytes of the villi nd in cells of the lmin propri in ll rt groups (Figures 4(g), 4(h), 4(i), 4(j), nd 4(k)). Smd4 ws not detected in golet cells or the longitudinl lyer of smooth muscle. TGF-β1 nd Smd4 stining ws consistently more undnt in the groups regrdless of OVA exposure when compred to stining in sections from or + OVA rts. No ckground stining wsdetectedinnegtivecontrols(figures4(f) nd 4(i)) TGF-β1 nd Smd mrna Expression in Spleen nd Ileum. TGF-β1 mrna expression in the spleen ws significntly greter in the nd + OVAc groups compred with the + OVAi,nd+OVAgroups(P<.5; Figure 2()). Splenic TGF-β1 mrna expression did not differ significntly etween the nd + OVAc groups. TGF-β1 mrna expression in the ileum ws significntly greter in ll groups regrdless of OVA exposure compred with the nd + OVA groups (P <.5; Figure 2()); however there were no significnt differences in ilel TGF-β1 mrna expression etween the groups. Foxp3 mrna expression in the spleen ws significntly greter in the, + OVAc, nd groups compred with the + OVAi nd + OVA groups (P <.5; Figure 2()). Expression did not differ significntly etween the, + OVAc, nd groups. Although the mrna expression of Foxp3 in the ileum did not differ etween the groups, expression ws significntly greter in groups compred with the nd + OVA groups (P <.5; Figure 2()). The Smd pthwy ws lso investigted y nlyzing the mrna expression of Smd2, Smd4, nd ismd7 in the spleen nd ileum. In the spleen, Smd2 mrna expression ws significntly greter in group compred with the + OVAi nd + OVA groups (P <.5; Figure 3()). 4. Discussion We investigted the immune response profile fter erly orl OVA exposure in nd rt pups. Erly orl OVA exposure in rt pups, regrdless of the dosge regime, in the presence of mternl milk mintined similr immune response profile to tht oserved in unchllenged rts, with low levels of circulting OVA-specific IgE; nd IgG1. In contrst to the low OVA IgG1 response seen in the rt pups fed formul lone (no OVA chllenge), the IgE response to OVA ws high (not significntly different from tht seen in the OVA chllenged formul fed rt pups). We hve previously shown tht formul feeding induces n overll increse in totl serum IgE, this incresed IgE response my contin cross-rective ntiodies to OVA [16]. Formul fed groups were only included s controls in this study, s we hve previously shown sensitiztion fter erly orl ntigen feeding in formul-fed pups [16]. The results seen for OVA-specific IgG1 re similr to our previous pulished dt relting to feeding cow s milk llergen, β-lctogloulin (BLG), where we showed tht sensitiztion ws prevented in mternl-milk-fed pups given orl BLG erly in life. Importntly we showed tht this regulted immune profile persisted into postwening ge [16, 23]. In contrst, immune

5 Clinicl nd Developmentl Immunology OVA-specific IgE (μg/l) 3 2 1, OVA-specific IgG1 (μg/l) () () 2 16 IgA (ng/g tissue) OVAc (c) +OVA Figure 1: OVA-specific IgE, OVA-specific IgG1, nd ilel IgA fter orl OVA commenced t dy 4 in or rt pups. Brs re men + SEM,n = 8/group. Mens without common letter differ, P <.5. ctivtion nd llergy development resulted when BLG ws fed in the presence of formul [16]. TGF-βs re n importnt fmily of growth fctors involved in mintining homeostsis in the intestine, regulting inflmmtion nd llergy development nd promoting orl tolernce development in infnts [31]. TGF-β is the predominnt cytokine present in humn nd rodent milk [4, 42]. TGF-β predomintely signls through the Smd protein fmily. Smd2 nd Smd3 re phosphorylted fter ctivtion of TGF-β receptors, forming complex with Smd4. Once trnslocted into the nucleus, this complex then inds to the Smd inding element in the promoter region of TGF-β trget genes nd regultes trnscriptionl responses in conjunction with DNA-inding prtners [43, 44]. By lso ssessing Smd genes involved in the pthwy we hve een le to further elucidte the function of TGF-β1 in the development of immune responses in the gut when OVA ws introduced. In the + OVAc group, TGF-β1 mrna expression in oth the spleen nd the locl gut environment did not differ significntly from tht in unchllenged rts. However, rts receiving orl OVA intermittently displyed decresed TGF-β1nd Smd2, Smd4, nd ismd7 mrna expression in the spleen. Collectively, we hve shown tht the + OVAi,,nd+OVA groups exhiited the gretest systemic impirment of the TGF-β1/Smd pthwy with lower mrna expression of the TGF-β1/Smd genes. However, in the intestine, which is the first site of exposure to food ntigens we oserve different

6 6 Clinicl nd Developmentl Immunology ReltiveTGF-β1 expression.9.6 Reltive TGF-β1 expression Spleen Ileum ().2.4 Reltive Foxp3 expression Reltive Foxp3 expression Spleen Ileum +OVAc +OVA +OVAc + OVA () Figure 2: Splenic nd ilel cytokine mrna expression in nd pups t dy 14 with or without dily/intermittent tretment with OVA. TGF-β1 mrna () nd Foxp3 mrna () s determined y rel-time PCR. Brs re men + SEM, n = 7-8. Mens without common letter differ, P<.5. pttern of expression. rts exposed to OVA intermittently mintined TGF-β1/Smd mrna expression profile similr to the unchllenged group. One possile explntion is tht externl sources of TGF-β, provided y mternl milk, re sufficient to mintin the expression of these genes in the locl gut environment. Our current dt lso shows tht in the ileum of rts, with or without OVA exposure, lower levels of ll Smd mrna s were present when compred to the groups. High levels of TGF-β re present in rt milk during erly lcttion, with the highest levels detected just fter irth. TGF-β levels then decrese towrd wening. In contrst in mternl-fed rt pups, the numer of TGF-β1- producing cells nd mrna in the intestine is low fter irth, ut levels increse over the wening period [4]. As TGF-β is essentil for mintining homeostsis in the intestine nd promotion of T regultory cells, our dt suggests tht the locl gut environment in pups is impired with regrd to the potentil for developing regulted immune responses to food ntigens. We hve shown in previous studies tht when BN rt pups re fed formul supplemented with physiologicl levels of TGF-β, mrkers ssocited with llergy development re reduced nd the immune response profile to the cow s milk llergen, BLG, is not significntly different to tht seen in unchllenged mternl-milk-fed pups. This regulted immune response profile extended out to postwening ges, highlighting the importnce of TGF-β in

7 Clinicl nd Developmentl Immunology 7 Spleen Reltive Smd2 expression c, Spleen Reltive Smd4 expression Spleen Reltive ismd7 expression , c, () () (c) Ileum Reltive Smd2 expression Ileum Reltive Smd4 expression Ileum Reltive ismd7 expression OVAc +OVA +OVAc +OVA +OVAc +OVA (d) (e) (f) Figure 3: Splenic nd ilel mrna expression of Smd pthwy genes in nd pups t dy 14 with or without dily/intermittent tretment with OVA. Smd2, 4, nd 7 mrna levels in spleen (,, nd c) nd Smd2, 4 nd 7 mrna levels in ileum (d, e, nd f) s determinedy rel-time PCR.Brs remen + SEM, n = 7-8. Mens without common letter differ, P <.5. developing nd preventing sensitiztion to food ntigens [23]. TGF-β1 signls re controlled y inhiitory ismds, predominntly ismd7 [43, 44]. We hve shown, prticulrly in the ileum, tht TGF-β1 nd ismd7mrna levels mintin homeosttic lnce, possily y forming negtive feedck loop. It hs een documented tht the trnscription of ismd7 cn e turned on y TGF-β itself in the TGF-β/Smd signlling pthwy [45]. This suggests tht even in the presence of erly orl ntigen chllenge the mucosl immune system cn develop nd mintin such regultory mechnisms. TGF-β signling promotes T-cell tolernce nd helps mintin norml homeostsis throughout the lifespn. TGFβ preferentilly increses IgA ntiody responses y directing isotype switching to IgA in Peyer s ptches [46]. Ogwet l. [47] showed in study of neworn infnts during their first month of life tht n increse of serum IgA correlted with levels of oth TGF-β1 nd TGF-β2 in mternl colostrum [47]. Our dt supports the role of TGF-β in regulting IgA levels during erly food introduction in the presence of mternl milk. We hve shown tht erly orl OVA exposure in the presence of mternl milk, s compred to formul, mintined IgA levels. In the groups, IgA levels were only slightly ove the detection limit of the ssy. As well s eing involved in epithelil growth, IgA production, DC mturtion, nd Treg cell differentition, TGF-βs inhiit inflmmtion nd regulte inflmmtory responses in the intestine [17, 48 51]. In the dult intestine, TGF-β1 is the predominnt isotype present in epithelil nd lmin propri cells [52]. We ssessed the locliztion pttern of oth TGF-β1 nd Smd4 in the intestine of nd rts with or without ntigen exposure. More undnt stining of TGF-β1 nd Smd4 ws oserved in ll the groups, regrdless of ntigen exposure compred with the groups. The histology supports our TGF-β1 nd Smd4 mrna expression dt in the ileum nd gin highlights the potentil for sensitiztion in rt pups. We hve demonstrted in the locl gut environment tht formul feeding erly in life results in n overll suppression of TGFβ1 nd the signling genes involved in its pthwy, nmely, Smd2, Smd4, nd ismd7. TGF-β is lso required for induction of Tregs, which ply criticl role in mintining immune homeostsis in the intestine. Foxp3 + (CD4 + CD25 + Foxp3 + ) regultory cells re necessry for the development of orl tolernce [53 56]. Foxp3 mrna expression ws mintined in the ileum of rts receiving OVA dily with expression levels similr to tht seen in the ileum of unchllenged rts. Ilel Foxp3 mrna expression in the + OVAi group did not differ from the or + OVAc groups ut decrese in splenic Foxp3 mrna ws oserved in the + OVAi group. A decrese in Foxp3mRNA expression ws lso oserved in oth the ileum nd spleen of rt pups receiving OVA. We hve previously shown tht this decrese

8 8 Clinicl nd Developmentl Immunology TGF-β1 immunostin Smd4 immunostin () () (g) (h) (c) (d) (i) (j) (e) (f) (k) (l) Figure 4: Mucosl immunolocliztion of TGF-β1 nd Smd4 in nd pups t dy 14 with or without dily/intermittent tretment with OVA. Representtive imges re shown for ll groups. Positive stining is indicted s rown color. TGF-β1 ( f: (), + OVAc (), + OVAi (c), (d), + OVA (e), nd negtive control (f)) nd Smd4 (G-L: (g), + OVAc (h), + OVAi (i), (j), + OVA (k), nd negtive control (l)). in FoxP3 mrna expression ws lso noted in the mesenteric lymph node of BN rt pups t dy 14, nd tht the frequency of Foxp3+ cells ws greter in mternl-fed BN rt pups receiving continuous dose of BLG [16]. The role of Foxp3+ /CD25+ /CD4+ Tregs in development of food llergy is t present uncler. It hs een shown tht Foxp3+ cells re present in the intestine of food llergic children, ut Foxp3 trnscription levels re low [57]. In contrst, other studies report lower expression of Foxp3 nd defects in trnscription [55]. It hs een shown tht repeted smll doses of ntigens re necessry for the development of orl tolernce medited y Treg cells [58]. Our results suggest tht continuous s opposed to intermittent ntigen exposure in the presence of mternl milk mye required to promote Treg cells nd Foxp3 expression in the periphery. A dily repeted exposure to OVA s compred to n intermittent (occsionl) exposure my llow the immture immune system time to prctice nd therefore help to prime for development of regulted immune response to prevent sensitiztion, potentilly enhncing lter tolernce development. In infnts with predisposition towrd llergy development, delying the feeding of solids until fter 6 months my progrm the developing immune response towrd sensitiztion [15, 59]. Fctors such s the durtion of exclusive restfeeding, timing of introduction, nd the type of other foods (llergens) in the diet re lso thought to influence the switch etween tolernce nd sensitiztion [15]. In support of this, in previous time course study of erly cow s milk llergen exposure (BLG ws commenced t dy 4 of life) we showed reduction in the levels of mrkers ssocited with llergy development t dy 1, 14, nd 21 of life fter BLG exposure in the presence of mternl milk [16].In our current study ssessing n erly wening time point (dy 14 of life) we show n upregultion of the levels of mrkers ssocited with immuno-regultory mechnisms fter erly OVA exposure. Dily ut not intermittent orl OVA exposure commenced on dy 4 during mternl milk feeding creted n immune environment with the potentil to decrese sensitiztion to food ntigens. Foxp3 mrna expression, TGF-β1 mrna nd protein expression, nd expression of the Smd genes involved in TGF-β signling were mintined in oth the microenvironment of the gut nd the periphery. Erly regulr exposure to food ntigens (OVA) in the presence of mternl milk in erly life mintins immune regultory mechnisms preventing llergic sensitiztion. References [1] P. Meglio, E. Brtone, M. Plntmur, E. Arito, nd P. G. Gimpietro, A protocol for orl desensitiztion in children

9 Clinicl nd Developmentl Immunology 9 with IgE-medited cow s milk llergy, Allergy, vol.59,no.9, pp , 24. [2] J. Koplin, K. Allen, L. Gurrin, N. Osorne, M. L. K. Tng, nd S. Dhrmge, Is cesren delivery ssocited with sensitiztion to food llergens nd IgE-medited food llergy: systemtic review, Peditric Allergy nd Immunology, vol. 19, no. 8, pp , 28. [3] S.L.Prescott,C.Mcus,T.Smllcome,B.J.Holt,P.D. Sly,ndP.G.Holt, Developmentofllergen-specificT-cell memory in topic nd norml children, Lncet, vol. 353, no. 9148, pp , [4] K. E. Grimshw, K. Allen, C. A. Edwrds et l., Infnt feeding nd llergy prevention: review of current knowledge nd recommendtions. A EuroPrevll stte of the rt pper, Allergy, vol. 64, no. 1, pp , 29. [5] H. A. Smpson, Updte on food llergy, Journl of Allergy nd Clinicl Immunology, vol. 113, no. 5, pp , 24. [6] R. J. Mullins, Peditric food llergy trends in communitysed specilist llergy prctice, , Medicl Journl of Austrli, vol. 186, no. 12, pp , 27. [7] D. J. Hill, C. S. Hosking, F. M. de Benedictis et l., Confirmtion of the ssocition etween high levels of immunogloulin E food sensitiztion nd eczem in infncy: n interntionl study, Clinicl nd Experimentl Allergy, vol. 38, no. 1, pp , 28. [8] J. M. Skripk nd H. A. Smpson, Towrds cure for food llergy, Current Opinion in Immunology, vol. 2, no. 6, pp , 28. [9] J.H.Svge,E.C.Mtsui,J.M.Skripk,ndR.A.Wood, The nturl history of egg llergy, Journl of Allergy nd Clinicl Immunology, vol. 12, no. 6, pp , 27. [1] K. M. Smith, A. D. Eton, L. M. Finlyson, nd P. Grside, Orl tolernce, Americn Journl of Respirtory nd Criticl Cre Medicine, vol. 162, no. 4, pp. S175 S178, 2. [11] N. Sudo, S. Swmur, K. Tnk, Y. Ai, C. Kuo, nd Y. Kog, The requirement of intestinl cteril flor for the development of n IgE production system fully susceptile to orl tolernce induction, Journl of Immunology, vol. 159, no. 4, pp , [12] J. Strid, M. Thomson, J. Hourihne, I. Kimer, nd S. Stroel, A novel model of sensitiztion nd orl tolernce to penut protein, Immunology, vol. 113, no. 3, pp , 24. [13] A. Friedmn nd H. L. Weiner, Induction of nergy or ctive suppression following orl tolernce is determined y ntigen dosge, Proceedings of the Ntionl Acdemy of Sciences of the United Sttes of Americ, vol. 91, no. 14, pp , [14] S. Stroel, Immunity induced fter feed of ntigen during erly life: orl tolernce v. sensitistion, Proceedings of the Nutrition Society, vol. 6, no. 4, pp , 21. [15]S.L.Prescott,P.Smith,M.Tngetl., Theimportnce of erly complementry feeding in the development of orl tolernce: concerns nd controversies, Peditric Allergy nd Immunology, vol. 19, no. 5, pp , 28. [16] K. L. Tooley, A. El-Merhii, A. G. Cummins et l., Mternl milk, ut not formul, regultes the immune response to β- lctogloulin in llergy-prone rt pups, Journl of Nutrition, vol. 139, no. 11, pp , 29. [17] I. A. Penttil, I. E. Flesch, A. L. McCue et l., Mternl milk regultion of cell infiltrtion nd interleukin 18 in the intestine of suckling rt pups, Gut, vol. 52, no. 11, pp , 23. [18] M. Zhng, H. Zol, L. Red, nd I. Penttil, Identifiction of solule trnsforming growth fctor-β receptor III (stβiii) in rt milk, Immunology nd Cell Biology, vol. 79, no. 3, pp , 21. [19] M. F. Zhng, H. Zol, L. C. Red, nd I. A. Penttil, Locliztion of trnsforming growth fctor-β receptor types I, II, nd III in the postntl rt smll intestine, Peditric Reserch, vol. 46, no. 6, pp , [2] C. P. Frossrd, L. Steidler, nd P. A. Eigenmnn, Orl dministrtion of n IL-1-secreting Lctococcus lctis strin prevents food-induced IgE sensitiztion, Journl of Allergy nd Clinicl Immunology, vol. 119, no. 4, pp , 27. [21] M. Klliomäki, A. Ouwehnd, H. Arvilommi, P. Kero, nd E. Isoluri, Trnsforming growth fctor-β in rest milk: potentil regultor of topic disese t n erly ge, Journl of Allergy nd Clinicl Immunology, vol. 14, no. 6, pp , [22] R. Groflo, S. Chhed, F. Mei et l., Interleukin-1 in humn milk, Peditric Reserch, vol. 37, no. 4 I, pp , [23] I. Penttil, Effects of trnsforming growth fctor-β nd formul feeding on systemic immune responses to dietry β- lctogloulin in llergy-prone rts, Peditric Reserch, vol. 59, no. 5, pp , 26. [24] M. S. Krmer, L. Mtush, I. Vnilovich et l., Effect of prolonged nd exclusive rest feeding on risk of llergy nd sthm: cluster rndomised tril, British Medicl Journl, vol. 335, no. 7624, pp , 27. [25] B. E. P. Snijders, C. Thijs, R. vn Ree, nd P. A. vn den Brndt, Age t first introduction of cow milk products nd other food products in reltion to infnt topic mnifesttions in the first 2 yers of life: the KOALA irth cohort study, Peditrics, vol. 122, no. 1, pp. e115 e122, 28. [26] C. W. Allen, D. E. Cmpell, nd A. S. Kemp, Food llergy: is strict voidnce the only nswer? Peditric Allergy nd Immunology, vol. 2, no. 5, pp , 29. [27] A. Ivrsson, O. Hernell, H. Stenlund, nd L. A. Persson, Brest-feeding protects ginst celic disese, Americn Journl of Clinicl Nutrition, vol. 75, no. 5, pp , 22. [28] M. O. Li nd R. A. Flvell, Contextul regultion of inflmmtion: duet y trnsforming growth fctor-β nd interleukin-1, Immunity, vol. 28, no. 4, pp , 28. [29] E. Volpe, N. Servnt, R. Zollinger et l., A criticl function for trnsforming growth fctor-β, interleukin 23 nd proinflmmtory cytokines in driving nd modulting humn TH- 17 responses, Nture Immunology, vol. 9, no. 6, pp , 28. [3] V. Drdlhon, A. Awsthi, H. Kwon et l., IL-4 inhiits TGFβ-induced Foxp 3+ T cells nd, together with TGF-β, genertes IL- 9+ IL- 1+ Foxp 3 effector T cells, Nture Immunology, vol. 9, no. 12, pp , 28. [31] I. A. Penttil, Milk-derived trnsforming growth fctor-β nd the infnt immune response, Journl of Peditrics, vol. 156, no. 2, pp. S21 S25, 21. [32] V. Verhsselt, V. Milcent, J. Czreth et l., Brest milkmedited trnsfer of n ntigen induces tolernce nd protection from llergic sthm, Nture Medicine,vol.14,no.2,pp , 28. [33] A. Zutvern, E. von Mutius, J. Hrris et l., The introduction of solids in reltion to sthm nd eczem, Archives of Disese in Childhood, vol. 89, no. 4, pp , 24. [34] C. Agostoni, T. Decsi, M. Fewtrell et l., Complementry feeding: commentry y the ESPGHAN Committee on Nutrition, Journl of Peditric Gstroenterology nd Nutrition, vol. 46, no. 1, pp , 28.

10 1 Clinicl nd Developmentl Immunology [35] L. M. Poulos, A. M. Wters, P. K. Correll, R. H. Loly, nd G. B. Mrks, Trends in hospitliztions for nphylxis, ngioedem, nd urticri in Austrli, to 24-25, Journl of Allergy nd Clinicl Immunology, vol. 12, no. 4, pp , 27. [36] S. W. Hung, Follow-up of children with rhinitis nd cough ssocited with milk llergy, Peditric Allergy nd Immunology, vol. 18, no. 1, pp , 27. [37] J. D. de Jonge, L. M. Knippels, J. Ezendm, J. Odink, A. H. Penninks, nd H. vn Loveren, The importnce of dietry control in the development of penut llergy model in Brown Norwy rts, Methods, vol. 41, no. 1, pp , 27. [38] L. M. J. Knippels, G. F. Houen, S. Spnhk, nd A. H. Penninks, An orl sensitiztion model in Brown Norwy rts to screen for potentil llergenicity of food proteins, Methods, vol. 19, no. 1, pp , [39]L.M.Knippels,H.P.vnderKleij,S.J.Koppelmn,G.F. Houen, A. H. Penninks, nd A. A. Felius, Comprison of ntiody responses to hen s egg nd cow s milk proteins in orlly sensitized rts nd food-llergic ptients, Allergy, vol. 55, no. 3, pp , 2. [4] I. A. Penttil, A. B. vn Spriel, M. F. Zhng et l., Trnsforming growth fctor-β levels in mternl milk nd expression in postntl rt duodenum nd ileum, Peditric Reserch, vol. 44, no. 4, pp , [41] A. Negoescu, P. Lorimier, F. Lt-Moleur et l., In situ poptotic cell leling y the TUNEL method: improvement nd evlution on cell preprtions, Journl of Histochemistry nd Cytochemistry, vol. 44, no. 9, pp , [42] S. Sito, M. Yoshid, M. Ichijo, S. Ishizk, nd T. Tsujii, Trnsforming growth fctor-β (TGF-β) in humn milk, Clinicl nd Experimentl Immunology, vol. 94, no. 1, pp , [43] J. Mssgue, The trnsforming growth fctor-β fmily, Annul Review of Cell Biology, vol. 6, pp , 199. [44] L. Attisno nd J. L. Wrn, Signl trnsduction y the TGF-β superfmily, Science, vol. 296, no. 5573, pp , 22. [45] S. H. Prk, Fine tuning nd cross-tlking of TGF-β signl y inhiitory Smds, Journl of Biochemistry nd Moleculr Biology, vol. 38, no. 1, pp. 9 16, 25. [46] E. Sonod, R. Mtsumoto, Y. Hitoshi et l., Trnsforming growth fctor β induces IgA production nd cts dditively with interleukin 5 for IgA production, Journl of Experimentl Medicine, vol. 17, no. 4, pp , [47] J. Ogw, A. Sshr, T. Yoshid et l., Role of trnsforming growth fctor-β in rest milk for initition of IgA production in neworn infnts, Erly Humn Development, vol. 77, no. 1-2, pp , 24. [48] A.diStino,K.M.Pickrd,D.Rmptonetl., Blockdeof trnsforming growth fctor β upregultes T-ox trnscription fctor T-et, nd increses T helper cell type 1 cytokine nd mtrix metlloproteinse-3 production in the humn gut mucos, Gut, vol. 57, no. 5, pp , 28. [49] G. Monteleone, A. Kumerov, N. M. Croft, C. McKenzie, H. W. Steer, nd T. T. McDonld, Blocking Smd7 restores TGF-β1 signling in chronic inflmmtory owel disese, Journl of Clinicl Investigtion, vol. 18, no. 4, pp , 21. [5] B. P. Vickery, S. Chin, nd A. W. Burks, Pthophysiology of food llergy, Peditric Clinics of North Americ, vol. 58, no. 2, pp , 211. [51] B. P. Vickery, A. M. Scurlock, S. M. Jones et l., Mechnisms of immune tolernce relevnt to food llergy, Journl of Allergy nd Clinicl Immunology, vol. 127, no. 3, pp , 211. [52] S. M. Whl, D. A. Hunt, nd L. M. Wkefield, Trnsforming growth fctor type β induces monocyte chemotxis nd growth fctor production, Proceedings of the Ntionl Acdemy of Sciences of the United Sttes of Americ, vol. 84, no. 16, pp , [53] D. Mucid, N. Kutchukhidze, A. Erzo, M. Russo, J. J. Lfille, nd M. A. Curotto De Lfille, Orl tolernce in the sence of nturlly occurring Tregs, Journl of Clinicl Investigtion, vol. 115, no. 7, pp , 25. [54] T. A. Chtil, Extr-intestinl mnifesttions of gstrointestinl llergy: effector nd regultory T cells in the lnce, Clinicl nd Experimentl Allergy, vol. 37, no. 1, pp , 27. [55] T. R. Torgerson, A. Linne, N. Moes et l., Severe food llergy s vrint of IPEX syndrome cused y deletion in noncoding region of the FOXP3 gene, Gstroenterology, vol. 132, no. 5, pp , 27. [56] E. Xystrkis, S. E. Boswell, nd C. M. Hwrylowicz, T regultory cells nd the control of llergic disese, Expert Opinion on Biologicl Therpy, vol. 6, no. 2, pp , 26. [57] M. Westerholm-Ormio, O. Vrl, M. Tiittnen, nd E. Svilhti, Infiltrtion of Foxp3-nd Toll-like receptor-4- positive cells in the intestines of children with food llergy, Journl of Peditric Gstroenterology nd Nutrition, vol. 5, no. 4, pp , 21. [58] M. Chehde nd L. Myer, Orl tolernce nd its reltion to food hypersensitivities, Journl of Allergy nd Clinicl Immunology, vol. 115, no. 1, pp. 3 13, 25. [59] G. Lck, The concept of orl tolernce induction to foods, Nestle Nutrition Workshop Series: Peditric Progrm, vol. 59, pp , 27.