Cardiovascular Disease Products
|
|
- Chad Watkins
- 5 years ago
- Views:
Transcription
1 Cardiovascular Disease Products For more information, visit:
2 Cardiovascular Disease Research Cardiovascular disease is the leading cause of death in developed nations. Boster Bio aims to supply researchers with high-quality antibodies and ELISA kits so they can make new discoveries and help save lives. In this catalogue you will find a comprehensive list of high-affinity Boster antibodies and high sensitivity Boster ELISA kits targeted at proteins associated with cardiovascular disease. Boster: The Fastest Growing Antibody Company In 2015 Boster Bio received the CitaAb award for the greatest increase in number of citations during 2015 than any other antibody manufacturer. About Bosterbio Boster is an antibody manufacturer founded in 1993 by histologist Steven Xia. Over the past two decades, Boster and its products have been cited in over 20,000 publications and counting. The firm specializes in developing antibodies and ELISA kits that feature high affinity, high specificity at affordable prices. Table of Contents Boster Cardiovascular Disease Related Antibodies Boster Cardiovascular Disease Related ELISA Kits
3 High Affinity Boster Antibodies Boster supplies only the highest quality antibodies. Our high-affinity polyclonal and monoclonal antibodies are thoroughly validated by Western Blotting, Immunohistochemistry and ELISA. This is our comprehensive catalog of our antibody products related to cardiovascular disease, sorted in alphabetical order by target gene name. Catalog No Product Name Gene Name Applications Reactivity PB9242 Anti-Fetuin A AHSG WB Mouse PB9123 Anti-AAMP AAMP IHC-P Human PA1723 Anti-ABCB6 ABCB6 IHC-P Human PA1871 Anti-ABCG5 ABCG5 WB Human PB9415 Anti-ABCG5 ABCG5 WB Human PA Anti-ACE ACE IHC-P Human PB9124 Anti-ACE ACE IHC-P Human PA Anti-ACE ACE WB Human PA2071 Anti-ADAMTS1 ADAMTS1 WB Mouse PA1461 Anti-ADAMTS2 ADAMTS2 IHC-P Human PB9001 Anti-Adiponectin ADIPOQ IHC-P Human PB9011 Anti-Adiponectin ADIPOQ IHC-P Mouse PA2014 Anti-Adiponectin ADIPOQ WB Human PB9418 Anti-ADIPOR1 ADIPOR1 WB Human MA1001 Anti-AFP AFP IHC-P Human PB9090 Anti-AFP AFP IHC-P Human PA1421 Anti-Fetuin A AHSG WB Human PA1485 Anti-12 Lipoxygenase ALOX12 IHC-P Human PA Anti-12 Lipoxygenase ALOX12 WB Human PB9125 Anti-Angiopoietin-1 ANGPT1 WB Human RP1037 Anti-Angiopoietin-2 ANGPT2 IHC-P Human PA1005 Anti-Angiopoietin-2 ANGPT2 WB Human PA1487 Anti-ANGPTL1 ANGPTL1 WB Human PA2075 Anti-ANGPTL3 ANGPTL3 WB Human PA1435 Anti-ANGPTL4 ANGPTL4 WB Human PA Anti-Annexin IV ANXA4 IHC-P Human PA1007 Anti-Annexin IV ANXA4 IHC-P Human PA1500 Anti-Annexin VIII ANXA8 WB Human PB9844 Anti-APOA1 APOA1 IHC-P Mouse PB9845 Anti-APOA1 APOA1 IHC-P Rat PA1247 Anti-APOA1 APOA1 WB Human PA1439 Anti-Carbonic Anhydrase III CA3 IHC-P Human PB9371 Anti-CD36/SR-B3 CD36 IHC-P Human Antibodies: A-Z by Target Gene Name This Page: AAM-CD6 3
4 PB9930 Anti-CD9 CD9 IHC-P Mouse PA1459 Anti-CEBP Alpha CEBPA IHC-P Human PA2019 Anti-CETP CETP WB Human PA1521 Anti-Collagen IV COL4A2 IHC-P Human PB9998 Anti-TAFI/CPB2 CPB2 WB Mouse PA1905 Anti-CSF1R/M-CSFR CSF1R WB Human PB9541 Anti-CTGF CTGF IHC-P Human PB9856 Anti-Cathepsin K CTSK IHC-P Human PA2021 Anti-CXCR5 CXCR5 WB Human PA1118 Anti-Cytochrome C CYCS IHC-P Human PB9334 Anti-Cytochrome C CYCS IHC-P Human PA1657 Anti-Cytoglobin CYGB WB Human PA1698 Anti-CYP11A1 CYP11A1 IHC-P Human PA Anti-CYP11A1 CYP11A1 WB Mouse PB9942 Anti-CYP11A1 CYP11A1 WB Human PA1699 Anti-CYP11B1 CYP11B1 WB Human PA1489 Anti-Aromatase CYP19A1 IHC-P Human PA2107 Anti-Aromatase CYP19A1 IHC-P Rat PB9544 Anti-CYP1A1 CYP1A1 IHC-P Human PA1907 Anti-Cytochrome P450 1A2 CYP1A2 IHC-P Human PB9545 Anti-CYP1A2 CYP1A2 IHC-P Human PB9546 Anti-CYP1B1 CYP1B1 IHC-P Human PB9547 Anti-CYP24A1 CYP24A1 IHC-P Human PA1397 Anti-Cytochrome P450 2D6 CYP2D6 IHC-P Mouse PA1909 Anti-Cytochrome P450 2E1 CYP2E1 IHC-P Mouse PA1116 Anti-Cytochrome P CYP2E1 IHC-P Human PB9190 Anti-CYP2E1 CYP2E1 IHC-P Human PA1908 Anti-Cytochrome P450 2E1 CYP2E1 WB Human PA2022 Anti-CYP2U1 CYP2U1 IHC-P Human PA1940 Anti-CYP7A1 CYP7A1 IHC-P Human RP1079 Anti-CYP7A1 CYP7A1 WB Human PB9549 Anti-CYR61/CCN1 CYR61 WB Human PA Anti-HIF-2-Alpha EPAS1 IHC-P Rat PA Anti-HIF-2-Alpha EPAS1 WB Human PA1744 Anti-Eph Receptor A2 EPHA2 IHC-P Human PA1568 Anti-Eph Receptor A3 EPHA3 IHC-P Human PB9583 Anti-Eph Receptor A5 EPHA5 WB Human PB9584 Anti-Eph Receptor B1 EPHB1 IHC-P Human PA1569 Anti-Eph Receptor B3 EPHB3 IHC-P Human PB9701 Anti-Tissue factor/f3 F3 WB Human PB9702 Anti-Tissue factor/f3 F3 WB Mouse PA2061 Anti-Factor VIII F8 WB Human Antibodies: A-Z by Target Gene Name This Page: CD9-F9 4
5 PA1336 Anti-Cardiac FABP FABP3 IHC-P Human PB9759 Anti-Cardiac FABP FABP3 IHC-P Human RP1085 Anti-FABP4 FABP4 IHC-P Human PA1209 Anti-FABP4 FABP4 WB Human PA1475 Anti-Fatty Acid Binding Protein 5 FABP5 IHC-P Human PA1853 Anti-Fatty Acid Binding Protein 5 FABP5 IHC-P Mouse PB9865 Anti-FASN FASN IHC-P Human PA1311 Anti-FGF1 FGF1 WB Human PB9241 Anti-FGF1 FGF1 WB Human PA1454 Anti-FGF10 FGF10 WB Human PA1032 Anti-FGF2 FGF2 IHC-P Human PB9587 Anti-FGF2 FGF2 WB Human PA1673 Anti-FGF21 FGF21 WB Human PA1033 Anti-FGF4 FGF4 WB Human PA1216 Anti-FGF8 FGF8 IHC-P Human PA Anti-FGF8 FGF8 IHC-P Human PA1453 Anti-FGF9 FGF9 IHC-P Human PA1477 Anti-FGFR1 FGFR1 IHC-P Human PA1241 Anti-FGFR2 FGFR2 IHC-P Human PA Anti-FGFR2 FGFR2 WB Human PA2143 Anti-FGFR3 FGFR3 IHC-P Human PB9193 Anti-FGFR4 FGFR4 IHC-P Human PA1332 Anti-VEGFD FIGF IHC-P Human PB9869 Anti-VEGFD FIGF WB Human PA1399 Anti-sVEGFR1/sFLT1 FLT1 WB Human PA Anti-sVEGFR1/sFLT1 FLT1 WB Rat PA Anti-sVEGFR1/sFLT1 FLT1 WB Mouse PA1966 Anti-sVEGFR1/sFLT1 FLT1 WB Rat PA1914 Anti-Flt-3ligand FLT3LG WB Human PB9588 Anti-Flt-3ligand FLT3LG WB Human PB9707 Anti-GNAQ GNAQ IHC-P Human PA1590 Anti-GST3/GST Pi GSTP1 IHC-P Human PB9184 Anti-GST3/GST Pi GSTP1 IHC-P Human PA1040 Anti-GST3/GST Pi GSTP1 WB Human PA2145 Anti-HIF3 HIF3A WB Human PB9277 Anti-HSPG2 HSPG2 IHC-P Human PA1353 Anti-IL-8 IL8 IHC-P Human PB10003 Anti-Alpha Internexin INA IHC-P Human PA1750 Anti-INPPL1 INPPL1 IHC-P Human PB9647 Anti-ITGA2B ITGA2B IHC-P Human PA2226 Anti-ITGA7 ITGA7 WB Human PA1405 Anti-Integrin Alpha V ITGAV IHC-P Human Antibodies: A-Z by Target Gene Name This Page: FAB-ITG 5
6 PB10004 Anti-ITLN1 ITLN1 IHC-P Human PB9651 Anti-KCNA5 KCNA5 WB Human PA2272 Anti-CSEN KCNIP3 WB Human MA1040 Anti-VEGFR2/KDR KDR IHC-F Human PA1989 Anti-VEGFR2/KDR KDR IHC-P Human PB9429 Anti-VEGFR2/KDR KDR WB Human PA1888 Anti-KLF3 KLF3 WB Human PA1625 Anti-KLK1 KLK1 IHC-P Human PA1633 Anti-KLK1 KLK1 IHC-P Rat PA1709 Anti-KLK1 KLK1 IHC-P Mouse PA2038 Anti-KLK1 KLK1 IHC-P Mouse PB9655 Anti-Kininogen-1/KNG1 KNG1 IHC-P Mouse PB9278 Anti-Kininogen-1/KNG1 KNG1 WB Human MA1054 Anti-Laminin LAMA1 IHC-P Feline PA1581 Anti-Laminin Gamma 1 LAMC1 IHC-P Human PB9142 Anti-Laminin LAMC1 IHC-P Human PA1967 Anti-LCAT LCAT WB Human PB9657 Anti-LCAT LCAT WB Human PA1304 Anti-LipoProtein Lipase LPL WB Bovine PA2273 Anti-LRP5 LRP5 WB Human PA2083 Anti-MADCAM-1 MADCAM1 IHC-P Human PB9058 Anti-CD10/Neprilysin MME IHC-P Human PB9725 Anti-MMP-1 MMP1 WB Human PA1380 Anti-MMP10 MMP10 WB Human PB9670 Anti-MMP10 MMP10 WB Human PA2146 Anti-MMP-12 MMP12 WB Human PA2147 Anti-MMP-14 MMP14 IHC-P Human PA1115 Anti-MMP-14 MMP14 IHC-P Human PB9283 Anti-MMP-14 MMP14 WB Human PA1123 Anti-MMP16 MMP16 IHC-P Human PA Anti-MMP-2 MMP2 IHC-P Human PB9267 Anti-MMP-3 MMP3 WB Human PA1471 Anti-MMP-7 MMP7 IHC-P Mouse PA1207 Anti-MMP-8 MMP8 IHC-P Human PB10008 Anti-MMP-9 MMP9 IHC-P Mouse PA1357 Anti-MMP-9 MMP9 WB Human PA1929 Anti-NADPH Oxidase 4 NOX4 IHC-P Human PA1930 Anti-NOXA1 NOXA1 WB Human PB9295 Anti-ANP NPPA WB Human PA1246 Anti-LXR Alpha NR1H3 WB Human PA Anti-LXR Alpha NR1H3 WB Human PB9729 Anti-NR2F2 NR2F2 WB Human Antibodies: A-Z by Target Gene Name This Page: ITL-NR2 6
7 PB9300 Anti-Neuropilin-1 NRP1 IHC-P Human PA1752 Anti-Neuropilin-1 NRP1 WB Human PA1832 Anti-LOX-1/OLR1 OLR1 WB Human PA1833 Anti-LOX-1/OLR1 OLR1 WB Human PA1949 Anti-OSBP1 OSBP WB Human PB9311 Anti-PDGF-BB PDGFB WB Human PA1678 Anti-PDGF Receptor Alpha PDGFRA IHC-P Human PB9771 Anti-PDGFRA PDGFRA IHC-P Human PA1411 Anti-Podoplanin/gp36 PDPN WB Human PA1674 Anti-Podoplanin/gp36 PDPN WB Human PA1675 Anti-Podoplanin/gp36 PDPN WB Mouse PA2045 Anti-PGK1 PGK1 IHC-P Human PB9774 Anti-PGK1 PGK1 WB Human PB9775 Anti-PGRMC1 PGRMC1 IHC-P Human PA2278 Anti-Plakophilin 2 PKP2 WB Human PA1344 Anti-uPAR PLAUR IHC-P Human PB9380 Anti-PLD1 PLD1 WB Human PA2228 Anti-PLTP PLTP IHC-P Human PA1211 Anti-COX2/Cyclooxygenase 2 PTGS2 IHC-P Human PA1725 Anti-COX2/Cyclooxygenase 2 PTGS2 IHC-P Human PB9138 Anti-COX2/Cyclooxygenase 2 PTGS2 WB Human PA1574 Anti-FAK PTK2 WB Human PB9674 Anti-FAK PTK2 WB Human PB9885 Anti-RNH1 RNH1 WB Human PA1896 Anti-Syndecan 2 SDC2 IHC-P Human PA1359 Anti-sL-Selectin SELL WB Mouse PA1715 Anti-P-Selectin SELP IHC-P Human PA1638 Anti-Kallistatin/Serpina4 SERPINA4 IHC-P Human PA2218 Anti-Serpin C1/Antithrombin-III SERPINC1 WB Human PA1933 Anti-Prosurfactant Protein C SFTPC WB Human PA2169 Anti-NKCC1 SLC12A2 IHC-P Human PA1431 Anti-OPN SPP1 IHC-P Human PA1432 Anti-OPN SPP1 IHC-P Mouse MA1090 Anti-Spectrin(Alpha And Beta) (MonocloSPTA1 WB Human PA1777 Anti-SPTLC1 SPTLC1 IHC-P Human PB9894 Anti-SPTLC1 SPTLC1 IHC-P Human PB9822 Anti-SULT2B1 SULT2B1 IHC-P Human PA1798 Anti-TFPI TFPI IHC-P Human PA1248 Anti-TFPI2 TFPI2 IHC-P Human PA1901 Anti-Transferrin Receptor 2 TFR2 WB Mouse PA1023 Anti-CD71 TFRC IHC-P Human PB9233 Anti-TFRC TFRC IHC-P Human Antibodies: A-Z by Target Gene Name This Page: NRP-TFR 7
8 PA1360 Anti-TGF Alpha TGFA WB Human PA1731 Anti-TGF Beta Receptor I TGFBR1 IHC-P Human PB9828 Anti-TGFBR1 TGFBR1 WB Human PA1417 Anti-TSP2 THBS2 IHC-P Human PA1385 Anti-TIMP-1 TIMP1 IHC-P Human PA2002 Anti-TIMP-1 TIMP1 WB Mouse PA2003 Anti-TIMP-1 TIMP1 WB Rat PB9830 Anti-TIMP-2 TIMP2 WB Human PA1078 Anti-TIMP-4 TIMP4 IHC-P Human PA2118 Anti-OPG TNFRSF11B WB Human PA1080 Anti-VEGF VEGFA IHC-P Human PB9071 Anti-VEGF VEGFA IHC-P Human PB9062 Anti-VWF VWF IHC-P Human PB9273 Anti-VWF VWF IHC-P Mouse PA1053 Anti-Morg1 WDR83 IHC-P Human PA1635 Anti-YIPF3 YIPF3 IHC-P Human Antibodies: A-Z by Target Gene Name This Page: TGF-YIP 8
9 High Sensitivity Boster ELISA Kits Boster Bio is proud to present our latest catalog of ELISA kit products. Our high sensitivity, high specificity ELISA kits are thoroughly tested alongside our antibody products.. This is our comprehensive catalog of our ELISA kits related to cardiovascular disease, sorted in alphabetical order by target gene name. Catalog No Product Name Gene Name Applications Reactivity EK0557 Human ACE ACE ELISA Human EK0558 Mouse ACE ACE ELISA Mouse EK1518 Human ALK-1/ACVRL1 ACVRL1 ELISA Human EK1519 Mouse ALK-1/ACVRL1 ACVRL1 ELISA Mouse EK1340 Human ADAMTS1 ADAMTS1 ELISA Human EK0595 Human Adiponectin ADIPOQ ELISA Human EK0596 Mouse Adiponectin ADIPOQ ELISA Mouse PA Anti-Adiponectin ADIPOQ ELISA Human EK1327 Rat Adiponectin ADIPOQ ELISA Rat EK0651 Human AFP AFP ELISA Human EK0757 Human Fetuin A AHSG ELISA Human PB9568 Anti-Fetuin A AHSG ELISA Human EK0559 Human Angiopoietin-1 ANGPT1 ELISA Human EK1295 Rat Angiopoietin-1 ANGPT1 ELISA Rat EK1296 Mouse Angiopoietin-1 ANGPT1 ELISA Mouse PA Anti-Angiopoietin-1 ANGPT1 ELISA Human EK0657 Human Angiopoietin-2 ANGPT2 ELISA Human EK0938 Mouse Angiopoietin-2 ANGPT2 ELISA Mouse EK1352 Mouse ANGPTL3 ANGPTL3 ELISA Mouse EK1374 Human ANGPTL3 ANGPTL3 ELISA Human EK0960 Human ANGPTL4 ANGPTL4 ELISA Human EK1456 Human APOA1 APOA1 ELISA Human PB9916 Anti-APOA1 APOA1 ELISA Human EK1546 Human BCAM BCAM ELISA Human EK1547 Mouse BCAM BCAM ELISA Mouse EK0311 Human BMP-2 BMP2 ELISA Human EK0312 Rat BMP-2 BMP2 ELISA Rat EK0313 Mouse BMP-2 BMP2 ELISA Mouse PB9687 Anti-BMP-2 BMP2 ELISA Human EK0314 Human BMP-4 BMP4 ELISA Human PB9688 Anti-BMP-4 BMP4 ELISA Human EK0316 Mouse BMP-4 BMP4 ELISA Mouse ELISAs: A-Z by Target Gene Name This Page: ACE-BMP 9
10 EK0310 Human BMP-5 BMP5 ELISA Human PB9689 Anti-BMP-5 BMP5 ELISA Human EK1127 Human CCL16/HCC-4 CCL16 ELISA Human EK0700 Human CD36/SR-B3 CD36 ELISA Human EK0701 Mouse CD36/SR-B3 CD36 ELISA Mouse EK1299 Rat CD36/SR-B3 CD36 ELISA Rat EK1253 Human Tetranectin/CLEC3B CLEC3B ELISA Human EK1502 Human TAFI/CPB2 CPB2 ELISA Human PB9997 Anti-TAFI/CPB2 CPB2 ELISA Human EK0807 Human CSF1R/M-CSFR CSF1R ELISA Human EK0808 Mouse CSF1R/M-CSFR CSF1R ELISA Mouse EK0727 Mouse CXCL4/PF4 CXCL4 ELISA Mouse EK0726 Human CXCL4/PF4 CXCL4 ELISA Human EK0413 Human IL-8 CXCL8 ELISA Human EK1203 Human CYR61/CCN1 CYR61 ELISA Human EK1228 Mouse JAM-A/F11R F11R ELISA Mouse EK1349 Human JAM-A/F11R F11R ELISA Human EK0928 Human Tissue Factor/F3 F3 ELISA Human EK1367 Mouse Tissue Factor/F3 F3 ELISA Mouse EK1459 Human FABP4 FABP4 ELISA Human EK1458 Mouse FABP4 FABP4 ELISA Mouse EK1258 Human Ficolin-2 FCN2 ELISA Human EK1498 Human Fetuin B FETUB ELISA Human EK1172 Mouse FGF1 FGF1 ELISA Mouse EK1173 Rat FGF1 FGF1 ELISA Rat RP1005 Anti-FGF1 FGF1 ELISA Human PB9944 Anti-FGF1 FGF1 ELISA Human RP1006 Anti-human FGF2 FGF2 ELISA Human EK0994 Human FGF21 FGF21 ELISA Human EK1379 Mouse FGF21 FGF21 ELISA Mouse EK0345 Human FGF4 FGF4 ELISA Human EK0348 Human FGF9 FGF9 ELISA Human EK0543 Human svegfr1/sflt1 FLT1 ELISA Human EK0354 Human Flt-3ligand FLT3LG ELISA Human EK0355 Mouse Flt-3ligand FLT3LG ELISA Mouse EK0965 Human FSTL1 FSTL1 ELISA Human EK1431 Human Hepcidin HAMP ELISA Human EK1466 Human Hemopexin HPX ELISA Human EK0388 Human IGFBP4 IGFBP4 ELISA Human EK0419 Human IL-11 IL11 ELISA Human EK0420 Mouse IL-11 IL11 ELISA Mouse EK0796 Mouse IL-17F IL17F ELISA Mouse ELISAs: A-Z by Target Gene Name This Page: BMP-IL1 10
11 EK1136 Rat IL-17F IL17F ELISA Rat EK1116 Human IL1RL1/ST2 IL1RL1 ELISA Human EK1180 Mouse IL1RL1/ST2 IL1RL1 ELISA Mouse EK0929 Human IL-33 IL33 ELISA Human EK0930 Mouse IL-33 IL33 ELISA Mouse PB9621 Anti-IL8 IL8 ELISA Human EK0544 Human VEGFR2/KDR KDR ELISA Human EK0590 Mouse VEGFR2/KDR KDR ELISA Mouse EK0903 Human KLK1 KLK1 ELISA Human EK1154 Human Kininogen-1/KNG1 ELISA Kit KNG1 ELISA Human EK0436 Mouse Laminin LAMA1 ELISA Mouse EK1542 Human LDLR LDLR ELISA Human EK1543 Mouse LDLR LDLR ELISA Mouse EK0967 Human LYVE-1 LYVE1 ELISA Human EK1332 Mouse MADCAM-1 MADCAM1 ELISA Mouse EK0851 Human CD10/Neprilysin MME ELISA Human EK0852 Mouse CD10/Neprilysin MME ELISA Mouse EK0458 Human MMP-1 MMP1 ELISA Human EK0950 Human MMP-12 MMP12 ELISA Human EK0996 Mouse MMP-12 MMP12 ELISA Mouse RP1089 Anti-MMP-12 MMP12 ELISA Mouse EK0468 Human MMP13 MMP13 ELISA Human EK0951 Human MMP-14 MMP14 ELISA Human EK0459 Human MMP-2 MMP2 ELISA Human EK0460 Mouse MMP-2 MMP2 ELISA Mouse EK0639 Rat MMP-2 MMP2 ELISA Rat PA Anti-MMP-2 MMP2 ELISA Human EK0461 Human MMP-3 MMP3 ELISA Human EK0462 Mouse MMP-3 MMP3 ELISA Mouse EK0463 Human MMP-7 MMP7 ELISA Human PB9037 Anti-MMP-7 MMP7 ELISA Human PB9038 Anti-MMP-7 MMP7 ELISA Mouse EK0464 Human MMP-8 MMP8 ELISA Human EK1248 Rat MMP-8 MMP8 ELISA Rat PB9726 Anti-MMP-8 MMP8 ELISA Human PB9727 Anti-MMP-8 MMP8 ELISA Mouse EK0465 Human MMP-9 MMP9 ELISA Human EK0466 Mouse MMP-9 MMP9 ELISA Mouse PB9668 Anti-MMP-9 MMP9 ELISA Human PB9669 Anti-MMP-9 MMP9 ELISA Mouse EK1463 Rat MMP-9 MMP9 ELISA Rat PB10009 Anti-Visfatin NAMPT ELISA Human ELISAs: A-Z by Target Gene Name This Page: IL1-NAM 11
12 EK1342 Mouse Neuropilin-1 NRP1 ELISA Mouse EK1343 Rat Neuropilin-1 NRP1 ELISA Rat EK1353 Human Neuropilin-1 NRP1 ELISA Human EK1422 Human CD73/NT5E NT5E ELISA Human EK0824 Human LOX-1/OLR1 OLR1 ELISA Human EK0825 Mouse LOX-1/OLR1 OLR1 ELISA Mouse EK0956 Human PDGF-BB PDGFB ELISA Human EK0484 Human PDGF-AB PDGFB, PDGFAELISA Human EK0485 Rat PDGF-AB PDGFB, PDGFAELISA Rat EK0486 Mouse PDGF-AB PDGFB, PDGFAELISA Mouse EK0536 Human upar PLAUR ELISA Human EK1215 Mouse upar PLAUR ELISA Mouse EK0905 Human Angiostatin K1-3 PLG ELISA Human RP1027 Anti-Angiostatin K1-3 PLG ELISA Human EK1368 Mouse PLTP PLTP ELISA Mouse PB9878 Anti-NAP2 PPBP ELISA Human EK0957 Human EPCR PROCR ELISA Human PB9880 Anti-EPCR PROCR ELISA Human EK1329 Human Chemerin/RARRES2 RARRES2 ELISA Human EK1330 Mouse Chemerin/RARRES2 RARRES2 ELISA Mouse EK0831 Human RBP4 RBP4 ELISA Human EK0832 Mouse RBP4 RBP4 ELISA Mouse PB9360 Anti-RBP4 RBP4 ELISA Human EK0503 Human sl-selectin SELL ELISA Human EK0504 Mouse sl-selectin SELL ELISA Mouse EK0937 Rat sl-selectin SELL ELISA Rat PB9389 Anti-sL-Selectin SELL ELISA Human EK0505 Human P-Selectin SELP ELISA Human EK0506 Mouse P-Selectin SELP ELISA Mouse PB9363 Anti-P-Selectin SELP ELISA Human EK0836 Human Kallistatin/Serpina4 SERPINA4 ELISA Human EK1393 Human Serpin C1/Antithrombin-III SERPINC1 ELISA Human EK0859 Human PAI-1 SERPINE1 ELISA Human EK0896 Human PEDF/SerpinF1 SERPINF1 ELISA Human EK1508 Human Siglec-7/CD328 SIGLEC7 ELISA Human EK0482 Human OPN SPP1 ELISA Human EK0483 Mouse OPN SPP1 ELISA Mouse RP1080 Anti-OPN SPP1 ELISA Human EK0840 Human TFPI TFPI ELISA Human EK1355 Mouse TFPI TFPI ELISA Mouse EK1358 Human TFPI2 TFPI2 ELISA Human EK0511 Human TGF Alpha TGFA ELISA Human ELISAs: A-Z by Target Gene Name This Page: NRP-TGF 12
13 EK0513 Human TGF Beta 1 TGFB1 ELISA Human EK0514 Rat TGF Beta 1 TGFB1 ELISA Rat EK0515 Mouse TGF Beta 1 TGFB1 ELISA Mouse EK1218 Human LAP(TGF-Beta1) TGFB1 ELISA Human EK0981 Human TGF-Beta 2 TGFB2 ELISA Human EK0982 Rat TGF-Beta 2 TGFB2 ELISA Rat EK0983 Mouse TGF-Beta 2 TGFB2 ELISA Mouse EK0917 Human Thrombomodulin THBD ELISA Human EK1119 Mouse Thrombomodulin THBD ELISA Mouse EK0642 Human TSP2 THBS2 ELISA Human EK0520 Human TIMP-1 TIMP1 ELISA Human EK0583 Rat TIMP-1 TIMP1 ELISA Rat EK0521 Mouse TIMP-1 TIMP1 ELISA Mouse EK0522 Human TIMP-2 TIMP2 ELISA Human EK0955 Mouse TIMP-2 TIMP2 ELISA Mouse EK1302 Rat TIMP-2 TIMP2 ELISA Rat PA1076 Anti-TIMP-2 TIMP2 ELISA Human EK0524 Human TIMP-4 TIMP4 ELISA Human PA Anti-TIMP-4 TIMP4 ELISA Human EK1335 Mouse TIMP-4 TIMP4 ELISA Mouse EK0480 Human OPG TNFRSF11B ELISA Human EK0481 Mouse OPG TNFRSF11B ELISA Mouse EK0539 Human VEGF VEGFA ELISA Human EK0540 Rat VEGF VEGFA ELISA Rat EK0541 Mouse VEGF VEGFA ELISA Mouse EK1411 Mouse VEGF-B VEGFB ELISA Mouse EK0588 Human VEGF-C VEGFC ELISA Human ELISAs: A-Z by Target Gene Name This Page: TGF-VEGs 13
14 3942 Valley Ave, Pleasanton, CA,
Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases
Supplementary Tables: Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Table 2: Contingency tables used in the fisher exact
More informationB16F1 B16F10 Supplemental Figure S1
B16F1 B16F1 Supplemental Figure S1 Representative microangiography images of B16F1 and B16F1 tumors grown in the cranial windows. FITC-dextran (2 million MW) was injected systemically to visualize blood
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationantibody and ELISA experts Cancer Research Products
Cancer Research Products WWW.BOSTERBIO.COM Cancer Research Cancer is a leading cause of death in developed nations, affecting millions of people around the world. Research into the molecular basis of these
More informationCD Marker Antibodies. atlasantibodies.com
CD Marker Antibodies atlasantibodies.com CD Marker Antibodies Product Name Product Number Validated Applications Anti-ACE HPA029298 IHC,WB Anti-ACKR1 HPA016421 IHC Anti-ACKR1 HPA017672 IHC Anti-ADAM17
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p
More informationFirePlex Multiplex Immunoassay product list
FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes
More informationCardiovascular Antibodies and Protocols 2008/2009
Cardiovascular Antibodies and Protocols 2008/2009 www.abcam.com Contents Catalogue contents Welcome to Abcam About Abcam......................................1 Cardiovascular at Abcam.............................2
More informationDilution Factor Serum Plasma Urine CSF (Other)
R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations
More informationSupplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral.
Supplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral. Anti-GDF15 antibody (mab26, a neutralizing monoclonal antibody to wtgdf15) blocks binding of GDF15 to human GFRAL in a dose-dependent
More informationSupplementary Figure 1!
a!!gt-cre x Twist LoxP/LoxP!!GT-Cre x Twist LoxP/LoxP! x RosaLSLEYFP!!GT-Cre x Snail LoxP/LoxP!!GT-Cre x Snail LoxP/LoxP! x RosaLSLEYFP! Supplementary Figure!!GT-Cre x Twist LoxP/LoxP! x RosaLSLEYFP x
More informationTITLE: Genetic and epigenetic biomarkers for recurrent prostate cancer after radiotherapy
AD Award Number: W81XWH-12-1-0113 TITLE: Genetic and epigenetic biomarkers for recurrent prostate cancer after radiotherapy PRINCIPAL INVESTIGATOR: Jong Park CONTRACTING ORGANIZATION: H. Lee Moffitt Cancer
More informationProject Summary. Principal Investigator: C. Krehbiel Oklahoma State University
Project Summary Skeletal muscle differentially influences marbling development through IGF-I and myostatin pathways in growing versus finishing beef cattle Principal Investigator: C. Krehbiel Oklahoma
More informationEffects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )
1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo
More informationSupplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in
Supplemental Data, Page 1 Supplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in pressure but not volume overload. Contents: Page 3: Supplemental Figure 1 - Echocardiographic
More information2018/2019 Catalog ReliaTech GmbH 2018/2019. Catalog
2018/2019 Catalog ReliaTech GmbH 2018/2019 Catalog +49-5331-8586 987 +49-5331-8586 989 www.reliatech.de orders@reliatech.de A B mouse anti-human CD31 rabbit anti-human EGFR C D CD31/EGFR control Double
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationELISA kits for Signal Transduction
ELISA kits for Signal Transduction Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan
More informationELISA kits for Cancer
ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationLuminex Assays and High Performance Assays Product Listing _ Fall 2017
RnDSy-lu-2945 Luminex Assays and High Performance Assays Product Listing _ Fall 2017 Analyte Streptavidin-PE Biotin Target Analyte Detection Antibody Capture Antibody Luminex Bead 1 Table of Contents Luminex
More informationEMT and ECM. Jesse Liang, Ph.D. Sample & Assay Technologies
EMT and ECM Jesse Liang, Ph.D. 1 Epithelial Cells.1. Closely adjoined.2. Polarized.Epithelial Markers: E-Cadherin (adherens junctions) Claudins (tight junctions) Occludin (tight junctions) Desmoplakin
More informationNori Rabbit IL-2 ELISA Kit DataSheet
Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the
More informationPrecision Oncology: Experience at UW
Precision Oncology: Experience at UW Colin Pritchard MD, PhD University of Washington, Department of Lab Medicine WSMOS Meeting November 1, 2013 Conflict of Interest Disclosures I declare the following,
More informationFig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
More informationStudy on the Biological Basis of Hypertension and Syndrome with Liver Fire Hyperactivity Based on Data Mining Technology
Download free from www.wjtcm.net Original Article Study on the Biological Basis of Hypertension and Syndrome with Liver Fire Hyperactivity Based on Data Mining Technology Xue-Ling Ma a, Xing Zhai b, Jing-Wei
More informationHTG EdgeSeq Immuno-Oncology Assay Gene List
A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK
More informationSupplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),
More informationSupplementary Material: Exploring wound-healing genomic machinery with a network-based approach
Supplementary Material: Exploring wound-healing genomic machinery with a network-based approach Francesca Vitali, Simone Marini, Martina Balli, Hanne Grosemans, Maurilio Sampaolesi, Yves A. Lussier, Maria
More informationChanging the Culture of Cancer Care II. Eric Holland Fred Hutchinson Cancer Research Center University of Washington Seattle
Changing the Culture of Cancer Care II Eric Holland Fred Hutchinson Cancer Research Center University of Washington Seattle Transforming Cancer Therapy Eric Holland Fred Hutchinson Cancer Research Center
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
More informationSupplementary Figures and Tables. An inflammatory gene signature distinguishes neurofibroma Schwann cells and
Supplementary Figures and Tables An inflammatory gene signature distinguishes neurofibroma Schwann cells and macrophages from cells in the normal peripheral nervous system Kwangmin Choi 1, Kakajan Komurov
More informationIvy GAP: An Anatomic Transcriptional Atlas of Glioblastoma. Nameeta Shah, Ph.D.
Ivy GAP: An Anatomic Transcriptional Atlas of Glioblastoma Nameeta Shah, Ph.D. Ivy Glioblastoma Atlas Project (Ivy GAP) NEUROSCIENCE INSTITUTE https://ivygap.swedish.org/ http://glioblastoma.alleninstitute.org/
More information细胞因子绝对定量检测 RayBio 平面型抗体芯片
细胞因子绝对定量检测 RayBio 平面型抗体芯片 RayBio 细胞因子定量检测抗体芯片技术服务 ()I Catalog duct Species QAH-ADI- y Obesity IGF-I, IL- alpha, IL-6, IL-8, Insulin, Leptin, MCP-, PAI-, Adipokines Resistin, TNF alpha QAH-ADI-2 y Obesity
More informationLuminex Assay Product Listing Summer 2017
RnDSy-lu-2945 Luminex Assay Product Listing Summer 2017 Streptavidin-PE Biotin Target Detection Antibody Capture Antibody Luminex Bead 1 Table of Contents Luminex Panels by Research Topic/Disease State...
More informationUnderstanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
More informationSupplementary Discussion
doi:10.1038/nature09513 Supplementary Discussion Time course of CNS vascular development The timing of endothelial cell entry into the rat cerebral cortex and pericyte recruitment are further demonstrated
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationptglab.com PECAM1: Customer Testimonial
ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called
More informationMechanisms of Gene Regulation and Signal! Transduction in Hypoxia!
Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Lorenz Poellinger! Dept. of Cell and Molecular Biology! Karolinska Institutet, Stockholm, Sweden! Normoxia - O 2 availability is in balance
More informationBritish Journal of Nutrition
(2009), 101, 1185 1194 q The Authors 2008 doi:10.1017/s0007114508066786 Maternal undernutrition programmes atherosclerosis in the ApoE*3-Leiden mouse Zoe Yates, Elizabeth J. Tarling, Simon C. Langley-Evans*
More informationExpression levels of b-pix mrna in ALS-MSCs and C-MSCs.
Supplementary Data SUPPLEMENTARY FIG. S1. The neurological functioning of ischemic rats depends on the origin of the transplanted MSCs. The scores of healthy rats in tests on forelimb placing, forelimb
More informationResearch Article Expression Profiling of Genes Related to Endothelial Cells Biology in Patients with Type 2 Diabetes and Patients with Prediabetes
BioMed Research International Volume 2016, Article ID 1845638, 12 pages http://dx.doi.org/10.1155/2016/1845638 Research Article Expression Profiling of Genes Related to Endothelial Cells Biology in Patients
More informationContribution of Interstitial Valve Cells to Aortic Valve Calcification
UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,
More informationIn vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell
Supplementary Methods BrdU incorporation in vivo In vivo bromodeoxyuridine (BrdU) incorporation was performed to analyze cell proliferation in the heart. Mice were subjected to LI-TAC, and 5 days later
More informationMechanisms underlying chemotherapy-induced vascular proliferation in ovarian cancer
Western University Scholarship@Western Electronic Thesis and Dissertation Repository August 2017 Mechanisms underlying chemotherapy-induced vascular proliferation in ovarian cancer Zeynep Gülsüm Kahramanoğlu
More informationSupplemental Table S1. Primers used in qrt-pcr analyses. Supplemental Figure S1, related to Figure 4. Extracellular matrix proteins
Supplemental Material PDGFRb regulates craniofacial development through homodimers and functional heterodimers with PDGFRa Katherine A. Fantauzzo and Philippe Soriano Supplemental materials provided: Supplemental
More informationAn Integrative Pharmacogenomic Approach Identifies Two-drug. Combination Therapies for Personalized Cancer Medicine
An Integrative Pharmacogemic Approach Identifies Two-drug Combination Therapies for Personalized Cancer Medicine Yin Liu 1,2,3, Teng Fei 4,5, Xiaoqi Zheng 6, Myles Brown 4,5, Peng Zhang 7*, X. Shirley
More informationTemporal expression analysis of angiogenesis-related genes in brain development
Özkan et al. Vascular Cell 2012, 4:16 VASCULAR CELL RESEARCH Open Access Temporal expression analysis of angiogenesis-related genes in brain development Abdulkadir Özkan 1,2, Atilla Biçer 1, Timuçin Avşar
More informationLife Sciences METABOLISM. Transform Your Metabolic Research
METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,
More informationSeeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
More informationCase Study - Informatics
bd@jubilantbiosys.com Case Study - Informatics www.jubilantbiosys.com Validating as a Prognostic marker and Therapeutic Target for Multiple Cancers Introduction Human genome projects and high throughput
More informationVascular Endothelial Growth Factor, diagnostic and therapeutic aspects Kusumanto, Yoka Hadiani
University of Groningen Vascular Endothelial Growth Factor, diagnostic and therapeutic aspects Kusumanto, Yoka Hadiani IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF)
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationAssessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018
Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect
More informationSupplementary Data. Supplementary Tables. Table 1S: qrt-pcr Primers
Supplementary Data Supplementary Tables Table 1S: qrt-pcr Primers Mouse Accession Forward Primer Reverse Primer Collagen1A1 Col1A1 NM_7742.3 TAGGCCATTGTGTATGCAGC ACATGTTCAGCTTTGTGGACC Collagen1A2 Col1A2
More informationground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were
Supplementary Figure 1. Characterization of EVs from intestine. (a, b) Intestinal tissues were ground and enzymatically digested or mechanically homogenized. The EVs or total vesicles were isolated by
More informationSupplementary Table 1. Annotated candidate SNV and indels in melanoma tumors. Patient C1 Patient C2 Patient C3 Patient C4 Patient C5 Patient C6 Patient C7 Patient C10 Chr Position Reference Allele Sample
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. Transcriptional changes are dependent upon Fpn and occur in peritoneal macrophages. A. Mouse bone marrow macrophages were transfected with either WT Fpn-GFP
More informationExons from 137 genes were targeted for hybrid selection and massively parallel sequencing.
SUPPLEMENTARY TABLES Supplementary Table 1. Targeted Genes ABL1 ABL2 AKT1 AKT2 AKT3 ALK APC ATM AURKA BCL2 BRAF BRCA1 BRCA2 CCND1 CCNE1 CDC73 CDH1 CDK4 CDK6 CDK8 CDKN1A CDKN2A CEBPA CHEK1 CHEK2 CREBBP
More informationR.G.C.C.-RESEARCH GENETIC CANCER CENTRE LTD
ONCONOMICS 1 / 13 R.G.C.C.-RESEARCH GENETIC CANCER CENTRE LTD Dear colleague, Florina, / / We send you the results from the analysis on a patient suffering from carcinoma stage. The sample that was sent
More informationWideScreen BeadPlex Multiplex Assays. Spring 2010
WideScreen BeadPlex Multiplex Assays Spring 2010 Cancer Panels Cancer Biomarkers Cancer Panel 1 (Biomarkers) Cancer Panel 2 (Growth Factors) MMP Panel Cat No: BPHCP001-6 CA 125 CEA (Carcinoembryonic Antigen)
More informationRayBio Human Thyroglobulin ELISA Kit
RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite
More informationSupplement Results, Figures and Tables
Supplement Results, Figures and Tables Results PET imaging The SUV was significantly higher in tumours of the parental HSC-3 cell line than tumours of the EV and the MMP-8 overexpressing cell lines (Figure
More informationRegulation of inflammation by histone deacetylases in rheumatoid arthritis: beyond epigenetics Grabiec, A.M.
UvA-DARE (Digital Academic Repository) Regulation of inflammation by histone deacetylases in rheumatoid arthritis: beyond epigenetics Grabiec, A.M. Link to publication Citation for published version (APA):
More informationMammalian Tissue Protein Extraction Reagent
Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction
More informationCommensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis
Supplementary Information Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation in Atherosclerosis Kazuyuki Kasahara 1,, Takeshi Tanoue 3, Tomoya Yamashita 1,*, Keiko
More informationHDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington
HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington Disclosures NIH AHA Insilicos Consultant Merck Research Support GSK Research Support Pfizer Research Support Corcept
More informationGenomic Medicine for Physical and Mental Health
Genomic Medicine for Physical and Mental Health Transform your health and mood with DNA-directed healthcare Learn about your DNA and what makes you unique Have you been trying to lose weight and gain muscle
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationTITLE: Biomarkers of Renal Tumor Burden and Progression in TSC. CONTRACTING ORGANIZATION: Massachusetts General Hospital Boston, MA
AD Award Number: W81XWH-10-1-0433 TITLE: Biomarkers of Renal Tumor Burden and Progression in TSC PRINCIPAL INVESTIGATOR: Elahna Paul, M.D., Ph.D. CONTRACTING ORGANIZATION: Massachusetts General Hospital
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationSUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
More informationEosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
More informationAnti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
More informationAdditional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
More informationHuman Cytokine Antibody Array
Li StarFish S.r.l. Via Cavour, 35-20063 Cernusco S/N (MI), Italy Tel. +39-02-92150794 - Fax. +39-02-92157285 info@listarfish.it -www.listarfish.it Human Cytokine Antibody Array Patent Pending Technology
More informationNatural and Synthetic lipid membrane nanovesiclesto repair and regenerate skin. Sai Kiang Lim, PhD
Natural and Synthetic lipid membrane nanovesiclesto repair and regenerate skin Sai Kiang Lim, PhD Research Focus of Lab Nano Lipid membrane vesicles Natural Extracellular Vesicles: microvesicles, exosomes,
More informationCell Lysis Buffer. Catalog number: AR0103
Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state
More informationAPPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE
AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST
More informationGenome Wide and Candidate Gene Studies in Cardiovascular Disease. Martin Hersberger Division of Clinical Chemistry and Biochemistry
Genome Wide and Candidate Gene Studies in Cardiovascular Disease Martin Hersberger Division of Clinical Chemistry and Biochemistry Global Risk Assessment for Cardiovascular Events in the Asymptomatic Patient
More informationSUPPLEMENTAL DATA. Table S1. Genes in each pathway selected for analysis.
SUPPLEMENTAL DATA Table S1. Genes in each pathway selected for analysis. Gene Chr Start End bp Pathway 1 AKR1C1 10 5000044 5022159 22115 COX 2 AKR1C2 10 5029967 5060207 30240 COX 3 AKR1C3 10 5077549 5149878
More informationGene Expression Multiplexing Menu
Gene Expression Multiplexing Menu Mouse Rat Human Table of CONTENTS Mouse Inflammatory Plex 2 Rat Stress Plex 3 Growth Regulation Plex 4 Multitox Plex 5 Pharma III Plex 6 Reference Plex 7 Human Transporter
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationRecombinant Integrins
Recombinant Integrins Ligand INTEGRIN α subunit S S β subunit Recombinant Integrins Integrins are heterodimeric integral membrane proteins that play key roles in regulating cell-cell and cell-extracellular
More informationqpcr-array Analysis Service
qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,
More informationAssay Kits
Assay Kits www.biogenuix.com» Immuno Assays Human Mouse Rat Rabbit Bovine Swine Equine Goat Faline Canine Chicken www.biogenuix.com Your leading RUO Assay supplier offering more than 800 Assays & Kits
More informationMultiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex
Multiplex Suspension Arrays NF-kβ p65 TGF-β1 c-jun Smad2 EGF IL-17A/F Akt IGF-IR Stat1 MEK1 IL-12p70 Bio-Plex Multiplex Immunoassays Analyte Guide Summer 2014 2014 Bio-Rad Laboratories, Inc. The Power
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationMutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals
Mutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals Jong-Gyu Lee 1,2, Ji-Hye Ahn 1,2, Tae Jin Kim 3, Jae Ho Lee 4, and Jung-Hye Choi 1,2 Table S1. Primer
More informationTarget Protein Antibody name Product number Manufacturer Species Epitope Dilution Aggrecan Anti-aggrecan AB1031 EMD Millipore Corp Rabbit
Family history Hypertension/ Maximum Degree of aortic Bicuspid Disease Age/Sex Diagnosed CTD of aortic disease Treated aortic insufficiency/stenosis aortic Aneurysm 63/M No Yes Yes/Yes diameter 59mm 1-2+/None
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationMicroparticles- Signaling in Atherothrombosis Agneta Siegbahn, MD, PhD, FESC Professor in Coagulation Science
Microparticles- Signaling in Atherothrombosis Agneta Siegbahn, MD, PhD, FESC Professor in Coagulation Science Department of Medical Sciences and Uppsala Clinical Research Center, Uppsala University Uppsala,
More informationGene expression of muscular and neuronal pathways is cooperatively dysregulated in patients
Gene expression of muscular and neuronal pathways is cooperatively dysregulated in patients with idiopathic achalasia Orazio Palmieri 1, Tommaso Mazza 2, Antonio Merla 1, Caterina Fusilli 2, Antonello
More informationSupplemental Material
Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin
More informationTHE BIOLOGY OF PLATELET-GEL THERAPY
THE BIOLOGY OF PLATELET-GEL THERAPY The synopsis of normal healing includes a well known sequence of coordinated phases. The unique process leading to healing is ontologically partitioned in three sequential
More informationRayBio Human ENA-78 ELISA Kit
RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,
More informationCancer FOCUS. Inside. R&D Systems Cancer Focus spring spring Cancer Stem Cells. EMMPRIN A New Link Between the MMP & upa Systems in Cancer
R&D Systems Cancer Focus spring 7 Cancer FOCUS Inside page 2 Cancer Stem Cells page 3 EPRIN A New Link Between the P & upa Systems in Cancer page 4 Cancer Immune Surveillance page 5 Receptor Tyrosine Kinases
More information