A combinatorial extracellular matrix platform identifies cell-extracellular matrix interactions that correlate with metastasis

Transcription

1 Received 1 Jul 1 Accepted 6 Sep 1 Pulished 9 Oct 1 DOI: 1.138/ncomms18 A comintoril extrcellulr mtrix pltform identifies cell-extrcellulr mtrix interctions tht correlte with metstsis Nthn E. Reticker-Flynn 1,, Dvid F. Brg Mlt 1,,3,, Monte M. Winslow 1,5, John M. Lmr 1, Mry J. Xu, Gregory H. Underhill 1,6, Richrd O. Hynes 1,7,8, Tyler E. Jcks 1,7,8,9 & Sngeet N. Bhti 1,,8,1,11 Extrcellulr mtrix interctions hve essentil roles in norml physiology nd mny pthologicl processes. Although the importnce of extrcellulr mtrix interctions in metstsis is well documented, systemtic pproches to identify their roles in distinct stges of tumorigenesis hve not een descried. Here we report novel-screening pltform cple of mesuring phenotypic responses to comintions of extrcellulr mtrix molecules. Using genetic mouse model of lung denocrcinom, we mesure the extrcellulr mtrix-dependent dhesion of tumour-derived cells. Hierrchicl clustering of the dhesion profiles differentites metsttic cell lines from primry tumour lines. Furthermore, we uncovered tht metsttic cells selectively ssocite with fironectin when in comintion with glectin-3, glectin-8 or lminin. We show tht these molecules correlte with humn disese nd tht their interctions re medited in prt y α3β1 integrin. Thus, our pltform llowed us to interrogte interctions etween metsttic cells nd their microenvironments, nd identified extrcellulr mtrix nd integrin interctions tht could serve s therpeutic trgets. 1 Dvid H. Koch Institute for Integrtive Cncer Reserch, Msschusetts Institute of Technology, Cmridge, Msschusetts 139, USA. Hrvrd- MIT Division of Helth Sciences nd Technology, Msschusetts Institute of Technology, Cmridge, Msschusetts 139, USA. 3 CellB, Advnced Therpeutics SA, Cntnhede, Portugl. Deprtment of Bioengineering, Institute for Biotechnology nd Bioengineering, Centre for Biologicl nd Chemicl Engineering, Instituto Superior Tecnico, Technicl University of Lison, Liso, Portugl. 5 Deprtment of Genetics, Stnford University School of Medicine, Stnford, Cliforni 935, USA. 6 Deprtment of Bioengineering, University of Illinois t Urn-Chmpign, Urn, Illinois 6181, USA. 7 Deprtment of Biology, Msschusetts Institute of Technology, Cmridge, Msschusetts 139, USA. 8 Howrd Hughes Medicl Institute, Cmridge, Msschusetts 139, USA. 9 Ludwig Center for Moleculr Oncology, Msschusetts Institute of Technology, Cmridge, Msschusetts 139, USA. 1 Division of Medicine, Brighm nd Women s Hospitl, Boston, Msschusetts 115, USA. 11 Deprtment of Electricl Engineering nd Computer Science, Msschusetts Institute of Technology, Cmridge, Msschusetts 139, USA. Correspondence nd requests for mterils should e ddressed to S.N.B. (emil: shti@mit.edu).. nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

2 nture communictions DOI: 1.138/ncomms18 Cncer metstsis is poorly understood multistep process tht results in 9% of cncer-relted deths 1,. At the time of initil dignosis, lmost hlf of lung denocrcinom ptients hve detectle metstses nd the mjority of the remining hlf will relpse with metsttic disese fter surgicl removl of the primry tumour nd djuvnt chemotherpy 3. Despite the ominous nture of metsttic disese, the moleculr mechnisms tht drive ech step re poorly chrcterized nd few effective therpies exist. Recently, it hs ecome pprent tht the tumour microenvironment drmticlly impcts metsttic progression 5. Chnges in cncer cell-extrcellulr mtrix (ECM) interctions likely influence ech stge of the metsttic cscde, from the loss of sement memrne dhesion to coloniztion of distnt sites. Furthermore, ltertions in mtrix production nd crosslinking cn promote metstsis 6 8. Consequently, inhiiting interctions of tumour cells with their microenvironments y trgeting dhesion molecules is n re of ctive investigtion 9,1. Although vriety of techniques exist for studying microenvironmentl interctions, it hs een chllenging to dte to interrogte the functionl implictions of specific cell ECM interctions in high-throughput mnner. Injection of metsttic cells into emryos documented the nti-tumor effects of the emryonic microenvironment 11,1, nd coculture studies hve identified the roles of crcinom-ssocited firolsts on tumour progression 13. ECM-coted trnswells hve een used to study the effects of smll numers of individul cndidte ECM molecules on D invsion 1, nd 3D collgen gels hve een useful prticulrly in the study of mtrix metlloproteinse ctivity 15. In vivo studies using gene-trgeted mice hve documented the importnce of severl ECM molecules nd their receptors in trnsplnt-sed models of cncer nd metstsis 16,17. Ech of these techniques hs documented key microenvironmentl regultors of metstsis, ut they hve not llowed n unised systemtic evlution of the role tht ECM components hve. Cell ECM interctions re prticulrly difficult to study ecuse of their complexity of synergistic nd ntgonistic interctions in vivo 18. Experiments trgeting integrins, centrl fmily of cell surfce receptors tht medite ECM interctions, hve implicted integrin ECM interctions s importnt regultors of cncer progression 9,19,. However, in ddition to dhesion, integrins regulte stress trnsmission nd idirectionl signlling, nd typiclly ind multiple ECM molecules 1. Furthermore, trnsmemrne collgens, syndecns, lectins, crohydrtes, gngliosides, glycolipids, CD nd dystroglycns re mong host of non-integrin ECM receptors. Thus, techniques tht llow the specific unised interrogtion of cell ECM dhesion re required to directly query the diversity of potentil interctions. In this study, we descrie high-throughput pltform cple of systemticlly uncovering cell ECM interctions, nd use this method to chrcterize the glol chnges in ECM dhesion in model of cncer progression. We previously descried first-genertion pltform tht utilized rootic spotting technology to generte rrys with comintions of five ECM molecules found in norml sement memrne nd connective tissue. Since then, others hve utilized similr pltforms to investigte ECM responses 3 6. Although these pltforms hve demonstrted fesiility of such pproches in physiologicl processes such s differentition of stem cells, they hve not yet een pplied to increse our understnding of disese sttes. Furthermore, their limited size (typiclly five different ECM molecules) hs prevented them from querying the diversity of ECM interctions present in the humn ody. Here, we present n expnded ECM microrry pltform contining 768 unique pirwise ECM molecule comintions expressed differentilly in development, regenertion nd disese including n expnded representtion of proteoglycns nd glycosminoglycns, which re difficult to study through integrin mnipultion lone, nd pply them to investigte chnges in dhesion throughout metsttic progression. We hve estlished high-throughput pipeline to generte these microrrys tht utilizes liquid hndlers for mixing of source ECM, optimized cell-seeding devices nd utomted imge cpture nd nlysis. We studied the dhesion profiles of lung denocrcinom cell lines generted from geneticlly engineered mouse model where discrete stges of metsttic progression hve een defined, nd correlted the findings with in vivo ECM distriutions in mice nd humns with metsttic lung cncer 7 9. This pproch is esily extensile to other disese sttes, ECM comintions nd phenotypic redouts. Results Extrcellulr mtrix microrrys to proe cell ECM dhesion. To llow the unised study of the ECM dhesion chrcteristics of ny cells-of-interest, we developed novel high-throughput pltform. We expnded, utomted nd optimized our dhesion pltform,3 to include every single nd pirwise comintion of 38 unique ECM molecules (Supplementry Tle S1). Thus, these rrys contin 768 different comintions in quintuplicte nd 16 control spots, for totl of, rryed fetures. To fricte the rrys, the 38 ECM molecules nd controls re trnsferred from 96-well source plte to two low-volume 38-well pltes nd mixed thoroughly using rootic liquid hndler. These 38-well pltes re then used s source pltes for deposition of the mtrix comintions onto the slides y DNA microrry spotter. Before deposition of the molecules, slides re coted with polycrylmide hydrogel tht is llowed to dry fter soking to remove ny unpolymerized monomer. The dehydrted hydrogel cts to entrp molecules without requiring their chemicl modifiction (Fig. 1). Our dt indicte tht molecules lrger thn ~1 kd cn e roustly entrpped in the hydrogel (Fig. 1), nd we verified their entrpment using NHS-Fluorescein lelling or ntiody-medited detection fter entrpment (Fig. 1c). Of the 38 molecules tht we tested y these methods, ll showed excellent reproduciility nd uniformity within the expected region of printing (Fig. 1c). To mesure cell ECM interctions, cells re seeded onto the rrys in serum-free medi nd llowed to dhere for 1.5 h t 37 C (Supplementry Fig. S1). To ensure uniform seeding, the slides re gitted every 15 min. Furthermore, the top surfces of the slides re held flush with the ottom of the plte through the use of custom-designed seeding device tht employs vcuum sel (Supplementry Fig. S1 nd 1c). This device minimizes seeding vriility etween experiments nd voids cell loss y preventing cells from settling elow the slide surfce or on the cks of the slides. Uniformity of seeding cross individul rrys nd etween replicte rrys ws confirmed using test slides composed of only one mtrix molecule. To quntify cells ound to ech spot, nuclei re stined ccording to conventionl fluorescence stining protocols, nd the slides re imged using n utomted inverted epifluorescent microscope with NIS Elements softwre (Figs 1d nd ). Lrge imges re cropped to individul spots nd indexed using MATLAB (Mthworks), nd dhesion is quntified using CellProfiler softwre to detect nd count nuclei (Fig. ) 3. Susequent imge nd dt nlysis is performed in MATLAB. ECM microrrys identify distinct dhesion profiles. To uncover chnges in the glol dhesion profile of cncer cells during cncer progression nd metsttic spred, we nlysed pnel of murine lung denocrcinom cell lines derived from non-metsttic primry tumours (T nonmet ), primry tumours tht metstsized (T Met ), or lymph node (N) nd liver (M) metstses (Supplementry Tle S) 9. These cell lines were derived from geneticlly engineered mouse model of metsttic lung denocrcinom in which tumours were initited in Krs LSL G1D/ + ;p53 flox/flox mice with lentivirl- Cre vectors. The stle nd rndom integrtion of the lentivirl nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

3 nture communictions DOI: 1.138/ncomms18 ARTICLE c d 1 : ECM molecules : Polycrylmide : Glss Moleculr weight (kd), ECM molecules 1 Fluorescence intensity (RFU) ECM comintions. For ech of the 11 murine lung denocrcinom cell lines tested, distinct profiles tht were highly reproducile cross replicte slides were otined (Fig. e). We used the ECM microrrys to compre the dhesion profiles of popultions from ech of the T nonmet, T Met, N nd M clsses of cell lines. We pplied unsupervised hierrchicl clustering nlysis of the dhesion vlues in mnner nlogous to clustering of gene expression microrry dt. Interestingly, ll the cell lines derived from metstses (N or M), sve for one lymph node line, clustered independently from the cell lines derived from primry lung tumours (T nonmet or T Met ) (Fig. 3). This result is prticulrly notle, s two of the metsttic lines ( nd 389N1) were generted from metstses tht originted from two of the primry tumours ( nd 389T, respectively), yet clustered more closely to the other metstses thn the lines derived from those primry tumours. Thus, there is conserved chnge in the ECM dhesion profile of cncer cells present in metsttic site versus those tht remin in the primry tumour. Furthermore, this differentil clustering ws not evident from unsupervised hierrchicl clustering of the gene expression of these lines (ref. 9 nd Supplementry Fig. S), suggesting tht the metstsis-specific dhesion phenotype provides complementry, non-overlpping view of the moleculr meditors tht influence metsttic progression. Figure 1 Extrcellulr mtrix microrry pltform presents comintions of ECM molecules for cell ttchment. () ECM microrrys re generted y spotting nerly 8 unique comintions of ECM molecules on glss slides coted with polycrylmide followed y seeding of cells onto the slides. () Polycrylmide cts to entrp molecules of lrge rnge of moleculr weights. (c) Verifiction of presenttion of ll molecules y immunoleling (coloured spots) or NHSfluorescein lelling (gryscle spots) of ll molecules susequent to rry genertion nd rehydrtion. (d) Representtive imges of cells dhered to ECM spots demonstrting selective dhesion in the loctions of ECM. Scle r on five-spot imge is µm. Scle rs on single-spot imges re 5 µm. vector llowed the clonl reltionship etween the multifocl primry tumours nd metstses to e estlished 9. Anlysis of the dhesion profiles of these cell lines highlighted the diverse dhesion of ech line to different ECM comintions (Fig. c). Our nlysis of these cell lines reveled highly reproducile dhesion etween replicte spots nd rrys, confirming the quntittive nture of the ssy (Fig. e). We exmined the profiles to interrogte whether vrious popultions exhiit enhnced dhesion to comintions of ECM molecules, reltive to the sme molecules spotted in isoltion. This nlysis reveled tht different pirwise-comintions of ECM molecules result in dditive, synergistic nd ntgonistic effects on dhesion. For exmple, for the T nonmet cell line shown in Fig. c,d, mny molecules improve dhesion to collgen I, wheres others reduce cell inding in comprison with the molecule in isoltion (lue line, Fig. d). A similr rnge of responses ws oserved for other molecules, including collgen IV nd fironectin (Fig. d). These types of comintoril effects were present for mny molecules, nd, while the specific ptterns vried, ll cell lines tested exhiited exmples of incresed nd reduced inding to vrious Identifiction of metstsis-ssocited ECM molecules. In light of the hierrchicl clustering results, we sked whether there were prticulr comintions of molecules tht re fvored y metsttic cells rther thn y cells from primry tumours. Thus, we compred the verge dhesion of the liver metstsis-derived cell lines (M) for ech ECM comintion to the verge dhesion of the T Met lines (Fig. 3). Although mny of the M lines exhiit elevted inding to comintions contining fironectin, pirings tht comined fironectin with ny of glectin-3, glectin-8 or lminin hd the highest differentil dhesion etween line clsses. To explore chnges in dhesion tht specificlly correlted with chnges in metsttic progression, we compred the T Met cell line nd the clonlly relted liver metstsis-derived cell line. This pir of lines ws derived from primry tumour nd metstsis tht disseminted from tht tumour, s confirmed y exmintion of the lentivirl integrtion site 9. Furthermore, the differentil dhesion to the forementioned ECM comintions ws cler in oth the group-wise comprison (Fig. 3) nd in the direct comprison with this primry tumour-liver metstsis pir (Fig. 3c). Collectively, the ptterns oserved suggest tht comintions of molecules my hve more significnt role in the dhesion profile of given popultion thn the tendency to ind to ny of the ECM molecules lone. Interestingly, the trend towrds incresed inding to fironectin/glectin-3, fironectin/lminin nd fironectin/ glectin-8 comintions ws consistent cross tumour progression when we compred the verge dhesion of ll T nonmet, T Met, N nd M cell lines (Fig. 3d). Binding to these molecules, when presented lone, showed miniml (fironectin) or no trend (lminin, glectin-3 nd glectin-8) cross the four groups of cell lines (Supplementry Fig. S3, red rs). When in comintion, however, these pirs demonstrte enhnced effects tht exceed the dditive vlues of their individul dhesion. In contrst, other comintions demonstrted reduced dhesion trend in reltively more metsttic popultions, including vriety of collgens nd osteopontin (Supplementry Fig. S3 c). Tken together, these dt suggest tht dhesion to fironectin in comintion with ny of glectin-3, glectin-8 or lminin is highly ssocited with tumour progression in this model system. We lso noted tht some comintions of molecules pper to elicit ntgonistic effects on dhesion. We looked more closely t the dhesion profile of the M line (Supplementry Fig. S) nd oserved tht, wheres the metstsis-ssocited molecules nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

4 nture communictions DOI: 1.138/ncomms18 d Collgen I c Collgen I Collgen II Collgen III Collgen IV Collgen V Collgen VI Fironectin Lminin Lminin α Tenscin R Chondroitin sulfte Aggrecn Elstin Kertin Mucin Super fironectin F-Spondin Nidogen- Heprin sulfte Biglycn Decorin Glectin-1 Glectin-3 Glectin-3c Glectin- Glectin-8 Thromospondin- Osteopontin Osteonectin Testicn 1 Testicn Firin Tenscin C Nidogen-1 Vironectin Agrin Hyluronn Brevicn e Collgen I Collgen II Collgen III Collgen IV Collgen V Collgen VI Fironectin Lminin Lminin α Tenscin R Chondroitin sulfte Aggrecn Elstin Kertin Mucin Super fironectin F-Spondin Nidogen- Heprin sulfte Biglycn Decorin Glectin-1 Glectin-3 Glectin-3c Glectin- Glectin-8 Thromospondin- Osteopontin Osteonectin Testicn 1 Testicn Firin Tenscin C Nidogen-1 Vironectin Agrin Hyluronn Brevicn Cell line 1 Cell line 1 Normlized dhesion Collgen IV Fironectin Collgen I Collgen II Collgen III Collgen IV Collgen V Collgen VI Fironectin Lminin Lminin α Tenscin R Chondroitin sulfte Aggrecn Elstin Kertin Mucin Super fironectin F-Spondin Nidogen- Heprin sulfte Biglycn Decorin Glectin-1 Glectin-3 Glectin-3c Glectin- Glectin-8 Thromospondin- Osteopontin Osteonectin Testicn 1 Testicn Firin Tenscin C Nidogen-1 Vironectin Agrin Hyluronn Brevicn Figure Comintoril dhesion profiles re generted using ECM microrrys. () Nucler stin of cells seeded on the ECM microrrys. () Identifiction of individul nuclei on one spot using CellProfiler 3. (c) Quntifiction of dhesion to ll molecule comintions for one cell line. (d) Selected dhesion profiles for three molecules: Collgen I (lue), Collgen IV (green) nd Fironectin (red) in comintion with ll other molecules. Dshed lue lines represent dhesion to tht molecule lone. Arrows denote comintions with the other two molecules or lone. Error rs re s.e.m. of three replicte slides. (e) Comprisons of three replicte slides for two representtive cell lines. Scle rs in () nd () re 5 µm nd 1 µm, respectively. lminin, glectin-3 nd glectin-8 ll increse dhesion to fironectin, other molecules ppered to decrese dhesion to it (Supplementry Fig. S). In vitro dhesion ssys using co-dsored ECM to multiwell polystyrene pltes confirmed tht the ddition of these molecules does indeed decrese the dhesion of this line to fironectin (Supplementry Fig. Sc). Collectively, the existence of oth synergistic nd ntgonistic effects highlights the importnce of investigting comintions of ECM molecules rther thn isolted components. ECM molecules re present in sites of endogenous tumours. Next we sought to correlte our in vitro dhesion profiles with ECM expression in vivo. To investigte whether the identified ECM molecules my e importnt in nturl tumorigenesis, orgns contining primry utochthonous tumours nd their metstses were resected from Krs LSL G1D/ + ;p53 flox/flox mice nd stined. Trichrome stining of lungs with extensive tumour urden reveled significnt presence of ECM deposition in the tumour-ering lung (Supplementry Fig. S5 nd ref. 31). Previously, we found tht primry tumours tht hve cquired the ility to metstsize (T Met tumours) upregulte the chromtin-ssocited protein Hmg (ref. 9). Therefore, we used Hmg immunohistochemistry in ddition to histologicl chrcteristics to identify res of highly ggressive cncer cells (Supplementry Fig. S5). As nticipted, primry lung tumours were positive for collgen I (lck rrowheds), collgen VI (open lck rrowheds) nd osteopontin (red rrowheds), with the most intense stining overlpping with the high-grde tumour res (Supplementry Fig. S5 nd S5c). In prticulr, osteopontin stining strongly co-loclized with Hmg pos regions, suggesting tht incresed osteopontin production is ssocited with metsttic primry lung tumours. Furthermore, little to no lminin, glectin-3 or glectin-8 stining ws detected in the primry tumours (Fig. ). Interestingly, fironectin stining in the tumour ws strong, reveling correltion etween incresingly nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

5 nture communictions DOI: 1.138/ncomms18 ARTICLE 6 T Met versus M FN/Lm Averge M dhesion FN/Gl-3 FN/Gl-8 6 Averge T Met dhesion c dhesion (M) 8 6 FN/Lm versus FN/Gl-3 FN/Gl-8 8T1 389T 8T 8N1 39T 368T1 389N1 691M1 691N1 6 8 dhesion (T Met ) d Normlized dhesion 8 FN + Lm 8 FN + Gl-3 8 FN + Gl T nonmet T Met N M T nonmet T Met N M T nonmet T Met N M Figure 3 ECM microrrys identify key dhesive chnges in metsttic progression. () Unsupervised hierrchicl clustering of dhesion profiles generted y the ECM microrrys. Verticl xis represents different ECM comintions. Horizontl xis represents different cell lines. Yellow rs indicte primry tumours (T nonmet nd T Met lines). Red rs indicte nodl (N) or distnt metstses (M). () Averge dhesion of metsttic cell lines (M) to ech comintion compred with those of the metsttic primry tumour cell lines (T Met ). (c) Comprison of dhesion for ech comintion to its mtching primry tumour line,. Red dots indicte top ECM comintions exhiiting preferentil dhesion y metsttic lines over the metsttic primry tumour lines. (d) Top three comintions exhiiting the gretest increse in dhesion cross tumour progression s represented y the four clsses of cell lines (T nonmet, T Met, N nd M). Error rs in (d) re s.e.m. of the different cell lines of ech clss (n = 3 cell lines per clss) with the exception of the M clss where there re two lines, nd thus the error rs re the rnge of the mens. metsttic popultions nd the presence of fironectin erly in the metsttic cscde (Fig. ). We next sked whether the lymph node nd distnt orgn metstses contined the metstsis-ssocited ECM molecules. Agin, trichrome stining reveled the presence of significnt mtrix deposition within the lymph nodes (Supplementry Fig. S5). As expected, the entirety of the lymph node tumours ws histologiclly high-grde nd ws Hmg pos (Supplementry Fig. S5). There ws lso cler expression of ll four of the metstsis-ssocited molecules (fironectin, lminin, glectin-3 nd glectin-8) within the lymph node metstses (Fig. ). Furthermore, there ws essentilly no collgen I or collgen VI (Supplementry Fig. S5c). Osteopontin, however, ws present in the metstses (Supplementry Fig. S5c) nd hd its highest expression long the invsive front (Supplementry Fig. S5,d). We lso exmined common metsttic sites for the presence of the metstsis-ssocited molecules (Fig. ). Both glectin-3 nd glectin-8 were distinctly visile in these sites. Lminin nd fironectin oth ppered to line the sinusoids of the livers of the mice nd were lso present in the metstses formed there. To determine whether these differences etween the primry nd metsttic sites were due to ltered mtrix production y the tumour cells, we performed immunolots on the nd T Met nd M cell lines. Although the M line showed slight increses in fironectin nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

6 nture communictions DOI: 1.138/ncomms18 Fironectin Lminin Glectin-3 Glectin-8 Primry lung LN Met Distnt site Kidney Liver nd lminin production compred with the T Met line, production of oth glectins ws constnt (Fig. 5). Furthermore, collgen I production ws constnt, nd osteopontin production ws ctully incresed in the M line. Tken together, these dt suggest tht the ECM microrrys identified molecules tht were found within the physiologiclly relevnt sites of mice ering utochthonous tumours, nd tht production of these molecules is not solely performed y the tumour cells present in those sites. Integrin surfce expression correltes with ECM-inding profiles. We noted tht comprisons of dhesion trends on our ECM rrys did not necessrily correlte with trnscriptionl profiles of the cognte integrins (Fig. 5). Thus, to correlte our findings with the presence of receptors for these metstsis-ssocited ECM molecules, we exmined the clonlly relted pir of representtive T Met nd M cell lines for surfce expression of their cognte integrins. Although the mrna expression ptterns did not show significnt upregultion of the metstsis-ssocited integrins in the M line y gene expression microrry (Fig. 5c), flow cytometry nlysis of the integrin suunits corresponding with either the primry tumour-ssocited molecules or metstsis-ssocited molecules reveled tht the receptor expression trends were consistent with the oserved inding ptterns. Specificlly, integrin suunits known to ind fironectin (α5 nd αv), lminin (α6 nd α3) nd T T Kidney Kidney Figure Metstsis-ssocited ECM molecules re present in the sites of metstses ut not primry tumours. Immunostining of the metstsis-ssocited ECM molecules in the lungs, lymph nodes nd distnt metstses of mice ering endogenous lung denocrcinoms (Krs LSL G1D/ + ;p53 flox/flox mice). Insets re mgnified views of oxed res showing ECM molecule firils. Numer of tissues exmined for ech orgn: lungs: 1; lymph nodes: 5; livers/kidneys:. T : tumour. Dotted line depicts edge of tumour nd norml kidney. Scle rs re 5 µm. glectins (α3) were ll more prevlent on the metstsis-derived line, while those ssocited with collgens (α1 nd α) were reltively higher on the primry tumour-derived line (Fig. 6). Nonetheless, the surfce expression trends were consistent for the other T Met nd M lines s well (Supplementry Fig. S6). Furthermore, within given cell line, we oserved reltively homogeneous surfce expression of the metstsis-ssocited integrins (Supplementry Fig. S6), suggesting tht vritions in dhesion etween lines re due to glol increses in surfce receptor expression rther thn inding ptterns of select supopultions. Immunohistochemistry reveled tht these integrins were lso present in the metstses of mice ering utochthonous tumours, ut not the djcent tissue (Fig. 6). The finding tht the trnscriptionl levels of the integrins do not gree with the dhesion trends suggests tht post-trnscriptionl regultion, post-trnsltionl modifictions such s ltered glycosyltion or ltertions in ctivtion stte of the integrins re likely responsile for the chnges in dhesion. Thus, y utilizing our pltform tht investigtes specific ECM inding rther thn receptor gene or protein expression, we re le to identify cndidte ECM interctions tht might otherwise hve een overlooked. Integrin α3β1 medites dhesion nd seeding in vitro nd in vivo. To exmine which cndidte receptor/ecm interctions my prticipte in the oserved inding ptterns, we performed in silico network mpping of the metstsis-ssocited ECM molecules using GeneGO softwre (Metcore) of mnully curted moleculr interctions. We generted network mp tht we termed the lung denocrcinom metstsis network tht hs gretest disese ssocition with Neoplsm Metstsis (P = , hypergeometric test, Fig. 7, Supplementry Fig. S7). A network generted using the sme prmeters ut with the primry tumorssocited molecules did not exhiit ny disese ssocition with metstsis (Supplementry Fig. S8). Anlysis of the lung denocrcinom metstsis network identified integrin α3β1 s the surfce receptor with the gretest numer of edges (Fig. 7). On the sis of this finding, we performed knockdown of oth the α3 nd β1 suunits (Itg3 nd Itg1, respectively) using short-hirpinmedited RNA-interference (Supplementry Fig. S9). Knockdown of these genes in the metsttic line,, resulted in reduced dhesion to the metstsis-ssocited molecules in vitro when compred with the control hirpin trgeting the firefly luciferse gene (Fig. 7c). We next ssessed whether this integrin dimer hs role in metsttic seeding in vivo. Thus, we conducted experimentl metstsis ssys y intrsplenic injection of -shα3 or -shff cells into wild-type mice, nd monitoring for liver tumour formtion. We found tht mice injected with the -shα3 cells formed fewer tumour nodules thn the controls (Fig. 7d-f). Tken together, these findings suggest tht the α3β1 integrin dimer hs role in dhesion of metsttic cells to the metstsis-ssocited ECM molecules nd in metsttic seeding. Glectin-3/8 is present in humn lung cncer metstses. Bsed on the in vitro dhesion dt nd in vivo mouse findings, we sought to explore the role of the metstsis-ssocited ECM molecules in humn smples. Using Oncomine 3, humn genetic dtset nlysis tool, we exmined the correltion of ECM gene expression nd disese severity (for exmple, clinicl stge or the presence of metstses). Results of these queries demonstrte tht incresed expression of LGALS3 or LGALS8 (glectin-3 nd glectin-8, respectively) correlte with incresed clinicl stge or the presence of metstses (Fig. 8). We next investigted whether glectin-3 protein is present t higher levels in mlignnt humn lung tumours compred with enign non-neoplstic humn lung tissue using smples tken from lungs nd lymph nodes of ptients. Stining for nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

7 nture communictions DOI: 1.138/ncomms18 ARTICLE ECM: Gl-3 Gl-8 FN Lm Coll I OPN α-tuulin 3 kd 5 kd kd 3 kd 5 kd 5 kd 15 kd 15 kd 6 kd 5 kd 7 Integrin expression versus ECM dhesion c log mrna expression 13 Itg1 Normlized dhesion 3 1 Itg3 Itg5 Itg Itgv Itg3 5 1 Integrin expression Itg6 Figure 5 ECM production nd integrin mrna expression y cell lines hve miniml correltion with dhesion. () Western lot nlysis of the metstsis- nd primry tumour-ssocited ECM molecules produced y the (T Met ) nd (M) cell lines. () Comprison of ECM dhesion for ll cell lines to gene expression of the cognte integrins from gene expression microrry dt. (c) Integrin suunit mrna expression from Affymetrix microrry nlysis in nd cell lines. glectin-3 in humn tissue microrrys reveled higher presence of the molecule in lymph nodes of ptients with mlignnt disese (88%) compred with those without cncer (38%) (Fig. 8). Furthermore, there ws higher frction of glectin-3-positive lymph nodes (88%) thn positive primry lung tumour smples (7%), confirming its ssocition with the metsttic site over the primry tumour (P <.5, Fisher s exct test). Thus, the ECM microrrys were cple of identifying interctions ssocited with metstsis in humn lung cncer. Discussion Our ECM microrrys provide high-throughput multiplexed pltform cple of mesuring vriety of cellulr responses to ECM. Here, we show they re cple of identifying dhesion ptterns tht differentite metsttic popultions from primry tumours. We found tht metsttic lung cncer cells preferentilly ind to fironectin in comintion with lminin, glectin-3 or glectin-8 compred with cells derived from primry tumours. These chnges in dhesion correlte with chnges in surfce presenttion of vrious integrins. In prticulr, α3β1 medites dhesion to these molecules in vitro nd permits metsttic seeding in vivo. Furthermore, metstses derived from oth geneticlly engineered mouse lung cncer model nd from humn lung cncers express the metstsis-ssocited ECM molecules. It is worth noting tht the comintions of these ECM components elicited the strongest effects, highlighting the importnce of using pltform tht is cple of mesuring responses to more thn individul molecules. Glectins re clss of lectins tht ind β-glctosides nd cn ssocite with other ECM molecules such s fironectin 33. Glectin-3 is ssocited with metstsis in vriety of cncers 3,35 nd cn ind to the oncofetl Thomsen-Friedenreich ntigen, crohydrte ntigen overexpressed y mny crcinoms 36. Our pltform confirmed its importnce in lung denocrcinom, nd lso identified glectin-8 s hving similr importnce. Although glectin-8 is known to ffect dhesion of cells to other mtrix molecules, its role in cncer nd metstsis hs een less cler s it hs een found to hve oth positive nd negtive ssocition with dhesion nd tumorigenesis 37,38. Using the ECM microrrys, we showed tht inding to glectin-8 in comintion with fironectin is strongly ssocited with metsttic progression in lung denocrcinom. Furthermore, in ddition to mny collgens, we found tht loss of dhesion to osteopontin ccompnied metsttic progression (Supplementry Fig. S3-c). Osteopontin levels correlte with prognosis in ptients with metsttic disese 39, nd secretion of osteopontin y primry tumours results in moiliztion of one mrrow-derived stroml precursors tht help estlish the metsttic niche. In ddition to confirming the presence of the metsttic molecules t the sites of metstses, we found tht the invsive portions of primry tumours nd the invsive front of the metstses secrete osteopontin (Supplementry Fig. S5). A metsttic tumour line lso produces more osteopontin thn its corresponding primry (Fig. 5). These findings suggest tht while some primry tumours my ctivte one mrrow cells y secreting osteopontin, in our model, metsttic cells my contriute to this recruitment t comprle or higher level thn the instigting primries, despite their own loss of dhesion to the immoilized molecule. The use of gene expression signtures for ptient strtifiction in the clinic hs ecome more widespred 1 5, ut while genomic pproches hve een eneficil for identifying cndidte genes, the diversity of findings mkes the development of rod therpeutic options seem nerly impossile. By ssying for conserved mechnisms t the phenotypic level, however, relevnt trgets cn e identified nd therpeutics cn e developed for rod spectrum of ptients. Our results highlight the utility of phenotypic screening pproches for identifying clinicl iomrkers. Although we identify α3β1 integrin s therpeutic trget, we lso demonstrte tht nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

8 nture communictions DOI: 1.138/ncomms18 Metstsis ssocited Primry tumor ssocited counts counts α5 αv α6 α3 α1 α %.1% % 3.183%.7% % 6 98.% 6 97.% Integrin-APC Integrin αv Integrin α5 Integrin α3 5.5% 6 5.6% % 66.1% Tumor Liver Liver Lymph node Adjcent tissue Figure 6 Integrin surfce expression correltes with ECM-inding profiles. () Flow cytometry of integrin surfce expression in (T Met ) nd (M) cell lines. Integrin suunits tht ind to metstsis-ssocited molecules show incresed surfce presenttion in the metsttic line (α5, αv, α6, α3), while those tht ind to primry tumour-ssocited molecules show decresed presenttion (α1 nd α). () IHC for metstsis-ssocited integrins in mice ering utochthonous tumours with spontneous metstses to the liver nd lymph nodes. Scle rs re 1 µm. the dhesion signtures generted y the ECM microrrys re cple of differentiting etween geneticlly similr popultions with vrying metsttic potentil. Furthermore, no increse in the mrna levels of the glectins or their receptors ws oserved y gene expression microrrys in the M lines (Fig. 5 nd ref. 9), despite the ssocition of these molecules with metstsis. The presence of glectin-3 nd glectin-8 in humn smples (Fig. 8) demonstrtes the relevnce of this pltform to humn disese, nd thus, we envision tht these rrys my e useful clinicl tool for strtifiction of cncer ptients eyond trditionl TNM stging. The vlue of the ECM microrry pltform extends eyond the specific ppliction of cncer metstsis. Although this study documents the ility to profile dhesion ptterns, cells ound to the rrys cn e kept in culture for multiple dys to monitor longterm responses to ECM such s cell deth, prolifertion nd ltertions in gene or protein expression. Towrd tht end, one could use multiplexed ntiody stining to proe the effects of ECM on stem cell differentition or ctivtion. Orthogonl screens cn e performed to look t the effects of growth fctors, smll molecules or RNAinterference gents in the context of ECM. Reduction of requisite nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

9 nture communictions DOI: 1.138/ncomms18 ARTICLE Lung denocrcinom metstsis network in vitro dhesion Normlized dhesion 1..5 * shff shα3 shβ1 ** Normlized dhesion 1..5 *** shff shα3 shβ1 ***. Fironectin+ Glectin-3. Fironectin+ Glectin-8 c No. of surfce nodules 1, 1 1 Liver metstsis seeding P = shff sh 3 d shff shα3 e shff shα3 Figure 7 Integrin 3 1 medites dhesion nd seeding in vitro nd in vivo. () In silico network mpping using GeneGO (MetCore) genertes the lung denocrcinom metstsis network. Anlysis of the network revels tht integrin α3β1 is the surfce receptor with the most edges (). Knockdown of oth α3 nd β1 integrin suunits y shrna reduces dhesion to metstsis-ssocited molecules in vitro () nd prevents metsttic seeding in vivo (c e). shff is the control hirpin trgeting firefly luciferse. One-wy ANOVA with Tukey s Multiple Comprison Test ws used to nlyse the dt in figure (). Error rs in () represent s.e. (n = 3). (c) Numer of liver tumour nodules of the surfce of livers.5 weeks fter intrsplenic injection. Mnn Whitney (non-prmetric) test ws used to nlyse significnce. (d) Fluorescence imging of whole livers fter resection. Cell lines express nucler-excluded ZSGreen. Scle rs re.5 cm. (f) Hemtoxylin nd eosin stin of liver slices. Scle rs re mm. Blue dt points in (d) correspond to imges in (e) nd (f). All results shown re representtive of multiple independent experiments. cell numers cn e chieved using miniturized rrys to screen rre cell popultions such s circulting tumour cells or cncer stem cells nd to help expnd those popultions in vitro for further iologicl studies. Overll, the ECM microrrys will enhnce our ility to study host of questions s they pertin to oth sic iologicl nd clinicl settings. Methods Murine lung denocrcinom cell lines. Cell lines hve een descried 9. Briefly, tumour initition ws chieved using intrtrchel injection of lentivirl Cre recominse. Tumours were resected, digested nd plted onto tissue culture treted plstic to generte cell lines 9. Cell lines were susequently cultured in Dulecco s modified Egle s medium (DMEM), 1% foetl ovine serum, penicillin/streptomycin nd glutmine. These lines were derived from oth primry lung tumours nd their metstses. See Supplementry Tle S for nomenclture regrding cell line origins. Cell trnsplnttion ssys. All niml procedures were performed in ccordnce with the MIT Institutionl Animl Cre nd Use Committee under protocol Cell injection studies were performed in B619SF1/J mice (Jckson Lortory, Stock Numer 113). Intrsplenic injections were performed using cells resuspended in 1 µl of phosphte-uffered sline (PBS) nd injected into the tip of the spleen following existing protocols 9. Animls were nesthetized with vertin efore surgery. Fur ws removed from the nimls nd they were sterilized with Betdine nd 7% ethnol. The spleen ws exteriorized following incisions in the skin nd ody wll. Cells were injected into the end of the spleen with 7-guge syringe nd llowed to trvel into circultion for min. Spleens were then excised from the nimls following cuteriztion of the splenic vessels. The muscle wll ws closed using 5- dissolvle sutures, nd the skin ws closed using 7 mm wound clips (Rooz). Mice were killed.5 weeks following injection, nd their livers were excised. Quntifiction of surfce nodules nd imging of livers ws performed using dissection microscope. Tissues were emedded in prffin following fixtion in % prformldehyde nd stined using hemtoxylin nd eosin. nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

10 nture communictions DOI: 1.138/ncomms18 log medin-centered intensity P =.18. P =. log medin-centered intensity Stge I (11) Stge II (5) Stge: I (3) II (7) III (1) IV (3) e Benign lung 56% (3/1) Mlignnt lung 7% (18/38) Gl-3-negtive Gl-3-positive c log medin-centered intensity P = 9.7E- Stge I (11) Stge II (5) d log copy numer units M (16) P =.13 M1+ (6) Norml lymph Node - 38% (3/8) Mlignnt lymph Node - 88% (7/8) Figure 8 Metstsis-ssocited molecules re present in the metstses of humn lung cncers. ( d) Oncomine 3 results for humn lung cncer expression of LGALS3 nd LGALS8. () LGALS3 Expression in Hou Lung: lrge cell lung crcinom dvnced stge. () LGALS3 expression in Bild Lung: lung denocrcinom dvnced stge. (c) LGALS8 Expression in Hou Lung: lrge cell lung crcinom dvnced stge. (d) LGALS8 copy numer in TCGA lung : lung denocrcinom dvnced M Stge. LGALS3 nd LGALS8 re overexpressed in Stge II lung cncer compred with stge I (P =.18 nd 9.7E-, respectively)(,c). Microrry dt source GSE19188 (ref. 6). () LGALS3 is overexpressed in Stge IV lung cncer compred with other stges (P =.). Microrry dt source GSE311 (ref. 7). (d) LGALS8 hs incresed copy numer in dvnced M stge lung cncer (P =.13) in the Lung Crcinom DNA Copy Numer Dt dt set ville from The Cncer Genome Atls wesite ( (e) Representtive imges of humn tissue microrry stining results for glectin-3 presence or sence in the primry sites nd lymph nodes. Scle rs re 5 µm. Box nd whisker plots in ( d): dots represent mximum nd minimum vlues, whiskers show 9th nd 1th percentiles, oxes show 75th nd 5th percentiles, nd line shows medin. P-vlues in ( d) were computed y Oncomine softwre using Student s t-test (,c,d) or Person s correltion nlysis (). Extrcellulr mtrix microrrys preprtion. Vntge crylic slides (CEL Assocites VACR-5C) were coted with polycrylmide y depositing prepolymer contining Irgcure 959 photoinititor (Ci) etween the slide nd glss coverslip. Following polymeriztion, slides were soked in ddh O nd the coverslips were removed. Slides were llowed to dry efore molecule deposition. Slides were spotted using DNA Microrry spotter (Crtesin Technologies Pixsys Microrry Spotter nd ArryIt 96 Pins). 768 comintions were spotted in replictes of five. Rhodmine dextrn (Invitrogen) ws spotted s negtive controls nd for use in imge lignment. The following molecules were used: Collgen I (Millipore), Collgen II (Millipore), Collgen III (Millipore), Collgen IV (Millipore), Collgen V (BD Biosciences), Collgen VI (BD Biosciences), Fironectin (Millipore), Lminin (Millipore), Merosin (Millipore), Tenscin-R (R&D Systems), Chondroitin Sulphte (Millipore), Aggrecn (Sigm), Elstin (Sigm), Kertin (Sigm), Mucin (Sigm), Superfironectin (Sigm), F-Spondin (R&D Systems), Nidogen- (R&D Systems), Heprn Sulphte (Sigm), Biglycn (R&D Systems), Decorin (R&D Systems), Glectin 1 (R&D Systems), Glectin 3 (R&D Systems), Glectin 3c (EMD Biosciences), Glectin (R&D Systems), Glectin 8 (R&D Systems), Thromospondin- (R&D Systems), Osteopontin (R&D Systems), Osteonectin (R&D Systems), Testicn 1 (R&D Systems), Testicn (R&D Systems), Firin (Sigm), Tenscin-C (R&D Systems), Nidogen-1 (R&D Systems), Vitronectin (R&D Systems), Rt Agrin (R&D Systems), Hyluronn (R&D Systems), Brevicn (R&D Systems). The lminin used is Millipore ctlogue no. AG56P, nd is mixture of humn lminins tht contin the et1 chin. Source pltes used in the spotter were prepred using Tecn liquid hndler. Molecules were prepred t concentrtion of µg ml 1 using uffer descried previously. Slides were stored in humidity chmer t C efore use. Extrcellulr mtrix microrry seeding nd nlysis. Slides were wshed in PBS nd treted with UV efore seeding cells. They were plced in seeding device tht holds the top surfce of the slides flush with ottom of the well. In ll,, cells were seeded on ech slide in 6 ml of serum-free medium (DMEM nd penicillin/streptomycin). Cells were llowed to ttch for two hours t 37 C. After ttchment, slides were wshed three times, trnsferred to qudriperm pltes (NUNC, 16763), nd new medium ws dded (DMEM, 1% foetl ovine serum, penicillin/streptomycin nd glutmine). Slides were left t 37 C for two dditionl hours efore removl for stining. Slides were wshed twice with PBS nd fixed with % prformldehyde. Nuclei were stined using Hoechst (Invitrogen) in comintion with.1% Triton-X nd PBS. Slides were mounted with Fluoromount-G (Southern Biotech 1-1) nd stored t C efore imging. Slides were imged using Nikon Ti-E inverted fluorescence microscope nd NIS Elements Softwre (Nikon). The entire slide ws scnned nd imges stitched using tht softwre. Imge mnipultion nd nlysis ws performed in MATLAB (Mthworks) nd quntifiction of nuclei ws performed using CellProfiler 3. Clustering nlysis ws performed using Spotfire (Tico). Replicte spots on ech slide were verged nd those whose vlues were >1 s.d. ove or elow the men of the replictes were excluded. Slides were normlized to the men of their non-zero dhesion vlues. Clustering ws performed sed on Eucliden distnces using Spotfire with the Hierrchicl Clustering lgorithm (normlized dhesion >.1). In vitro dhesion seeding. In vitro ECM dhesion tests were performed using 96-well-pltes (Corning 363). Pltes were coted with µg ml 1 of fironectin lone or µg ml 1 of fironectin nd µl ml 1 of the second molecule in PBS overnight t C. Pltes were then locked with 1wt% BSA t room temperture for 1 h. Pltes were llowed to dry efore dding 1 cells per well in wrm serum-free DMEM. Cells were llowed to dhere for 1 h t 37 C nd shken every 15 min to ensure uniform seeding. Cells were wshed, fixed with % prformldehyde nd stined with Hoechst (Invitrogen). Wells were imged using Nikon Ti-E inverted epifluorescent microscope nd nlysed with Nikon elements softwre. Protein nlysis. Western lot nlysis of ECM molecules ws performed with the following ntiodies: glectin-3 (Acm, 538, 1:5), glectin-8 (Acm, 69631, 1:5), osteopontin (Acm, 88, 1:,), fironectin (Acm, 13, 1:1,), lminin (Acm, 11575, 1:1,), collgen I (Acm, 371, 1:5,) nd α-tuulin (Cell Signling, 15, 1:1,). Immunohistochemistry of ECM molecules ws performed with the following ntiodies: glectin-3, glectin- 8 (1:75), osteopontin, lminin (Acm, 11575, 1:1), fironectin (Millipore, AB33, 1:8), Hmg (Biocheck, 5917AP, 1:1,), collgen I (Acm, 371, 1:5) nd collgen VI (Acm 6588, 1:1). Integrin stining ws performed 1 nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved.

11 nture communictions DOI: 1.138/ncomms18 ARTICLE using the following ntiodies: integrin αv (Millipore AB193, 1:), integrin α5 (Chemicon AB198, 1:), integrin α3 ntiody ws gift from J.M.L. Tissue microrrys were cquired from LifeSpn Biosciences (LS-SLUCA5), nd were stined with the sme glectin-3 ntiody. Murine tissues were hrvested from Krs LSL G1D, p53 flox/flox mice 7 9. IHC ws performed following resection from mice, fixtion in formlin nd emedding in prffin. Flow cytometry nlysis of integrin expression ws performed using the following ntiodies: integrin α5 (Acm nd BioLegend-clone 5H1-7, 1:1), integrin αv (BD-clone RMV-7, 1:1), integrin α6 (BD nd BioLegend-clone GoH3, 1:1), integrin α3 (R&D, 1:1), integrin α1 (BD-clone H31/8 nd BioLegend-clone HMα1, 1:1) nd integrin α (BD-clone HMα, 1:1). RNA isoltion nd expression profiling. Cell lystes were hrvested using Trizol (Sigm). Chloroform extrction ws performed followed y RNA purifiction using Qigen RNesy spin columns. Lystes were nlysed for RNA integrity nd prepred with Affymetrix GeneChip WT Sense Trget Lelling nd Control Regents kit, followed y hyridiztion to Affymetrix Mouse 3 Arrys (Mouse 3A.) Lystes used for gene expression microrrys were hrvested t the sme time s the ECM microrrys were seeded to ensure miniml vriility introduced y cell culture. R/Bioconductor softwre ws used to process rry imges. Unsupervised hierrchicl clustering nlysis ws performed in Spotfire (Tico) for ll proe sets with vrince>.5 nd expression>3. using Eucliden distnces. Dt sets re puliclly ville from NCBI under ccession numer GSE. Retrovirl short hirpin RNA (shrna) constructs. mir3-sed shrnas trgeting integrins β1 (5 -TGCTGTTGACAGTGAGCGCGGCTCTC AAACTATAAAGAAATAGTGAAGCCACAGATGTATTTCTTTATAGTT TGAGAGCCTTGCCTACTGCCTCGGA-3 ), α3 (5 -TGCTGTTGACAGTGA GCGCCGGATGGACATTTCAGAG AAATAGTGAAGCCACAGATGTATT TCTCTGAAATGTCCATCCGTTGCCTACTGCCTCGGA-3 ), or control firefly luciferse (5 -AAGGTATATTGCTGTTGACAGTGAGCGAGCTCCC GTGA ATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAG CCTGCCTACTGCCTCG-3 ) were designed using the shrna retriever softwre ( edu/homepge/sirna/rnai.cgi?type=shrna), synthesized (IDT, Corlville, Iow), nd then cloned into the MSCV-ZSG-A-Puro-miR3 vector 8. Pckging of retrovirus nd trnsduction of cells ws done s descried previously 9. References 1. Gupt, G. P. & Mssgué, J. Cncer Metstsis: uilding frmework. Cell 17, (6).. Mehlen, P. & Puisieux, A. Metstsis: question of life or deth. Nt. Rev. Cncer 6, 9 58 (6). 3. Hoffmn, P. C., Muer, A. M. & Vokes, E. E. Lung cncer. The Lncet 355, ().. Steeg, P. S. & Theodorescu, D. Metstsis: therpeutic trget for cncer. Nt. Clin. Prc. Oncol. 5, 6 19 (8). 5. Joyce, J. A. & Pollrd, J. W. Microenvironmentl regultion of metstsis. Nt. Rev. Cncer 9, 39 5 (9). 6. N, A. et l. The mtrisome: in silico definition nd in vivo chrcteriztion y proteomics of norml nd tumor extrcellulr mtrices. Mol. Cell. Proteomics 11, M (1). 7. Leventl, K. R. et l. Mtrix crosslinking forces tumor progression y enhncing integrin signling 139, (9). 8. Oskrsson, T. et l. Brest cncer cells produce tenscin C s metsttic niche component to colonize the lungs. Nt. Med. 17, (11). 9. Desgrosellier, J. S. & Cheresh, D. A. Integrins in cncer: iologicl implictions nd therpeutic opportunities. Nt. Rev. Cncer 1, 9 (1). 1. Wever, V. M. et l. Reversion of the mlignnt phenotype of humn rest cells in three-dimensionl culture nd in vivo y integrin locking ntiodies. J. Cell Biol. 137, 31 5 (1997). 11. Dolerg, D. S. & Bissell, M. J. Inility of Rous srcom virus to cuse srcoms in the vin emryo. Nture 39, (198). 1. Hendrix, M. J. C. et l. Reprogrmming metsttic tumour cells with emryonic microenvironments. Nt. Rev. Cncer 7, 6 55 (7). 13. Olumi, A. F. et l. Crcinom-ssocited firolsts direct tumor progression of initited humn prosttic epithelium. Cncer Res. 59, (1999). 1. Alini, A. et l. A rpid in vitro ssy for quntitting the invsive potentil of tumor cells. Cncer Res. 7, (1987). 15. Hotry, K. B. et l. Memrne type I mtrix metlloproteinse usurps tumor growth control imposed y the three-dimensionl extrcellulr mtrix. Cell 11, 33 5 (3). 16. Mlik, G. et l. Plsm fironectin promotes lung metstsis y contriutions to firin clots nd tumor cell invsion. Cncer Res. 7, (1). 17. White, D. E. et l. Trgeted disruption of β1-integrin in trnsgenic mouse model of humn rest cncer revels n essentil role in mmmry tumor induction. Cncer Cell 6, (). 18. Hynes, R. O. The Extrcellulr Mtrix: not just pretty firils. Science 36, (9). 19. Reuter, J. A. et l. Modeling inducile humn tissue neoplsi identifies n extrcellulr mtrix interction network involved in cncer progression. Cncer Cell 15, (9).. Avrmides, C. J., Grmy-Susini, B. & Vrner, J. A. Integrins in ngiogenesis nd lymphngiogenesis. Nt. Rev. Cncer 8, (8). 1. Hynes, R. O. Integrins: idirectionl, llosteric signling mchines. Cell 11, ().. Flim, C. J., Chien, S. & Bhti, S. N. An extrcellulr mtrix microrry for proing cellulr differentition. Nt. Meth., (5). 3. Flim, C. J., Teng, D., Chien, S. & Bhti, S. N. Comintoril signling microenvironments for studying stem cell fte. Stem Cells Dev. 17, 9 (8).. LBrge, M. A. et l. Humn mmmry progenitor cell fte decisions re products of interctions with comintoril microenvironments. Integr. Biol. 1, 7 79 (9). 5. Mei, Y. et l. Cell-comptile, multicomponent protein rrys with sucellulr feture resolution. Smll, (8). 6. Brfmn, D. A. et l. Investigting the role of the extrcellulr environment in modulting heptic stellte cell iology with rryed comintoril microenvironments. Integr. Biol. 1, (9). 7. Jckson, E. L. et l. Anlysis of lung tumor initition nd progression using conditionl expression of oncogenic K-rs. Genes Dev. 15, (1). 8. DuPge, M., Dooley, A. L. & Jcks, T. Conditionl mouse lung cncer models using denovirl or lentivirl delivery of Cre recominse. Nt. Protocols, (9). 9. Winslow, M. M. et l. Suppression of lung denocrcinom progression y Nkx-1. Nture 73, 11 1 (11). 3. Crpenter, A. E. et l CellProfiler: imge nlysis softwre for identifying nd quntifying cell phenotypes. Genome Biol. 7, R1 (6). 31. Jckson, E. L. et l. The differentil effects of mutnt p53 lleles on dvnced murine lung cncer. Cncer Res. 65, (5). 3. Rhodes, D. R. et l. ONCOMINE: cncer microrry dtse nd integrted dt-mining pltform. Neoplsi 6, 1 6 (). 33. Liu, F.- T. & Rinovich, G. A. Glectins s modultors of tumour progression. Nt. Rev. Cncer 5, 9 1 (5). 3. Tkenk, Y., Fukumori, T. & Rz, A. Glectin-3 nd metstsis. Glycoconjugte J. 19, (). 35. Breslier*, R. S. et l. Metstsis of humn colon cncer is ltered y modifying expression of the β-glctoside-inding protein glectin 3. Gstroenterology 115, (1998). 36. Yu, L.- G. The oncofetl Thomsen Friedenreich crohydrte ntigen in cncer progression. Glycoconjugte J., 11 (7). 37. Ngy, N. et l. Glectin-8 expression decreses in cncer compred with norml nd dysplstic humn colon tissue nd cts significntly on humn colon cncer cell migrtion s suppressor. Gut 5, 39 1 (). 38. Zick, Y. et l. Role of glectin-8 s modultor of cell dhesion nd cell growth. Glycoconjugte J. 19, (). 39. Singhl, H. et l. Elevted plsm osteopontin in metsttic rest cncer ssocited with incresed tumor urden nd decresed survivl. Clin. Cncer Res. 3, (1997).. McAllister, S. S. et l. Systemic endocrine instigtion of indolent tumor growth requires osteopontin. Cell 133, (8). 1. vn t Veer, L. J. et l. Gene expression profiling predicts clinicl outcome of rest cncer. Nture 15, ().. Beer, D. G. et l. Gene-expression profiles predict survivl of ptients with lung denocrcinom. Nt. Med. 8, (). 3. Perou, C. M. et l. Moleculr portrits of humn rest tumours. Nture 6, ().. Pik, S. et l. A multigene ssy to predict recurrence of tmoxifen-treted, node-negtive rest cncer. N. Engl. J. Med. 351, (). 5. vn de Vijver, M. J. et l. A gene-expression signture s predictor of survivl in rest cncer. N. Engl. J. Med. 37, (). 6. Hou, J. et l. Gene expression-sed clssifiction of non-smll cell lung crcinoms nd survivl prediction. PLoS ONE 5, e131 (1). 7. Bild, A. H. et l. Oncogenic pthwy signtures in humn cncers s guide to trgeted therpies. Nture 39, (6). 8. Lmr, J. M. et l. The Hippo pthwy trget, YAP, promotes metstsis through its TEAD-interction domin. Proc. Ntl Acd. Sci. USA 19, E1 E5 (1). 9. Stern, P. et l. A system for Cre-regulted RNA interference in vivo. Proc. Ntl Acd. Sci. 15, (8). Acknowledgements The uthors thnk H. Fleming, S. Ktz, L. Inghrro nd ll other memers of the S.B. l for their insightful discussions nd generl reserch ssistnce. They lso thnk the Swnson Biotechnology Center Core Fcilities nd the Dvid H. Koch Institute nd, nture communictions 3:11 DOI: 1.138/ncomms Mcmilln Pulishers Limited. All rights reserved. 11