Hs LOC Hs.7100 T Hs YARS Tyrosyl-tRNA synthetase 0.24

Transcription

1 Supplementary Table S1 Genes differently expressed between LNM35 and N15 UniGene ID Gene symbol Description Ratio Genes up-regulated in LNM35 Hs LOC Hs SLC35B2 Solute carrier family 35, member B Hs.7100 T Genes down-regulated in LNM35 Hs AGR2 Anteriogradient 2 homolog 0.16 Hs YARS Tyrosyl-tRNA synthetase 0.24 Hs EIF2S2 Eukaryotic translation initiation factor 2, subunit 2 beta 0.29

2 Supplementary Table S2 Proteins differently expressed in shcim- vs. VC LNM35 No. Gene ID Gene symbol Description Ratio Genes up-regulated in shcim-lnm35 1 gi CPS1 carbamoyl-phosphate synthetase 1, mitochondrial gi NUP160 nucleoporin 160kDa gi PDIA3 protein disulfide isomerase family A gi WARS tryptophanyl-trna synthetase gi RPLP1 ribosomal protein P gi LGALS3 galectin gi GRP75 heat shock 70kDa protein 9B precursor gi MRLC3 myosin regulatory light chain gi SERPINE2 plasminogen activator inhibitor type gi RPL4 ribosomal protein L gi RPLP2 ribosomal protein P gi RPL6 ribosomal protein L gi RPS5 ribosomal protein S5 2.8

3 14 gi HIST2H4B histone cluster 2, H4b gi HSPB1 heat shock 27kDa protein gi ANXA7 annexin VII gi RPL31 ribosomal protein L gi PD1A6 protein disulfide isomerase-associated gi ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/imp cyclohydrolase gi CAST calpastatin gi DPP7 dipeptidyl-peptidase gi RPL36 ribosomal protein L gi RPS3A ribosomal protein S3a gi SPTBN1 spectrin, beta, non-erythrocytic 1 isoform gi NUP214 nucleoporin 214kDa gi NUP62 nucleoporin 62kDa gi PSMD1 proteasome 26S non-atpase subunit Genes down-regulated in shcim-lnm35 1 gi SERPINB5 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member gi AKR1B10 aldo-keto reductase family 1, member B10 0.5

4 3 gi EIF4A1 eukaryotic translation initiation factor 4A isoform gi AKR1C1 aldo-keto reductase family 1, member C gi RPS13 ribosomal protein S gi RPSA ribosomal protein SA gi RPL5 ribosomal protein L gi HNRNPU heterogeneous nuclear ribonucleoprotein U isoform a gi FLNA filamin A gi SERPINH1 serine (or cysteine) proteinase inhibitor, clade H, member 1 precursor gi STIP1 stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein) gi GANAB alpha glucosidase II alpha subunit isoform gi HISTH1 histone cluster 1, H1e gi MYH9 myosin, heavy polypeptide 9, non-muscle gi PSMA1 proteasome alpha 1 subunit isoform gi HNRNPL heterogeneous nuclear ribonucleoprotein L isoform a gi RPS14 ribosomal protein S gi PSMA5 proteasome alpha 5 subunit gi ACTB beta actin gi RPL3 ribosomal protein L3 isoform a 0.4

5 21 gi LDHB lactate dehydrogenase B gi PSMB3 proteasome beta 3 subunit gi PA2GA proliferation-associated 2G gi ANXA1 annexin A gi EEF1A1 eukaryotic translation elongation factor 1 alpha gi BiP Immunoglobulin heavy chain-binding protein gi HSPA8 heat shock 70kDa protein 8 isoform gi HNRNPC heterogeneous nuclear ribonucleoprotein C isoform b gi CALM1 calmodulin gi AGR2 anterior gradient 2 homolog gi RPS4X ribosomal protein S4, X-linked X isoform gi RPS16 ribosomal protein S gi FLNB filamin B gi SERPINB2 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member gi EEF2 eukaryotic translation elongation factor gi ALDH1A1 aldehyde dehydrogenase 1A gi TPI1 triosephosphate isomerase gi HSP90AB1 heat shock 90kDa protein 1, beta 0.3

6 39 gi HISTH1 histone cluster 1, H1c Hs ALDOA Aldolase A Hs ENO1 enolase Hs LDHA lactate dehydrogenase A Hs HNRPA1 heterogeneous nuclear ribonucleoprotein A1 isoform a Hs ANXA3 annexin A Hs RPL13A ribosomal protein L13a Hs ANXA2 annexin A2 isoform Hs VIM vimentin 0.1

7 Supplementary Table S3 Gene Ontology (GO) terms significantly related to the acquisition of metastatic phenotype GO aspect GO term GO accession P Biological processes translation GO: < cellular macromolecule metabolic process GO: cellular macromolecule biosynthetic process GO: cellular biosynthetic process GO: unfolded protein response GO: protein stimulus response GO: glycolysis GO: cellular protein metabolic process GO: protein metabolic process GO: glucose catabolic process GO: primary metabolic process GO: Molecular functions structural constituent of ribosome GO: structural molecule activity GO: Ca-dependent phospholipid binding GO: phospholipase inhibitor activity GO:

8 lipase inhibitor activity GO: enzyme inhibitor activity GO: Cellular component cytoplasm GO: < ribonucleoprotein complex GO: < macromolecular complex GO: < cytoplasmic part GO: ribosome GO: cytosol GO: non-membrane-bounded organelle GO: intracellular non-membrane-bounded organelle GO: intracellular part GO: organellar ribosome GO: mitochondrial ribosome GO:

9 Supplementary Information Primer sequence for generation of a CIM cdna probe by polymerase chain reaction a sense primer, 5'-TCTGCCCACAACTGGAGTTT an antisense primer, 5'-GGCCAACATATTCCCAAGGT Oligonucleotides sequence for generation of a CIM-specific shrna expression vector si#5; sense 5'-GATCCCC(GTGCAAAGAATCAGATTCA)ttcaagaga(TGAATCTGATTCTTTGCAC)TTTTTG GAAA-3', anti-sense 3'-GGG(CACGTTTCTTAGTCTAAGT)aagttctct(ACTTAGACTAAGAAACGTG)AAAAACCTTT TCGA-5' si#6; sense 5'-GATCCCC(GGACAACCCACATATCCAA)ttcaagaga(TTGGATATGTGGGTTGTCC)TTTTTG GAAA-3' anti-sense 3'-GGG(CCTGTTGGGTGTATATGGTT)aagttctct(AACCTATACACCCAACAGG)AAAAACCTT TTCGA-5') Control; sense, 5 -GATCCCCTTTTTTTTGGAAA antisense, 5 -AGCTTTTCCAAAAAAAAGGG

10 Oligonucleotides sequence for generation of a CIM expression vector CIMS; Sense 5'- AAACTGCAGGATGGAGGAAGGAGGCG CIMAS; anti-sense 5'- CGGGATCCGAGACACAGTGGGACAGAAA Two dimensional HPLC Instrument; DiNa Nano-flow LC system (KYA Technologies, Tokyo, Japan) Column; HiQ Sil SCX, 0.5 mm inside diameter (i.d.) x 35 mm (KYA Technologies) HiQ Sil C18-3 reverse-phase (RP) trap, 0.8 mm i.d. x 3 mm (KYA Technologies) HiQ Sil C18-3 Gradient RP analytical column, 0.15 mm i.d. x 50 mm (KYA Technologies) Elution buffer for a SCX column; 10, 30, 50, 80, 100, 150, 200, 300, and 500 mm of ammonium-formate in ph 3.0, containing 2 % acetonitrile) Condition for RP column; 0 to 50% solvent B in solvent A over 125 minutes (solvent A: 0.1 % formic acid (FA), 2% acetonitrile; solvent D: 0.1% FA, 70% acetonitrile) and % solvent B for 10 minutes at a flow rate 200 nl/minute Mass spectrometry analysis Instrument; Q-STAR XL mass spectrometer (Applied Biosystems Inc.) Analytical mode; Information-Dependent Acquisition (IDA) mode with the scan cycles set to perform a 1-second MS Scan followed by 3 MS/MS scans for 2 seconds each.

11 The acquisition method; 1 repetition at any m/z followed by a dynamic exclusion for a period of 60 seconds Data acquisition and analysis software; Analyst 1.1, ProQUANT 1.1 and ProGroup (Applied Biosystems Inc.) Search parameters; tolerance 0.3 Da for the MS and 0.15 Da for the MS/MS

12 Supplementary Figure legends Supplementary Fig. S1. Detection of CIM transcripts by Northern blot analysis in NCI-H460-LNM35 and -N15 clones knocked down for CIM. Supplementary Fig. S2. Detection of CIM transcripts by Northern blot analysis in various adult tissues. MTN TM blots containing 2 µg each of poly(a)+ RNA (Clontech) were used for the analysis of CIM expression. Significant abundant expressions of CIM transcripts 2.5 kb in size were present in testis, skeletal muscle, pancreas, and prostate tissues. CIM splice variant transcripts 2.0 kb in size are also abundantly observed in pancreas and testis. Supplementary Fig. S3. Significant up-regulation of CIM in the highly metastatic LNM35 subline as well as primary lung cancers. (A) Significantly more abundant CIM expression was found in highly metastatic LNM35 in comparison with that in its representative parental clone, N15. (B) Increased expression of CIM analyzed by northern blot in primary lung cancers in vivo. NL, normal lung; SCLC, small cell lung cancer; AD, adenocarcinomas; SQ, squamous cell carcinoma; LA, large cell carcinoma. (C) Increased expression of CIM analyzed by microarray in primary lung cancers in vivo. AD, adenocarcinomas; SQ, squamous cell carcinoma; LA, large cell carcinoma; LCNEC, large cell neuroendocrine carcinoma. Supplementary Fig. S4. Pathway analysis was performed using KeyMolnet according to the differential expression profiles of proteins between shcim- and VC-LNM35. A molecular interaction search was utilized, with the parameter set to 2 path. Closed circles, proteins in the differential expression profile. Open circles, selected by pathway analysis with KeyMolnet.

13 Supplementary Fig. S5. Detection of CIM transcripts by real-time RT-PCR analysis in LNM35 cells transiently transfected with sirna-control or -targeting CIM. Supplementary Fig. S6. (A) The expression of HIF-1α at the primary tumor sites of the xenografts of the shcim-lnm35 clones was reduced, as compared with the VC-LNM35 clones. (B) As compared to the primary tumor sites, the expression level of HIF-1α in metastatic nodules in the lungs of the shcim-lnm35 clones was considerably closer to that in those of the VC-LNM35 clones. Western blotting data presented here were first quantitated, then the relative expression ratio of HIF-1α to α-tubulin was calculated. The mean value for the VC-LNM35 clones was set at 1.0. Supplementary Fig. S7. Interaction of CIM with unfolded protein response proteins. Western blot analysis of total and phosphorylated-p38 (p38 and p-p38, respectively) expressions in shcim and VC clones cultured in the presence or absence of tunicamycin. α-tubulin was used as a loading control. Supplementary Fig. S8. CIM/ERLEC1/XTP3-B has multi-facetted roles, including modulation of unfolded protein response via binding to BiP as well as positive regulation of HIF-1α expression via binding to OS-9. The involvement of CIM/ERLEC1/XTP3-B in ER-associated protein degradation was recently reported (1-3). BiP, immunoglobin heavy chain-binding protein; HIF-1α, hypoxia inducible factor 1α; ER, endoplasmic reticulum; UPR, unfolded protein response; ERAD, ER-associated protein degradation; OS-9, osteosarcoma 9; PHDs, prolyl hydroxylases; SEL1L, Sel-1 suppressor of lin-12-like; Hrd1, Synovial apoptosis inhibitor 1; Ub, ubiquitin; HR, homologous regions (HR) between CIM and OS-9.

14 References 1. Cruciat CM, Hassler C, Niehrs C. The MRH protein Erlectin is a member of the endoplasmic reticulum synexpression group and functions in N-glycan recognition. J Biol Chem 2006; 281: Hosokawa N, Wada I, Nagasawa K, Moriyama T, Okawa K, Nagata K. Human XTP3-B forms an endoplasmic reticulum quality control scaffold with the HRD1-SEL1L ubiquitin ligase complex and BiP. J Biol Chem 2008; 283: Christianson JC, Shaler TA, Tyler RE, Kopito RR. OS-9 and GRP94 deliver mutant alpha1-antitrypsin to the Hrd1-SEL1L ubiquitin ligase complex for ERAD. Nat Cell Biol 2008; 10: