DMEM/F12 (Invitrogen) supplemented with 10% FBS (Hyclone Laboratory), except

Size: px
Start display at page:

Download "DMEM/F12 (Invitrogen) supplemented with 10% FBS (Hyclone Laboratory), except"

Transcription

1 Materials and Methods Cell Culture Rat aortic SMCs were isolated as previously described 1 and then cultured in DMEM/F12 (Invitrogen) supplemented with 10% FBS (Hyclone Laboratory), except where otherwise indicated. Cells were used between passages 3 and 12. For palmitate treatment, confluent SMCs were cultured for 48 h in a defined serum-free DMEM/F12 supplemented with 0.68 mmol/l L-glutamine, 5x10-7 mol/l insulin, 2x10-4 mol/l L-ascorbic acid, and 5 g/ml transferrin, 8x10-5 mol/l selenium, and 100 units/ml penicillin (Life Technologies) and 100 µg/ml streptomycin (Life Technologies) 2, 3. The cells were then treated for 24 h with either 200 mol/l palmitate or vehicle (fatty acid-free bovine serum albumin [BSA]) (Sigma). Sodium palmitate (Sigma) was dissolved in warm 50% ethanol to make a 100 mmol/l palmitate stock solution 4. To make 5 mmol/l palmitate/10% fatty acid-free BSA solution, the palmitate stock solution and 10% fatty acid-free BSA in water were incubated for 10 min at 55ºC, mixed and incubated for an additional 10 min at 55ºC to obtain a homogeneous mixture.. To analyze the effects of inhibitors, SMCs were pretreated with 10 mmol/l N-acetyl-L-cysteine (NAC) (Sigma), 100 mo/l apocynin (Sigma), or 5 mol/l BMS (Sigma) for 1 h prior to the addition of palmitate. Quantitative Real-Time PCR Total RNA was extracted from cultured cells using RNeasy (Qiagen) and from arteries using an RNeasy fibrous kit (Qiagen). Real-time PCR was carried out using LightCycler

2 (Roche) and QuantiTect SYBR green PCR kits (Qiagen). The sequences of the PCR primers used are shown in Supplemental Table 1. Western Blotting Cytoplasmic and nuclear extracts were obtained using NE-PER nuclear and cytoplasmic extraction reagent (Thermo Scientific) with protease inhibitor and phosphatase inhibitors according to the supplier s protocol. Whole cell lysates were prepared in RIPA buffer containing 150 mmol/l NaCl, 50 mmol/l Tris-HCl (ph 7.5), 1% NP-40, 0.1% SDS, 0.5% Na-deoxycholate, 1 mmol/l DTT and Complete EDTA-free protease inhibitors (Roche). Antibodies against phospho-ikk and I B-α were purchased from Cell Signaling. Antibodies against NF- B p65, NOX1 and β-tubulin were from Santa Cruz. Animals Eight-week-old male C57BL/6 mice (body weight 20 to 25 g) were purchased from Japan Clea, and Myd88 -/- mice of the C57BL/6 background were from Oriental Bio. All mice were fed a normal rodent chow diet. Ligation of the right common carotid artery was performed as previously described 5. After ligation, the mice were intraperitoneally administered either 0.6 mg/g emulsified ethyl palmitate or vehicle daily for 3 weeks. Ethyl palmitate (Tokyo Chemical Industry) was dissolved with 1.6% lecithin (Wako) and 3.3% glycerol in water to produce a mixture containing 600 mmol/l ethyl palmitate, 1.2% lecithin and 2.5% glycerol 6. The mixture was then emulsified using sonicator. The lecithin-glycerol-water solution was used as the vehicle. To measure serum palmitate, a

3 single dose of either ethyl palmitate emulsion or vehicle was intraperitoneally administered to mice that had been fasted for 16 h, and serum was collected 6 h later. To measure FFA levels, mice fed a normal chow diet were intraperitoneally administered either ethyl palmitate or vehicle daily. For BM transplantation, BM cells were obtained from 8-week-old C57BL/6 (Ly5.1) mice and transplanted into lethally irradiated wild-type C57BL/6 and Myd88 -/- mice (Ly5.2). Flow cytometric analysis using Ly-5.1 antibody indicated that >85% of peripheral blood leukocytes were reconstituted in the BM-transplant recipient mice. Six weeks after the transplantation, the mice were subjected to the carotid artery ligation. FFA, Triglyceride and Cholesterol Measurements FFA, triglyceride and cholesterol levels were respectively measured using a NEFA C kit, L-type WAKO TG kit and Cholesterol E test WAKO (Wako), following the instructed protocols. Serum Palmitate Measurement Serum lipids were extracted and separated by thin-layer chromatography (TLC) using hexane/diethyl ether/acetic acid (80:20:1, v/v). Free fatty acid spots were visualized by iodine vapors, scraped and methylated with 1% H 2 SO 4 in methanol. Methyl palmitate was then quantified by GS-MS analysis.

4 Immunohistochemical Analysis Carotid arteries were fixed with 40% Ufix (Sakura Finetek) overnight and then immunohistologically stained using anti-sm α-actin (Sigma), anti-sm1 (KM3660, Kyowa Medex) and anti-mac3 (BD Biosciences) as primary antibodies. ROS Measurement To measure ROS, SMCs were treated with BSA or palmitate for 24 h, after which the cells were rinsed twice with PBS and incubated with 10 μmol/l CM-H 2 DCFDA (Invitrogen) for 30 min at 37ºC. ROS fluorescence was then detected using a flow cytometer (BD FACSCalibur). Lucigenin-enhanced chemiluminescence was also used to measure the level of superoxide in cells. After stimulation for 24 h with BSA or palmitate, SMCs were incubated with DETCA (3 mmol/l) in Krebs-HEPES buffer for 1 h to inactivate endogenous SOD activity. The medium was then exchanged with a fresh KRB buffer, and chemiluminescence was detected using lucigenin (5 mol/l) and NADPH (100 mol/l). The buffer blank background was subtracted from each reading, and the area under the curve during the 3 min immediately after the addition of lucigenin was calculated. Bromodeoxyuridine (BrdU) Incorporation SMC proliferation was examined using a BrdU cell proliferation assay kit (Roche) according to the manufacturer s protocol. SMCs were incubated for 4 h in medium containing BSA or 200 mol/l palmitate plus BrdU, after which the absorbance of the samples at 405 nm was measured.

5 sirna sirna was synthesized using a silencer sirna construction kit (Ambion) according to the manufacture s instructions. The template sequences were as follows: Nox1, CAGAGGCAAGAGATCCATC; Myd88, ACCACCATGCGACGACACC; and Tlr4, TCTCAATTGCTTGGCAAAT. A sirna against secreted alkaline phosphatase (SEAP) served as a control 7. For transfection, rat aortic SMCs were plated in 3.5-cm culture dishes. Once the cells reached 50% confluency, 40 pmol of sirna were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacture s protocol. The cells were incubated in growth medium without antibiotics (Invitrogen) containing the sirna-lipofectamine 2000 complex for 4 h, after which the medium was replaced with growth medium, and the incubation was continued until the cells reached confluence (20 h). The medium was then replaced with the serum-free defined medium 3, 8 and the incubation was continued for 24 h prior to palmitate treatment. Plasmids and Luciferase Assay The rat Nox1 promoter region was obtained by PCR. Promoter fragments were then subcloned into pgl3 basic luciferase vector. In addition, an NF- B binding site mutant construct, in which the potential B element at -264 bp (5 - TGATATTTCC-3 ) was mutated to 5 -TGACCATATG-3 was generated by PCR. In both cases, luciferase activity was normalized to the protein concentration of each cell lysate 9. For transfection, SMCs were plated to a density of 2.0x10 4 cells/cm 2 in 12-well plates, and the next day luciferase reporter constructs were transfected using Polyfect (Qiagen) according to the manufacture s instructions. After an additional 24 h, the cells were

6 cultured in growth medium supplemented with 10% FBS until they reached confluence. The medium was then replaced with serum-free defined medium for 24 h, followed by an additional 24 h with palmitate, after which they were subjected to luciferase assays. Chromatin Immunoprecipitation (ChIP) ChIP assays was performed as previously described 9. Briefly, 2x10 6 cells were grown at confluence for 24 h and then cultured in serum-free defined medium for an additional 24 h, after which either palmitate (200 mol/l) or vehicle was added to the medium for 8 h. The cells were then cross-linked by adding formaldehyde to a final concentration of 1%, and chromatin samples were prepared. Anti-NF- B p65 antibody was used for immunoprecipitation (Santa Cruz sc-372x). The primers used to detect the Nox1 promoter were 5 TGGAGTGCGTTGAGCCCAGCTG- 3 and 5 -CAAAGTCGGCTTAGAACTGGATC-3. Statistical Analysis Student t test was used for comparisons between two groups. Differences among more than two groups were analyzed using one-way ANOVA followed by a post hoc Tukey-Kramer test for multiple groups. Values of P<0.05 were considered significant. References 1. Shimizu RT, Blank RS, Jervis R, Lawrenz-Smith SC, Owens GK. The smooth muscle alpha-actin gene promoter is differentially regulated in smooth muscle versus non-smooth muscle cells. J Biol Chem. 1995;270:

7 2. Kihm AJ, Hershey JC, Haystead TA, Madsen CS, Owens GK. Phosphorylation of the rrna transcription factor upstream binding factor promotes its association with TATA binding protein. Proc Natl Acad Sci U S A. 1998;95: Everett AD, Lobe DR, Matsumura ME, Nakamura H, McNamara CA. Hepatoma-derived growth factor stimulates smooth muscle cell growth and is expressed in vascular development. The Journal of clinical investigation. 2000;105: Rho M-C, Ah Lee K, Mi Kim S, Sik Lee C, Jeong Jang M, Kook Kim Y, Sun Lee H, Hyun Choi Y, Yong Rhim B, Kim K. Sensitization of vascular smooth muscle cell to TNF-α-mediated death in the presence of palmitate. Toxicol Appl Pharmacol. 2007;220: Choi ET, Khan MF, Leidenfrost JE, Collins ET, Boc KP, Villa BR, Novack DV, Parks WC, Abendschein DR. Beta3-integrin mediates smooth muscle cell accumulation in neointima after carotid ligation in mice. Circulation. 2004;109: Eguchi K, Manabe I, Oishi-Tanaka Y, Ohsugi M, Kono N, Ogata F, Yagi N, Ohto U, Kimoto M, Miyake K, Tobe K, Arai H, Kadowaki T, Nagai R. Saturated Fatty Acid and TLR Signaling Link b Cell Dysfunction and Islet Inflammation. Cell Metab. 2012;15: Yagi N, Manabe I, Tottori T, Ishihara A, Ogata F, Kim JH, Nishimura S, Fujiu K, Oishi Y, Itaka K, Kato Y, Yamauchi M, Nagai R. A nanoparticle system specifically designed to deliver short interfering RNA inhibits tumor growth in vivo. Cancer Res. 2009;69:

8 8. Fujiu K, Manabe I, Ishihara A, Oishi Y, Iwata H, Nishimura G, Shindo T, Maemura K, Kagechika H, Shudo K, Nagai R. Synthetic retinoid Am80 suppresses smooth muscle phenotypic modulation and in-stent neointima formation by inhibiting KLF5. Circ Res. 2005;97: Manabe I, Owens GK. CArG elements control smooth muscle subtype specific expression of smooth muscle myosin in vivo. J Clin Invest. 2001;107:

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript. Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

SUPPORTING MATREALS. Methods and Materials

SUPPORTING MATREALS. Methods and Materials SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation

More information

Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab)

Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Updated 12/3/02 Reagents: ChIP sonication Buffer (1% Triton X-100, 0.1% Deoxycholate, 50 mm Tris 8.1, 150 mm NaCl, 5 mm EDTA): 10 ml 10 % Triton

More information

Kit for assay of thioredoxin

Kit for assay of thioredoxin FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

SUPPLEMENT. Materials and methods

SUPPLEMENT. Materials and methods SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments

More information

Free Fatty Acid Assay Kit (Fluorometric)

Free Fatty Acid Assay Kit (Fluorometric) Product Manual Free Fatty Acid Assay Kit (Fluorometric) Catalog Number STA-619 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type of lipid

More information

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory

More information

Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit

Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol

More information

Supporting Information

Supporting Information Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School

More information

supplementary information

supplementary information Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis

More information

Western Immunoblotting Preparation of Samples:

Western Immunoblotting Preparation of Samples: Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,

More information

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

More information

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

Antibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0.

Antibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0. Experiment: Date: Tissue: Purpose: ChIP-Seq Antibodies: 11x cross-link buffer: Regent Stock Solution Final Vol for 10 ml of 11xstock concentration 5 M NaCl 0.1M 0.2 ml 0.5 M EDTA 1 mm 20 ul 0.5 M EGTA,

More information

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced

More information

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

Supplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1.

Supplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1. Supplemental figures and figure legends (957-INS-RG-RV-) Supplemental Figure. A B.5.5 Interaction p=.89 Model p

More information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA

More information

The rabbit femoral artery was prepared and each arterial ring was permeabilized

The rabbit femoral artery was prepared and each arterial ring was permeabilized Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

B. 50 mm Calcium Chloride Solution (CaCl 2 ) (Prepare 25 ml in Reagent A using Calcium Chloride, Dihydrate, Sigma Prod. No. C-3881.

B. 50 mm Calcium Chloride Solution (CaCl 2 ) (Prepare 25 ml in Reagent A using Calcium Chloride, Dihydrate, Sigma Prod. No. C-3881. SIGMA QUALITY CONTROL TEST PROCEDURE ProductInformation Enzymatic Assay of PHOSPHOLIPASE C PRINCIPLE: L-α-Lecithin + H 2 O Phospholipase C > 1,2-Diglyceride + Choline Phosphate Choline phosphate + H 2

More information

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich

More information

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.

More information

Total Phosphatidic Acid Assay Kit

Total Phosphatidic Acid Assay Kit Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Phospholipid Assay Kit

Phospholipid Assay Kit Product Manual Phospholipid Assay Kit Catalog Number MET-5085 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phospholipids are important structural lipids that are the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Choline Assay Kit (Fluorometric)

Choline Assay Kit (Fluorometric) Product Manual Choline Assay Kit (Fluorometric) Catalog Number MET- 5042 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Choline is a water soluble amine that is an essential

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

2-Deoxyglucose Assay Kit (Colorimetric)

2-Deoxyglucose Assay Kit (Colorimetric) 2-Deoxyglucose Assay Kit (Colorimetric) Catalog Number KA3753 100 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509 Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Caution: For Laboratory Use. A product for research purposes only. Eu-W1284 Iodoacetamido Chelate & Europium Standard. Product Number: AD0014

Caution: For Laboratory Use. A product for research purposes only. Eu-W1284 Iodoacetamido Chelate & Europium Standard. Product Number: AD0014 TECHNICAL DATA SHEET Lance Caution: For Laboratory Use. A product for research purposes only. Eu-W1284 Iodoacetamido Chelate & Europium Standard Product Number: AD0014 INTRODUCTION: Iodoacetamido-activated

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Glucose Uptake Colorimetric Assay Kit

Glucose Uptake Colorimetric Assay Kit ab136955 Glucose Uptake Colorimetric Assay Kit Instructions for Use For the sensitive and accurate measurement of Glucose uptake in various samples This product is for research use only and is not intended

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

Mammalian Cell PE LB

Mammalian Cell PE LB 257PR G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Mammalian Cell PE LB Mammalian Cell Protein Extraction & Lysis Buffer (Cat. # 786 180)

More information

Supporting Information

Supporting Information Supporting Information Gack et al. 1.173/pnas.8494715 SI Text Cell Culture, Transfection, and Reagents. HEK293T, MEF, Vero, EcoPack2-293 (D iosciences), HeLa, HCT116, Huh7, NHLF, 2fTGH wild-type, U3A,

More information

Supplementary Data. Supplementary Methods:

Supplementary Data. Supplementary Methods: Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Data sheet. TBARS Assay kit. (Colorimetric/Fluorometric) Kit Contents. MDA-TBA Adduct. 2-Thiobarbituric Acid. Cat. No: CA995.

Data sheet. TBARS Assay kit. (Colorimetric/Fluorometric) Kit Contents. MDA-TBA Adduct. 2-Thiobarbituric Acid. Cat. No: CA995. Data sheet Cat. No: CA995 TBARS Assay kit (Colorimetric/Fluorometric) Introduction Oxidative stress in the cellular environment results in the formation of highly reactive and unstable lipid hydroperoxides.

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information