Molecular Regulation of Cytochrome P4501A1 Induction by Hyperoxia in Human Pulmonary Cells
|
|
|
- Edith Hopkins
- 5 years ago
- Views:
Transcription
1 Molecular Regulation of Cytochrome P4501A1 Induction by Hyperoxia in Human Pulmonary Cells Sudeepta K. Basu, MD Neonatology Fellow, Baylor College of Medicine Attending, Children s National Health System October 24 th 2015 AAP, Washington, DC
2 I have no relevant financial relationships with the manufacturer(s) of any commercial product(s) and/or provider(s) of commercial services discussed in this CME activity. I do not intend to discuss an unapproved/investigative use of a commercial product/device in my presentation. xxx00.#####.ppt 3/16/ :30:52 AM
3 Bronchopulmonary Dysplasia Oxygen therapy Mechanical ventilation Reactive oxygen species Hyperoxic lung injury Infection Chorioamnionitis Barotrauma Volutrauma Injury & Inflammation CYP1A1 Impaired alveogenesis Deranged repair and fibrosis Bronchopulmonary dysplasia (BPD) xxx00.#####.ppt 3/16/ :30:52 AM
4 CYP1A1 reduces hyperoxic injury Methylchloanthrene (MC) CYP1A1 95% Oxygen Hyperoxic injury Arylhydrocarbon Receptor pathway (AHR) CYP1A1 ANF, AHR ko CYP1A1 xxx00.#####.ppt 3/16/ :30:53 AM Mansour 1988, Moorthy 2000
5 CYP1A1 regulation: Arylhydrocarbon Receptor(AHR) pathway xxx00.#####.ppt 3/16/ :30:53 AM
![FICZ: (6-formylindolo[3,2-b]carbazole) Tryptophan derivative - UVR Suggested physiologic AhR ligand High affinity K d 0.](/docs-images/83/88756728/images/6-1.jpg "07nM Feedback loop AHR Induction of AhR responsive gene products 5 +1 at 3 end of exon 3 AhR responsive element (AhRE) sequence (5'-T/GCGTG-3') xxx00.")
6 FICZ: (6-formylindolo[3,2-b]carbazole) Tryptophan derivative - UVR Suggested physiologic AhR ligand High affinity K d 0.07nM Feedback loop AHR Induction of AhR responsive gene products 5 +1 at 3 end of exon 3 AhR responsive element (AhRE) sequence (5'-T/GCGTG-3') xxx00.#####.ppt 3/16/ :30:53 AM
7 Hypothesis: Hyperoxia Responsive Element (HRE) in CYP1A1 promoter AHR Induction of CYP1A1 gene +1 at 3 end of exon AhRE consensus sequence (5'-T/GCGTG-3') Mutated sequence (5 - A/CGGTG-3 ) xxx00.#####.ppt 3/16/ :30:54 AM
8 pgl4 luciferase reporter plasmid Mutated CYP1A1 promoter (WT, 974, ) Firefly luciferase gene pgl4 vector sequence Firefly luciferase Hyperoxia, MC, FICZ pgl4 Renilla luciferase - null promoter - used as control xxx00.#####.ppt 3/16/ :30:54 AM
9 H441 cell transfection & Dual luciferase assay H441 lung adenocarcinoma cell ( 96 well microplate x 3 wells) MC,FICZ Hyperoxia, Firefly/Renilla luciferase ratio pgl4 Firefly luciferase (CYP1A1 WT, 974, 1047, 45.) pgl4 Renilla luciferase (null internal control) Dual luciferase assay CYP1A1 promoter activity xxx00.#####.ppt 3/16/ :30:54 AM
10 Mutated 974 blocks CYP1A1 induction by MC Luciferase activity Fold of increase 7.7 vs 2.8, p < 0.01 DMSO 0.1 µm MC xxx00.#####.ppt 3/16/ :30:55 AM
11 FICZ induces CYP1A1 promoter in pgl4-wt pgl- 974 mutation blocks induction by FICZ (13.1 vs 6.7, p<0.01) DMSO Luciferase Assay nm FICZ 10 nm FICZ 100 nm FICZ 0 pgl4min pgl4 1A1 pgl4 974 pgl xxx00.#####.ppt 3/16/ :30:55 AM
12 Mutated 974 blocks CYP1A1 induction by Hyperoxia Luciferase activity (0.33 vs 0.5, p 0.03) (0.19 vs 0.22, p 0.25) RA 24h O2 24h RA 48h O2 48h pgl4 WT pgl4 974 pgl H441 cells with wild type or mutated CYP1A1 promoter vector xxx00.#####.ppt 3/16/ :30:55 AM
13 Electrophoretic Mobility shift assay xxx00.#####.ppt 3/16/ :30:56 AM
14 Chromatin Immunoprecipitation assay 974 mutated CYP1A1 O2 MC Control RA O2 MC Wild Type CYP1A1 inverted colors xxx00.#####.ppt 3/16/ :30:56 AM
15 Conclusions Mutated (- 974) blocks CYP1A1 induction by MC(AhR pathway) and hyperoxia Hyperoxia induces CYP1A1 by AhR pathway FICZ induces CYP1A1 by AhR pathway AhRE(- 974) is a likely site for the proposed HRE segment in the CYP1A1 promoter xxx00.#####.ppt 3/16/ :30:56 AM
16 Acknowledgements: Dr Moorthy s Lab: Chun Chu Jiang Weiwu Xanthi I. Couroucli Bhagavatula Moorthy Evie Whitlock grant AAP Marshall Klaus award xxx00.#####.ppt 3/16/ :30:56 AM
17 Future directions and implications Novel pharmacological agents influencing 974 site need to be investigated for effect on hyperoxic cell/lung injury Investigating Nuclear factor 1 binding site for regulatory role in delayed CYP1A1 suppression xxx00.#####.ppt 3/16/ :30:57 AM
18 References: Wincent E, Amini N, Luecke S, et al. The suggested physiologic aryl hydrocarbon receptor activator and cytochrome P4501 substrate 6-formylindolo[3,2-b]carbazole is present in humans. J Biol Chem Jan 30;284(5): Couroucli XI, Welty SE, Geske RS, Moorthy B. Regulation of pulmonary and hepatic cytochrome P4501A expression in the rat by hyperoxia: implications for hyperoxic lung injury. Mol Pharmacol 2002;61: [PubMed: ] Jiang W, Welty SE, Couroucli XI, Barrios R, Kondraganti SR, Muthiah K, Yu L, Avery SE, Moorthy B. Disruption of the Ah receptor gene alters the susceptibility of mice to oxygenmediated regulation of pulmonary and hepatic cytochromes P4501A expression and exacerbates hyperoxic lung injury. J Pharmacol Exp Ther 2004;310: [PubMed: ] Mansour H, Brun-Pascaud M, Marquetty C, Gougerot-Pocidalo MA, Hakim J, Pocidalo JJ. Protection of rat from oxygen toxicity by inducers of cytochrome P-450 system. Am Rev Respir Dis 1988a; 137: [PubMed: ] xxx00.#####.ppt 3/16/ :30:57 AM
19 References: Mansour H, Levacher M, Azoulay-Dupuis E, Moreau J, Marquetty C, Gougerot-Pocidalo MA. Genetic differences in response to pulmonary cytochrome P-450 inducers and oxygen toxicity. J Appl Physiol 1988b;64: [PubMed: ] Moorthy B, Nguyen UT, Gupta S, Stewart KD, Welty SE, Smith CV. Induction and decline of hepatic cytochromes P4501A1 and 1A2 in rats exposed to hyperoxia are not paralleled by changes in glutathione S-transferase-alpha. Toxicol Lett 1997;90: [PubMed: ] Moorthy B, Parker KM, Smith CV, Bend JR, Welty SE. Potentiation of oxygen-induced lung injury in rats by the mechanism-based cytochrome P-450 inhibitor, 1- aminobenzotriazole. J Pharmacol Exp Ther 2000;292: [PubMed: ] Kushal Y. Bhakta, Weiwu Jiang, Xanthi I. Couroucli, Inayat S. Fazili, Kathirvel Muthiah, and Bhagavatula Moorthy. Regulation of Cytochrome P450-1A1 Expression by Hyperoxia in Human Lung Cell Lines: Implications for Hyperoxic Lung Injury. Toxicol Appl Pharmacol December 1; 233(2): doi: /j.taap xxx00.#####.ppt 3/16/ :30:57 AM
20 Chromatin Immunoprecipitation assay 974 mutated CYP1A1 O2 MC Control RA O2 MC Wild Type CYP1A1 xxx00.#####.ppt 3/16/ :30:58 AM
21 Transcription Regulation Elements in CYP1A1 Promoter Consensus sequence (5'-T/GCGTG-3') Mutated sequence (5 - A/CGGTG-3 ) xxx00.#####.ppt 3/16/ :30:58 AM
22 Schematic depiction of pgl4 constructs xxx00.#####.ppt 3/16/ :30:58 AM
23 Hyperoxia induces endogenous CYP1A1 f/b suppression on sustained hyperoxia BEAS H358 H441 O2/RA at 24 hr O2/RA at 36 hr O2/RA at 48 hr O2/RA at 60 hr O2/RA at 72 hr CYP1A1 EROD assay fold of increase O2/RA 0 72 hrs xxx00.#####.ppt 3/16/ :31:00 AM
24 Possible sites of AhR repression of inflammation mediated transcription xxx00.#####.ppt 3/16/ :31:00 AM
25 Hypothesis: Hyperoxia Responsive Element (HRE) in promoter region CYP1A1?? O2 Induction of CYP1A1 gene 5 AHR ARNT T T G C G T G A G A A +1 at 3 end of exon 3 AhRE core consensus sequence (5'-T/GCGTG-3 ) xxx00.#####.ppt 3/16/ :31:00 AM
26 xxx00.#####.ppt 3/16/ :31:01 AM
27 NF1 mutation maintains cyp1a1 response to hr hyperoxia Luciferase activity RA 24 O2 24 RA 36 O A1 old NF1 mut xxx00.#####.ppt 3/16/ :31:01 AM
28 NF1 mutation blocks late suppression of cyp1a1 on sustained hyperoxia xxx00.#####.ppt 3/16/ :31:01 AM
29 Conclusions B NF1 response element mutation suppresses constitutive CYP1A1 expression does not interfere AHR pathway does not alter CYP1A1 induction in early hyperoxia(24-36hrs) Blocks CYP1A1 suppression by late hyperoxia (48-60hrs) xxx00.#####.ppt 3/16/ :31:02 AM
Received September 9, 2003; accepted April 29, 2004
0022-3565/04/3102-512 519$20.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 310, No. 2 Copyright 2004 by The American Society for Pharmacology and Experimental Therapeutics 59766/1164128
Glutathione / Thioredoxin Nrf2 & Hyperoxia
Glutathione / Thioredoxin Nrf2 & Hyperoxia Trent E. Tipple, MD Principal Investigator, Center for Perinatal Research The Research Institute at Nationwide Children s Hospital Assistant Professor of Pediatrics,
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Regulation of P450. b. competitive-inhibitor but not substrate. c. non-competitive inhibition. 2. Covalent binding to heme or protein
10. Inhibition of P450 Regulation of P450 a. competitive-2 chemicals metabolized by same isoform b. competitive-inhibitor but not substrate c. non-competitive inhibition 11. Induction of P450 1. Non-covalent
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described
Supplemental Methods In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described previously 1 2 using 32P-labeled 211 bp fragment from 3 HS1. Footprinting reaction mixes contained
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
Bioluminescence Resonance Energy Transfer (BRET)-based studies of receptor dynamics in living cells with Berthold s Mithras
Bioluminescence Resonance Energy Transfer (BRET)-based studies of receptor dynamics in living cells with Berthold s Mithras Tarik Issad, Ralf Jockers and Stefano Marullo 1 Because they play a pivotal role
Sudin Bhattacharya Institute for Integrative Toxicology
Beyond the AHRE: the Role of Epigenomics in Gene Regulation by the AHR (or, Varied Applications of Computational Modeling in Toxicology and Ingredient Safety) Sudin Bhattacharya Institute for Integrative
Cytochrome P450 Suppression in Human Hepatocyte Cultures by Small and Large Molecules. George Zhang, Ph.D. April 18, 2012
Cytochrome P450 Suppression in Human Hepatocyte Cultures by Small and Large Molecules George Zhang, Ph.D. April 18, 2012 Presentation Overview Regulatory guidance Brief review on drug-drug (Disease) interactions
12th International Scientific Conference «Science and Society» London, November 2017 MEDICINE
MEDICINE Li T.A., Maltabarova N.A. SEVERE BRONCHOPULMONARY DYSPLASIA AND PEDIATRIC ACUTE RESPIRATORY DISTRESS SYNDROME. RESEMBLANCE AND CONTRAST Li Tatyana Anatolyevna, PhD doctoral student, Department
The liver in poisoning: what can we learn from animal models?
The liver in poisoning: what can we learn from animal models? Stephan Krähenbühl Clinical Pharmacology & Toxicology University Hospital 4031 Basel/Switzerland Kraehenbuehl@uhbs.ch Outcome and causes of
FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism
Supplementary Information The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism Address correspondence to Yong Li (yongli@xmu.edu.cn, Tel: 86-592-218151) GW464 CDCA Supplementary
/06/$15.00/0 Molecular Endocrinology 20(9): Copyright 2006 by The Endocrine Society doi: /me
0888-8809/06/$15.00/0 Molecular Endocrinology 20(9):2062 2079 Printed in U.S.A. Copyright 2006 by The Endocrine Society doi: 10.1210/me.2005-0316 Androgens, Progestins, and Glucocorticoids Induce Follicle-Stimulating
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice
Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice Vikramaditya Dumpa, MD Lori C Nielsen, MS Huamei Wang, MD Vasanth HS Kumar, MD Supported by AAP Marshall Klaus Perinatal Research Grant
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
The Future of In Vitro Systems for the Assessment of Induction and Suppression of Enzymes and Transporters
The Future of In Vitro Systems for the Assessment of Induction and Suppression of Enzymes and Transporters AAPS, San Diego November 6 th, 2014 Andrew Parkinson, XPD Consulting Lisa Almond, Simcyp-Certara
Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4
Khozoie et al. BMC Genomics 2012, 13:665 RESEARCH ARTICLE Open Access Analysis of the peroxisome proliferator-activated receptor-β/δ (PPARβ/δ) cistrome reveals novel co-regulatory role of ATF4 Combiz Khozoie
Role of the Brain-Lung Axis in Fatigue
Role of the Brain-Lung Axis in Fatigue Y.S. Prakash, M.D., Ph.D. Professor of Anesthesiology and Physiology Chair, Department of Physiology & BME Mayo Clinic Rochester, Minnesota, USA Fatigue in Chronic
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Targeting MAT2A in MTAP-deleted Cancers
Targeting MAT2A in MTAP-deleted Cancers Presented at the American Association for Cancer Research (AACR) Annual Meeting, April 14-18, 2018, Chicago, IL, USA 1 Acknowledgements Agios 2017 Founders Day Retreat
PUBLICATIONS. cells. J. Physiol. (London) 517P:91P (Manchester, England, UK).
277 PUBLICATIONS Abstracts Haddad JJ, Land SC (1999). Differential activation of oxygen-responsive transcription factors over fetal-to-neonatal alveolar oxygen tensions in rat fetal distal lung epithelial
FANNP 28TH NATIONAL NNP SYMPOSIUM: CLINICAL UPDATE AND REVIEW OCTOBER 17-21, 2017
Pulse Oximetry in the Delivery Room: Principles and Practice GS2 3 Jonathan P. Mintzer, MD, FAAP Assistant Professor of Pediatrics Stony Brook Children s Hospital, Division of Neonatal-Perinatal Medicine,
SUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
The Role of Aryl Hydrocarbon Receptor in Mono-Substituted Isopropylated Triaryl Phosphate-Induced Cardiac Toxicity in Zebrafish
The Role of Aryl Hydrocarbon Receptor in Mono-Substituted Isopropylated Triaryl Phosphate-Induced Cardiac Toxicity in Zebrafish Cory V. Gerlach Mentor: Dr. Robert Tanguay Bioresource Research, University
CB2-mediated immunoregulation in Inflammatory Bowel Disease. David Ziring, MD Clinical Instructor, UCLA Div of Peds GI
CB2-mediated immunoregulation in Inflammatory Bowel Disease David Ziring, MD Clinical Instructor, UCLA Div of Peds GI Overview Why study cannabinoid signaling in intestinal immunoregulation? G_i2 -/- mice
Balancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
UDP-GLUCURONOSYLTRANSFERASE (UGT) 1A1 EXPRESSION IN SKIN AND ROLE OF UVB IN INDUCTION OF UGT1A1 IN THE NEONATAL HYPERBILIRUBINEMIA
UDP-GLUCURONOSYLTRANSFERASE (UGT) 1A1 EXPRESSION IN SKIN AND ROLE OF UVB IN INDUCTION OF UGT1A1 IN THE NEONATAL HYPERBILIRUBINEMIA * Bijay Kumar Sah and Prof. Dr. Zhao-Lin Dept. of Pediatrics, The 2 nd
Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors
Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The
Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535
Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05732 SUPPLEMENTARY INFORMATION Supplemental Data Supplement Figure Legends Figure S1. RIG-I 2CARD undergo robust ubiquitination a, (top) At 48 h posttransfection with a GST, GST-RIG-I-2CARD
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
Combination therapy with simeprevir and TMC647055/low dose ritonavir: dose anticipation using PBPK modeling and dose optimization in healthy subjects
Combination therapy with simeprevir and TMC647055/low dose ritonavir: dose anticipation using PBPK modeling and dose optimization in healthy subjects MC. Rouan, J. Snoeys, S. Ouwerkerk-Mahadevan, R. Verloes,
Effect of BD Matrigel Matrix Overlay and BD Matrigel Matrix Thin Coat on CYP450 Activities in Cryo Human Hepatocytes. Rongjun Zuo.
Effect of BD Matrigel Matrix Overlay and BD Matrigel Matrix Thin Coat on CYP450 Activities in Cryo Human Hepatocytes Rongjun Zuo November 10, 2010 Topics Overview of Hepatocyte Products P450 Induction
Interleukin 17 (IL-17)-producing T helper cells (Th17) are a
Aryl hydrocarbon receptor regulates Stat1 activation and participates in the development of Th17 cells Akihiro Kimura*, Tetsuji Naka, Keiko Nohara, Yoshiaki Fujii-Kuriyama, and Tadamitsu Kishimoto* *Laboratory
Transgenic Humanized AHR Mouse Reveals Differences between Human and Mouse AHR Ligand Selectivity
PharmSight TM DOI: 10.4255/mcpharmacol.09.15 Molecular and Cellular Pharmacology www.mcpharmacol.com Transgenic Humanized AHR Mouse Reveals Differences between Human and Mouse AHR Ligand Selectivity Colin
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Dose Response Approaches for Nuclear Receptor Mediated Modes of Action Workshop Preliminary Report
Dose Response Approaches for Nuclear Receptor Mediated Modes of Action Workshop Preliminary Report Workshop Organizing Committee 2 Major Goals of the Workshop Determine whether the biology of nuclear receptors
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
In Vivo Models and Cell Delivery for Lung Indications NO DISCLOSURES
In Vivo Models and Cell Delivery for Lung Indications Marlowe Eldridge MD Department of Pediatrics and Biomedical Engineering University of Wisconsin School of Medicine and Public Health NO DISCLOSURES
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
/05/$15.00/0 Molecular Endocrinology 19(5): Copyright 2005 by The Endocrine Society doi: /me
0888-8809/05/$15.00/0 Molecular Endocrinology 19(5):1343 1360 Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: 10.1210/me.2003-0493 Elevated Glucose Attenuates Human Insulin Gene Promoter
Prediction of invasiveness of hepatic tumor cells
Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator
Supplemental Figure 1
1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer
Glutathione Regulation
The Virtual Free Radical School Glutathione Regulation Dale A. Dickinson 1, Henry Jay Forman 1 and Shelly C. Lu 2 1 University of California, Merced, School of Natural Sciences, P.O. Box 2039, Merced,
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
The Search for Endogenous Activators of the Aryl Hydrocarbon Receptor
102 Chem. Res. Toxicol. 2008, 21, 102 116 The Search for Endogenous Activators of the Aryl Hydrocarbon Receptor Linh P. Nguyen and Christopher A. Bradfield* McArdle Laboratory for Cancer Research, UniVersity
Genetic suppressors and enhancers provide clues to gene regulation and genetic pathways
Genetic suppressors and enhancers provide clues to gene regulation and genetic pathways Suppressor mutation: a second mutation results in a less severe phenotype than the original mutation Suppressor mutations
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of PHD3 in a Diverse Set of Malignant Cells Abstract The prolyl-hydroxylase domain family of enzymes (PHD1-3) plays an important
Evaluation of STAT3 Signaling in Macrophages Using a Lentiviral Reporter System
Evaluation of STAT3 Signaling in Macrophages Using a Lentiviral Reporter System Schwertfeger Laboratory Emily Hartsough Breast Cancer Prevalence Adapted from Siegel et. al Cancer Statistics. 2016 Tumor
Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Disrupted Sleep Awakes Cancer Progression & Invasiveness
Disrupted Sleep Awakes Cancer Progression & Invasiveness Fahed Hakim, MD Pediatric Pulmonary Division, Mayer Children s Hospital Section of Sleep Medicine,The University of Chicago The Brain, Sleep and
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
Investigating the versatility of a primary fish gill cell culture system for environmental monitoring
Investigating the versatility of a primary fish gill cell culture system for environmental monitoring Matteo Minghetti, Sabine Schnell, Christer Hogstrand, Nic Bury Fish Gill In vitro Cell culture System
Transcriptional regulation of the human hepatic lipase (LIPC) gene promoter
Transcriptional regulation of the human hepatic lipase (LIPC) gene promoter Laura E. Rufibach, 1, * Stephen A. Duncan, Michele Battle, and Samir S. Deeb* Departments of Medical Genetics and Genome Sciences,*
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:
Probiotic bacteria: mechanisms of action?
Probiotic bacteria: mechanisms of action? Probiotic derived antibacterial substances (microcins) Competitive inhibition of pathogens Modulation of inflammatory responses: Increasing antiinflammatory cytokine
Supplemental Figure 1
mrn/ mirn expression 3.5 3.5.5.5 +Jagged mir-5+jagged Supplemental Figure HS mir-5 Z H HS mir-5 Z H HS mir-5 Z H HM MF PT HM JG HS Percentage of 4-44 + cells (%) mrn/mirn 8 6 4.5.5.5 mir-5 sh-jg +Jagged
TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway
AWARD NUMBER: W81XWH-12-1-0560 TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway PRINCIPAL INVESTIGATOR: Andrew S. Kraft, MD CONTRACTING ORGANIZATION:
Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535
Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive
BIOMARKERS AND TOXICITY MECHANISMS 07 Mechanisms Metabolism & Detoxification. Luděk Bláha, PřF MU, RECETOX
BIOMARKERS AND TOXICITY MECHANISMS 07 Mechanisms Metabolism & Detoxification Luděk Bláha, PřF MU, RECETOX www.recetox.cz Metabolism and detoxification Chemicals enter body... mostly via food Pass directly
Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators
/, 2017, Vol. 8, (No. 53), pp: 91425-91444 Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators Roni Sarkar 1 and Subhash C. Verma 1 1 Department of Microbiology
La farmacologia dei CDK4/6 inibitori
La farmacologia dei CDK4/6 inibitori Romano Danesi UO Farmacologia clinica e Farmacogenetica Università di Pisa The role of cyclin D CDK4/6 p16 Rb pathway in the cell cycle Debu Tripathy et al. Clin Cancer
Constitutive Regulation of P450s by Endocrine Factors
References: Constitutive Regulation of P450s by Endocrine Factors Meyer UA. Endo-xenobiotic crosstalk and the regulation of cytochromes P450. Drug Metab Rev 39:639-46, 2007. Waxman DJ and O Connor C. Growth
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Aseptic lung inflammation, mouse models and methods of investigation
HELENA Lecture Series: Lung Biology and Disease Aseptic lung inflammation, mouse models and methods of investigation Tobias Stöger - Dynamics of pulmonary inflammation November 12, 2015 Inflammation, a
The Aryl Hydrocarbon receptor and intestinal immunity: an overview of ligands derived from microbial metabolism and food
The Aryl Hydrocarbon receptor and intestinal immunity: an overview of ligands derived from microbial metabolism and food Fleur de Mooij 3257843 Master thesis Toxicology and Environmental Health Supervisors:
supplementary information
DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient
Supplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
Ready-to-use Lentiviral Particles for intracelular labeling
Ready-to-use Lentiviral Particles for intracelular labeling (LocLight TM Living cell imaging lentivirus for sub-cellular localization) LocLight TM cell organelle labeling lentivirus are provided as 200ul/per
Adrenalectomy and Glucocorticoid Effects on the Rat Hepatic Aryl Hydrocarbon Receptor Pathway and the Response to Aromatic Hydrocarbons
Adrenalectomy and Glucocorticoid Effects on the Rat Hepatic Aryl Hydrocarbon Receptor Pathway and the Response to Aromatic Hydrocarbons by Anne K. Mullen Grey A thesis submitted in conformity with the
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene
Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene YUELIN ZHANG, WEIHUA FAN, MARK KINKEMA, XIN LI, AND
Chronic Lung Disease Of Prematurity. Dr Jo Harrison
Chronic Lung Disease Of Prematurity Dr Jo Harrison 9.9.14 Chronic Neonatal Lung Disease Bronchopulmonary dysplasia (BPD) first described in 1967 by Northway Defined as O 2 dependence at 28 days post birth
SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric*
SensoLyte 520 HDAC Activity Assay Kit *Fluorimetric* Catalog # 72084 Kit Size 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect HDAC activity. Enhanced Value: It provides
Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages
Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Supplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
Mechanistic Toxicology
SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi
P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)